Gene Details:
- Gene ID: AT4G25420
- Gene Symbol: AT2301, ATGA20OX1, GA20OX1, GA5
- Gene Name: ARABIDOPSIS THALIANA GIBBERELLIN 20-OXIDASE 1, gibberellin 20 oxidase 1, GA REQUIRING 5
- Description: 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein;(source:Araport11)
- TAIR Accession: locus:2005511
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Gene Ontology:
- GO:0009686 — involved in — gibberellin biosynthetic process
- GO:0009826 — involved in — unidimensional cell growth
- GO:0045544 — enables — gibberellin 20-oxidase activity
- GO:0048575 — acts upstream of or within — short-day photoperiodism, flowering
- GO:0009739 — acts upstream of or within — response to gibberellin
- GO:0009908 — acts upstream of or within — flower development
- GO:0009686 — acts upstream of or within — gibberellin biosynthetic process
- GO:0009908 — involved in — flower development
- GO:0009740 — acts upstream of or within — gibberellic acid mediated signaling pathway
- GO:0009826 — acts upstream of or within — unidimensional cell growth
- GO:0005737 — located in — cytoplasm
- GO:0048366 — acts upstream of or within — leaf development
- GO:0009416 — involved in — response to light stimulus
Germplasm Phenotype:
- CS16549 — Dwarf phenotype of ga5-1 plants was rescued by the introduction of a wild-type copy of the gene in the 35S::GA5/ga5-1 transgenic plants.
- CS2110211 — dwarf plants; need GA treatment for germination; late flowering
- CS62 — dwarf, responsive to gibberellin; gibberellin not required for germination.
- CS6520 — late flowering phenotype (delay in the transition to flowering is relatively stronger under long day than under short day light conditions), dark-green rosettes with increased number of leaves; very bright green stems and siliques, complete absence of lobed plates and tube-shaped structures on the epicuticular wax layer; dwarf (12-17 cm height), responsive to gibberellin, gibberellin not required for germination; abscisic acid resistant, reduced sensitivity to ABA inhibition of germination.
- ga5-3 — semidwarf
Function-related keywords:
- guard cell , flower , leaf apex , pollen
Literature:
- Genetic analysis of growth-regulator-induced parthenocarpy in Arabidopsis. DOI: 10.1104/pp.121.2.437 ; PMID: 10517835
- Feedback regulation of GA5 expression and metabolic engineering of gibberellin levels in Arabidopsis. DOI: 10.1105/tpc.11.5.927 ; PMID: 10330476
- Gibberellins and stem growth in Arabidopsis thaliana. Effects of photoperiod on expression of the GA4 and GA5 loci. DOI: 10.1104/pp.114.4.1471 ; PMID: 9276956
- The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression. DOI: 10.1073/pnas.92.14.6640 ; PMID: 7604047
- Isolation and expression of three gibberellin 20-oxidase cDNA clones from Arabidopsis. DOI: 10.1104/pp.108.3.1049 ; PMID: 7630935
- GASA, a gibberellin-regulated gene family from Arabidopsis thaliana related to the tomato GAST1 gene. DOI: 10.1007/BF00020227 ; PMID: 7727751
- Endogenous gibberellins in Arabidopsis thaliana and possible steps blocked in the biosynthetic pathways of the semidwarf ga4 and ga5 mutants. DOI: 10.1073/pnas.87.20.7983 ; PMID: 2236013
- Control of specific gene expression by gibberellin and brassinosteroid. DOI: 6843 ; PMID: 11598220
- Gibberellin response mutants identified by luciferase imaging. DOI: 10.1046/j.1365-313x.2001.00980.x ; PMID: 11309141
- The Metabolism of Gibberellin A20 to Gibberellin A1 by Tall and Dwarf Mutants of Oryza sativa and Arabidopsis thaliana. DOI: 10.1104/pp.106.4.1367 ; PMID: 12232414
