Gene Details:

  • Gene ID: AT4G26466
  • Gene Symbol: LRE
  • Gene Name: LORELEI
  • Description: lorelei;(source:Araport11)
  • TAIR Accession:
  • Genome: Araport11_genome_release
  • Species: Arabidopsis thaliana

Transcripts:

Germplasm Phenotype:

  • CS66101  — Reduced seed set.
  • CS66102  — Reduced seed set due to defects in pollen tube reception, double fertilization and early seed development.
  • CS66103  — Reduced seed set.
  • CS66104  — Reduced seed set.
  • CS66107  — Reduced seed set due to defects in pollen tube reception, double fertilization and early seed development.
  • CS69692  — No visible phenotype. The cYFP is expressed in synergid cells.
  • CS69693  — No visible phenotype. The cYFP is expressed in synergid cells.
  • CS69694  — No visible phenotype. The cYFP is expressed in synergid cells.
  • CS69695  — No visible phenotype. The cYFP is expressed in synergid cells.
  • CS69696  — No visible phenotype. The cYFP is expressed in synergid cells.
  • CS69697  — No visible phenotype. The cYFP is expressed in synergid cells.
  • CS69698  — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
  • CS69699  — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
  • CS69700  — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
  • CS69701  — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
  • CS69702  — No visible phenotype. The cYFP is expressed in synergid cells.
  • CS69703  — No visible phenotype. The cYFP is expressed in synergid cells.
  • CS69704  — No visible phenotype. The cYFP is expressed in synergid cells.
  • CS69705  — Reduced seed set. The cYFP is expressed in synergid cells.
  • CS69706  — Reduced seed set. The cYFP is expressed in synergid cells.
  • CS69707  — Reduced seed set. The cYFP is expressed in synergid cells.
  • CS69708  — Reduced seed set. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
  • CS69709  — Reduced seed set. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
  • CS69710  — Reduced seed set. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
  • CS69717  — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
  • CS69718  — No visible phenotype. The cYFP is expressed diffusely in the cytoplasm of synergid cells.
  • lre-1/+  — Approximately 20% of embryo sacs show invasion by multiple pollen tubes. About 25% of embryo sacs abort. Morphology and development of the embryo sacs appears normal.

Literature:

Sequences:

cDNA Sequence
  • >AT4G26466.1
    ATGGAGCTGATATTATTATTCTTCTTTCTGATGGCACTGTTGGTATCTCTCTCCTCTTCAAGTTCCATATCGGATGGTGTGTTTGAATCACAAACCTCGGTTAGTGGAAGGAACCTTCGTCATGCCAAGAAAAAATGTGAAGTGAACTTTGAGTATATGGACTACAAGGTCTTGACAAAGAGGTGCAAAGGTCCAGCGTTTCCAGCCAAAGAATGTTGCTCTGCTTTTAAAGAATTTGCATGTCCTTACGTGAGTCAGATCAACGACATGAATAGTGATTGTGCACAGACAATGTTCAGCTACATGAATATTTATGGAAACTACCCTACTGGCCTTTTCGCTAACGAGTGCAGAGAAAGGAAAGATGGGCTTGTTTGCCCTTTACCACCTCTCTATTCACATAACCTAAACGCCTCAACTGCTGATTCGACTCCTCGTTTTATCTCGCTGTTGATCTCTGCTGCAACCGCTGTTTTTGCTTTGTTAGTGTTGACTTGATCAATCAAAGGAAATTGAAA
CDS Sequence
Protein Sequence