Gene Details:
- Gene ID: AT4G25820
- Gene Symbol: ATXTH14, XTH14, XTR9
- Gene Name: xyloglucan endotransglucosylase/hydrolase 14, xyloglucan endotransglycosylase 9
- Description: xyloglucan endotransglucosylase/hydrolase 14;(source:Araport11)
- TAIR Accession: locus:2117492
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0020031 — radicle — radícula (Spanish, exact), 幼根 (Japanese, exact)
- PO:0000256 — root hair cell — célula del pelo de la raíz (Spanish, exact), 根毛細胞 (Japanese, exact)
- PO:0000262 — trichoblast — tricoblasto (Spanish, exact), 根毛形成細胞、トリコブラスト (Japanese, exact), hair cell (related)
Gene Ontology:
- GO:0048589 — acts upstream of or within — developmental growth
- GO:0005576 — located in — extracellular region
- GO:0048364 — acts upstream of or within — root development
- GO:0090558 — acts upstream of or within — plant epidermis development
- GO:0030247 — enables — polysaccharide binding
- GO:0010411 — involved in — xyloglucan metabolic process
- GO:0071554 — acts upstream of or within — cell wall organization or biogenesis
- GO:0004553 — enables — hydrolase activity, hydrolyzing O-glycosyl compounds
- GO:0016762 — enables — xyloglucan:xyloglucosyl transferase activity
- GO:0030154 — acts upstream of or within — cell differentiation
- GO:0042546 — involved in — cell wall biogenesis
Germplasm Phenotype:
Function-related keywords:
- root , radicle , root hair cell , trichoblast
Literature:
- In vitro activities of four xyloglucan endotransglycosylases from Arabidopsis. DOI: 10.1046/j.1365-313x.1999.00459.x ; PMID: 10406121
- A comprehensive expression analysis of all members of a gene family encoding cell-wall enzymes allowed us to predict cis-regulatory regions involved in cell-wall construction in specific organs of Arabidopsis. DOI: 10.1093/pcp/pce154 ; PMID: 11673616
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Transcriptional divergence of the duplicated oxidative stress-responsive genes in the Arabidopsis genome. DOI: 10.1111/j.1365-313X.2004.02295.x ; PMID: 15634198
- and darkness-regulated Arabidopsis genes: a focus on calmodulin-like and XTH genes. DOI: 10.1111/j.1469-8137.2004.01238.x ; PMID: 15720654
- Characterization of a novel putative zinc finger gene MIF1: involvement in multiple hormonal regulation of Arabidopsis development. DOI: 10.1111/j.1365-313X.2005.02626.x ; PMID: 16412086
- The Arabidopsis NFYA5 transcription factor is regulated transcriptionally and posttranscriptionally to promote drought resistance. DOI: 10.1105/tpc.108.059444 ; PMID: 18682547
- Light quality-mediated petiole elongation in Arabidopsis during shade avoidance involves cell wall modification by xyloglucan endotransglucosylase/hydrolases. DOI: 10.1104/pp.110.162057 ; PMID: 20688978
- A gene regulatory network for root epidermis cell differentiation in Arabidopsis. DOI: 10.1371/journal.pgen.1002446 ; PMID: 22253603
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
Sequences:
cDNA Sequence
- >AT4G25820.1
AAATCCATCGACAAAGACTTACCTCTCACGGCGAGAAACAACAGAGAATCGGGGAAAAATGGCGTGTTTCGCAACCAAACAGCCTCTGTTGTTGTCTCTCCTCCTTGCCATTGGCTTCTTTGTGGTGGCTGCATCTGCCGGAAACTTCTATGAGAGCTTTGATATCACTTGGGGTAATGGTCGTGCCAACATATTCGAGAATGGACAGCTTCTCACTTGTACTCTTGACAAGGTCTCCGGCTCAGGTTTTCAATCCAAGAAGGAGTACTTGTTTGGTAAGATCGACATGAAGCTCAAGCTTGTCGCTGGAAACTCTGCTGGCACCGTCACCGCCTACTACCTATCGTCAAAAGGCACGGCATGGGATGAGATTGACTTCGAGTTTTTGGGAAATCGCACAGGACATCCTTACACTATCCACACCAATGTGTTCACCGGAGGTAAAGGCGACCGTGAGATGCAGTTCCGTCTCTGGTTCGATCCCACTGCGGATTTCCACACCTACACCGTCCACTGGAACCCTGTTAACATCATCTTCCTTGTGGATGGGATCCCAATTCGGGTGTTCAAGAACAACGAGAAAAATGGGGTGGCTTACCCTAAGAACCAGCCGATGAGGATATACTCAAGCCTTTGGGAAGCCGATGACTGGGCTACAGAAGGCGGTCGCGTGAAGATCGACTGGAGCAACGCACCATTCAAGGCCTCTTACAGAAACTTCAACGACCAAAGCTCATGCAGCAGGACATCAAGCTCAAAATGGGTGACTTGCGAGCCAAACAGCAACTCGTGGATGTGGACGACTCTCAATCCTGCCCAGTACGGAAAAATGATGTGGGTGCAACGAGACTTCATGATCTACAACTATTGTACCGATTTTAAGAGATTCCCTCAAGGCCTCCCCAAGGAGTGTAAACTTTGATTCTATTATGGGAATTTTCAAGCATTTTTCTTTCCGTTTTGTTTCATCTTGTGATGTTACTTTGATTTATTTTGTTCTTTCTTTTGGTGTTTCTGAGATACGATATTACATGTATACGTATTCTTCCTGAGAAAATAAGAAGTTGTATTACTCGATAATACATTTTATCTCTCAATGTGGTGTGATTGTTTATTGGGTTTGGCGTACAATGAAAGCTACATCAATGTGCTTTAGAAAAATGCATA
CDS Sequence
Protein Sequence