- Drought Rhizogenesis in Arabidopsis thaliana (Differential Responses of Hormonal Mutants). DOI: 10.1104/pp.104.2.761 ; PMID: 12232124
- Metabolism and Biological Activity of Gibberellin A4 in Vegetative Shoots of Zea mays, Oryza sativa, and Arabidopsis thaliana. DOI: 10.1104/pp.102.2.379 ; PMID: 12231829
- The involvement of gibberellin 20-oxidase genes in phytochrome-regulated petiole elongation of Arabidopsis. DOI: 10.1104/pp.104.059055 ; PMID: 15923331
- Overexpression of ADC2 in Arabidopsis induces dwarfism and late-flowering through GA deficiency. DOI: 10.1111/j.1365-313X.2005.02465.x ; PMID: 16045477
- Overexpression of a protein phosphatase 2C from beech seeds in Arabidopsis shows phenotypes related to abscisic acid responses and gibberellin biosynthesis. DOI: 10.1104/pp.106.084681 ; PMID: 16815952
- ATHB23, an Arabidopsis class I homeodomain-leucine zipper gene, is expressed in the adaxial region of young leaves. DOI: 10.1007/s00299-007-0340-9 ; PMID: 17387478
- Arabidopsis Ovate Family Protein 1 is a transcriptional repressor that suppresses cell elongation. DOI: 10.1111/j.1365-313X.2007.03096.x ; PMID: 17461792
- Overproduction of OsSLRL2 alters the development of transgenic Arabidopsis plants. DOI: 10.1016/j.bbrc.2007.04.205 ; PMID: 17521606
- The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle. DOI: 10.1111/j.1365-313X.2007.03356.x ; PMID: 18069939
- Expression of gibberellin 20-oxidase1 (AtGA20ox1) in Arabidopsis seedlings with altered auxin status is regulated at multiple levels. DOI: 10.1093/jxb/ern063 ; PMID: 18440929
- A study of gibberellin homeostasis and cryptochrome-mediated blue light inhibition of hypocotyl elongation. DOI: 10.1104/pp.107.099838 ; PMID: 17644628
- Major flowering time gene, flowering locus C, regulates seed germination in Arabidopsis thaliana. DOI: 10.1073/pnas.0901367106 ; PMID: 19564609
- Dynamic landscapes of four histone modifications during deetiolation in Arabidopsis. DOI: 10.1105/tpc.109.066845 ; PMID: 20008096
- Increased leaf size: different means to an end. DOI: 10.1104/pp.110.156018 ; PMID: 20460583
- DBB1a, involved in gibberellin homeostasis, functions as a negative regulator of blue light-mediated hypocotyl elongation in Arabidopsis. DOI: 10.1007/s00425-010-1274-y ; PMID: 20872270
- Evolutionary analysis of three gibberellin oxidase genes in rice, Arabidopsis, and soybean. DOI: 10.1016/j.gene.2010.10.010 ; PMID: 21056641
- Expression of an Oncidium gene encoding a patatin-like protein delays flowering in Arabidopsis by reducing gibberellin synthesis. DOI: 10.1093/pcp/pcq206 ; PMID: 21217124
- Combining enhanced root and shoot growth reveals cross talk between pathways that control plant organ size in Arabidopsis. DOI: 10.1104/pp.110.167049 ; PMID: 21205622
- A gain-of-function mutation in IAA7/AXR2 confers late flowering under short-day light in Arabidopsis. DOI: 10.1111/j.1744-7909.2011.01050.x ; PMID: 21564544
- Arabidopsis ovate family proteins, a novel transcriptional repressor family, control multiple aspects of plant growth and development. DOI: 10.1371/journal.pone.0023896 ; PMID: 21886836
- A MADS-box gene is specifically expressed in fibers of cotton (Gossypium hirsutum) and influences plant growth of transgenic Arabidopsis in a GA-dependent manner. DOI: 10.1016/j.plaphy.2013.12.003 ; PMID: 24374505
- Transgenic hybrid aspen trees with increased gibberellin (GA) concentrations suggest that GA acts in parallel with FLOWERING LOCUS T2 to control shoot elongation. DOI: 10.1111/nph.13144 ; PMID: 25382585
