Information report for AT4G25560
Gene Details
|
|
Functional Descriptions
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0010018 — acts upstream of or within — far-red light signaling pathway
- GO:0005515 — enables — protein binding
- GO:0009639 — acts upstream of or within — response to red or far red light
- GO:0045893 — acts upstream of or within — positive regulation of DNA-templated transcription
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0005634 — located in — nucleus
- GO:0005634 — is active in — nucleus
- laf1 — Elongated hypocotyl in far-red light
Functional Keywords
Literature and News
- Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.1998.00278.x ; PMID: 9839469
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The R2R3-MYB gene family in Arabidopsis thaliana. DOI: 10.1016/s1369-5266(00)00199-0 ; PMID: 11597504
- LAF1, a MYB transcription activator for phytochrome A signaling. DOI: 10.1101/gad.915001 ; PMID: 11581165
- HFR1 is targeted by COP1 E3 ligase for post-translational proteolysis during phytochrome A signaling. DOI: 10.1101/gad.1247205 ; PMID: 15741320
- Repression of light signaling by Arabidopsis SPA1 involves post-translational regulation of HFR1 protein accumulation. DOI: 10.1111/j.1365-313X.2005.02433.x ; PMID: 15960622
- The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. DOI: 10.1007/s11103-005-2910-y ; PMID: 16463103
- LAF1 ubiquitination by COP1 controls photomorphogenesis and is stimulated by SPA1. DOI: 10.1038/nature01696 ; PMID: 12827204
- Independent and interdependent functions of LAF1 and HFR1 in phytochrome A signaling. DOI: 10.1101/gad.1568207 ; PMID: 17699755
- FAR-RED ELONGATED HYPOCOTYL1 and FHY1-LIKE associate with the Arabidopsis transcription factors LAF1 and HFR1 to transmit phytochrome A signals for inhibition of hypocotyl elongation. DOI: 10.1105/tpc.109.067215 ; PMID: 19482971
- Three transcription factors, HFR1, LAF1 and HY5, regulate largely independent signaling pathways downstream of phytochrome A. DOI: 10.1093/pcp/pct042 ; PMID: 23503597
- phyB and HY5 are Involved in the Blue Light-Mediated Alleviation of Dormancy of Arabidopsis Seeds Possibly via the Modulation of Expression of Genes Related to Light, GA, and ABA. DOI: 10.3390/ijms20235882 ; PMID: 31771191
- Nucleo-plastidic PAP8/pTAC6 couples chloroplast formation with photomorphogenesis. DOI: 10.15252/embj.2020104941 ; PMID: 33001465
- Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. DOI: 10.1046/j.1365-313x.1998.00278.x ; PMID: 9839469
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
- The MYB transcription factor superfamily of Arabidopsis: expression analysis and phylogenetic comparison with the rice MYB family. DOI: 10.1007/s11103-005-2910-y ; PMID: 16463103
Gene Resources
- UniProt: A0A1P8B4Z5
- EMBL: CP002687
- AlphaFoldDB: A0A1P8B4Z5
- EnsemblPlants: AT4G25560.2
- Gramene: AT4G25560.2
- Orthologous matrix: TEMMINN
- ExpressionAtlas: AT4G25560
- InterPro: IPR001005, IPR009057, IPR017930
- PANTHER: PTHR47997, PTHR47997:SF11
- SUPFAM: SSF46689
- PROSITE: PS50090, PS51294
- Gene3D: 1.10.10.60
- OrthoDB: A0A1P8B4Z5
- SWISS-MODEL: A0A1P8B4Z5
- Conserved Domain Database: cd00167
Sequences
cDNA Sequence
- >AT4G25560.2
GAGTCAACTTTGATAATTGTTGTTGGGATTTAATTTGATAGGGTTACAAAGGAATGGGAAGAGCTGCAGATTAAGATGGATTAATTACCTAAGACCAGGGTTAAAGAGGGATATGATTAGTGCAGAAGAAGAAGAGACTATCTTGACGTTTCATTCTTCCTTGGGTAACAAGTGGTCGCAAATAGCTAAATTCTTACCGGGAAGAACAGACAATGAGATAAAGAACTATTGGCACTCTCATTTGAAAAAGAAATGGCTCAAGTCTCAGAGCTTACAAGATGCAAAATCTATTTCCCCTCCTTCGTCTTCATCATCATCACTTGTTGCTTGTGGAAAAAGAAATCCGGAAACCTTGATCTCGAATCACGTGTTCTCCTTCCAGAGACTTCTAGAGAACAAATCTTCATCTCCCTCACAAGAAAGCAACGGAAATAACAGCCATCAATGTTCTTCTGCTCCTGAGATTCCAAGGCTTTTCTTCTCTGAATGGCTTTCTTCTTCATATCCCCACACCGATTATTCCTCTGAGTTTACCGACTCTAAGCACAGTCAAGCTCCAAATGTCGAAGAGACTCTCTCAGCTTATGAAGAAATGGGTGATGTTGATCAGTTCCATTACAACGAAATGATGATCAACAACAGCAACTGGACTCTTAACGACATTGTGTTTGGTTCCAAATGTAAGAAGCAGGAGCATCATATTTATAGAGAGGCTTCAGATTGTAATTCTTCTGCTGAATTCTTTTCTCCATCAACAACGACGTAAATTGCGTTTATTGTAATGTAAATCAAATTTCTAAGGCAAAACCGGAA - >AT4G25560.1
GAGTCAACTTTGATAATTGTTGTTGGGATTTAATTTGATAGGGTTACAAAGGAATGGGAAGAGCTGCAGATTAAGATGGATTAATTACCTAAGACCAGGGTTAAAGAGGGATATGATTAGTGCAGAAGAAGAAGAGACTATCTTGACGTTTCATTCTTCCTTGGGTAACAAGTGGTCGCAAATAGCTAAATTCTTACCGGGAAGAACAGACAATGAGATAAAGAACTATTGGCACTCTCATTTGAAAAAGAAATGGCTCAAGTCTCAGAGCTTACAAGATGCAAAATCTATTTCCCCTCCTTCGTCTTCATCATCATCACTTGTTGCTTGTGGAAAAAGAAATCCGGAAACCTTGATCTCGAATCACGTGTTCTCCTTCCAGAGACTTCTAGAGAACAAATCTTCATCTCCCTCACAAGAAAGCAACGGAAATAACAGCCATCAATGTTCTTCTGCTCCTGAGATTCCAAGGCTTTTCTTCTCTGAATGGCTTTCTTCTTCATATCCCCACACCGATTATTCCTCTGAGTTTACCGACTCTAAGCACAGTCAAGCTCCAAATGTCGAAGAGACTCTCTCAGCTTATGAAGAAATGGGTGATGTTGATCAGTTCCATTACAACGAAATGATGATCAACAACAGCAACTGGACTCTTAACGACATTGTGTTTGGTTCCAAATGTAAGAAGCAGGAGCATCATATTTATAGAGAGGCTTCAGATTGTAATTCTTCTGCTGAATTCTTTTCTCCATCAACAACGACGTAAATTGCGTTTATTGTAATGTAAATCAAATTTCTAAGGCAAAACCGGAA
CDS Sequence
Protein Sequence