- The Arabidopsis MYB96 transcription factor plays a role in seed dormancy. DOI: 10.1007/s11103-015-0283-4 ; PMID: 25616734
- Gibberellin driven growth in elf3 mutants requires PIF4 and PIF5. DOI: 10.4161/15592324.2014.992707 ; PMID: 25738547
- Genetic analyses of the interaction between abscisic acid and gibberellins in the control of leaf development in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2015.04.009 ; PMID: 26025539
- The KNOTTED-like genes of peach (Prunus persica L. Batsch) are differentially expressed during drupe growth and the class 1 KNOPE1 contributes to mesocarp development. DOI: 10.1016/j.plantsci.2015.05.005 ; PMID: 26089153
- Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis. DOI: 10.1105/tpc.15.00433 ; PMID: 26243314
- Interplay between ABA and GA Modulates the Timing of Asymmetric Cell Divisions in the Arabidopsis Root Ground Tissue. DOI: 10.1016/j.molp.2016.02.009 ; PMID: 26970019
- Gibberellins are involved in effect of near-null magnetic field on Arabidopsis flowering. DOI: 10.1002/bem.22004 ; PMID: 27598690
- Differential Cellular Control by Cotyledon-Derived Phytohormones Involved in Graft Reunion of Arabidopsis Hypocotyls. DOI: 10.1093/pcp/pcw177 ; PMID: 27986917
- Colonization by the endophyte Piriformospora indica leads to early flowering in Arabidopsis thaliana likely by triggering gibberellin biosynthesis. DOI: 10.1016/j.bbrc.2017.06.169 ; PMID: 28668394
- PIL5 represses floral transition in Arabidopsis under long day conditions. DOI: 10.1016/j.bbrc.2018.03.179 ; PMID: 29588173
- DELLA proteins negatively regulate dark-induced senescence and chlorophyll degradation in Arabidopsis through interaction with the transcription factor WRKY6. DOI: 10.1007/s00299-018-2282-9 ; PMID: 29574486
- Reduction of the geomagnetic field delays Arabidopsis thaliana flowering time through downregulation of flowering-related genes. DOI: 10.1002/bem.22123 ; PMID: 29709075
- Plastidial Phosphoglucose Isomerase Is an Important Determinant of Seed Yield through Its Involvement in Gibberellin-Mediated Reproductive Development and Storage Reserve Biosynthesis in Arabidopsis. DOI: 10.1105/tpc.18.00312 ; PMID: 30099384
- A gene-stacking approach to overcome the trade-off between drought stress tolerance and growth in Arabidopsis. DOI: 10.1111/tpj.14110 ; PMID: 30285298
- Class I TCP Transcription Factors Target the Gibberellin Biosynthesis Gene GA20ox1 and the Growth-Promoting Genes HBI1 and PRE6 during Thermomorphogenic Growth in Arabidopsis. DOI: 10.1093/pcp/pcz137 ; PMID: 31292642
- AtPER1 enhances primary seed dormancy and reduces seed germination by suppressing the ABA catabolism and GA biosynthesis in Arabidopsis seeds. DOI: 10.1111/tpj.14542 ; PMID: 31536657
- NAC-Like Gene GIBBERELLIN SUPPRESSING FACTOR Regulates the Gibberellin Metabolic Pathway in Response to Cold and Drought Stresses in Arabidopsis. DOI: 10.1038/s41598-019-55429-8 ; PMID: 31848381
- Aquaporin AtTIP5;1 as an essential target of gibberellins promotes hypocotyl cell elongation in Arabidopsis thaliana under excess boron stress. DOI: 10.1071/FP16444 ; PMID: 32290954
- Nitrate Promotes Germination Under Inhibition by NaCl or High Concentration of Glucose. DOI: 10.3390/plants9060707 ; PMID: 32498308
- Ectopic expression of the Arabidopsis florigen gene FLOWERING LOCUS T in seeds enhances seed dormancy via the GA and DOG1 pathways. DOI: 10.1111/tpj.15354 ; PMID: 34037275
- Near-Null Magnetic Field Suppresses Fruit Growth in Arabidopsis. DOI: 10.1002/bem.22363 ; PMID: 34289513
- Gibberellin regulates UV-B-induced hypocotyl growth inhibition in Arabidopsis thaliana. DOI: 10.1080/15592324.2021.1966587 ; PMID: 34463604
- DELLA-GAF1 complex is involved in tissue-specific expression and gibberellin feedback regulation of GA20ox1 in Arabidopsis. DOI: 10.1007/s11103-021-01195-z ; PMID: 34562198
- Histone Deacetylase HDA15 Restrains PHYB-Dependent Seed Germination via Directly Repressing GA20ox1/2 Gene Expression. DOI: 10.3390/cells11233788 ; PMID: 36497048
- Functional Mapping of Genes Modulating Plant Shade Avoidance Using Leaf Traits. DOI: 10.3390/plants12030608 ; PMID: 36771692
- Histone Deacetylases Regulate MORE AXILLARY BRANCHED 2-Dependent Germination of Arabidopsis thaliana. DOI: 10.1093/pcp/pcad047 ; PMID: 37279553
- The GA5 locus of Arabidopsis thaliana encodes a multifunctional gibberellin 20-oxidase: molecular cloning and functional expression. DOI: 10.1073/pnas.92.14.6640 ; PMID: 7604047
- The involvement of gibberellin 20-oxidase genes in phytochrome-regulated petiole elongation of Arabidopsis. DOI: 10.1104/pp.104.059055 ; PMID: 15923331
- Overexpression of ADC2 in Arabidopsis induces dwarfism and late-flowering through GA deficiency. DOI: 10.1111/j.1365-313X.2005.02465.x ; PMID: 16045477
- Overexpression of a protein phosphatase 2C from beech seeds in Arabidopsis shows phenotypes related to abscisic acid responses and gibberellin biosynthesis. DOI: 10.1104/pp.106.084681 ; PMID: 16815952
- Arabidopsis Ovate Family Protein 1 is a transcriptional repressor that suppresses cell elongation. DOI: 10.1111/j.1365-313X.2007.03096.x ; PMID: 17461792
- Overproduction of OsSLRL2 alters the development of transgenic Arabidopsis plants. DOI: 10.1016/j.bbrc.2007.04.205 ; PMID: 17521606
- High temperature-induced abscisic acid biosynthesis and its role in the inhibition of gibberellin action in Arabidopsis seeds. DOI: 10.1104/pp.107.113738 ; PMID: 18162586
- The gibberellin biosynthetic genes AtGA20ox1 and AtGA20ox2 act, partially redundantly, to promote growth and development throughout the Arabidopsis life cycle. DOI: 10.1111/j.1365-313X.2007.03356.x ; PMID: 18069939
- Expression of gibberellin 20-oxidase1 (AtGA20ox1) in Arabidopsis seedlings with altered auxin status is regulated at multiple levels. DOI: 10.1093/jxb/ern063 ; PMID: 18440929
Sequences:
cDNA Sequence
- >AT4G25420.1
TTGATAACTCCATTACAGACTATAGTATTGTACTACTAGAAAACAAAAACAACAAAAAAAGAAGTGGACAACACTATACGATCGACTTAAATGCTTGCTTATATAAAGACTAAAAGGACCATTGGTTCCCGTATCTCCTCGCAATACTACTACTCACTTTACTATAATCTCTCAAAATGGCCGTAAGTTTCGTAACAACATCTCCTGAGGAAGAAGACAAACCGAAGCTAGGCCTTGGAAATATTCAAACTCCGTTAATCTTCAACCCTTCAATGCTTAACCTTCAAGCCAATATCCCAAACCAATTCATCTGGCCTGACGACGAAAAACCTTCCATCAACGTTCTCGAGCTTGATGTTCCTCTCATCGACCTTCAAAACCTTCTCTCTGATCCATCCTCCACTTTAGATGCTTCGAGACTGATCTCTGAGGCCTGTAAGAAGCACGGTTTCTTCCTCGTGGTCAATCACGGCATCAGCGAGGAGCTTATTTCAGACGCTCATGAATACACGAGCCGCTTCTTTGATATGCCTCTCTCCGAAAAACAGAGGGTTCTTAGAAAATCCGGTGAGAGTGTTGGCTACGCAAGCAGTTTCACCGGACGCTTCTCCACCAAGCTTCCATGGAAGGAGACCCTTTCTTTCCGGTTTTGCGACGACATGAGCCGCTCAAAATCCGTTCAAGATTACTTCTGCGATGCGTTGGGACATGGGTTTCAGCCATTTGGGAAGGTGTATCAAGAGTATTGTGAAGCAATGAGTTCTCTATCACTGAAGATCATGGAGCTTCTGGGGCTAAGTTTAGGCGTAAAACGGGACTACTTTAGAGAGTTTTTCGAAGAAAACGATTCAATAATGAGACTGAATTACTACCCTCCATGTATAAAACCAGATCTCACACTAGGAACAGGACCTCATTGTGATCCAACATCTCTTACCATCCTTCACCAAGACCATGTTAATGGCCTTCAAGTCTTTGTGGAAAATCAATGGCGCTCCATTCGTCCCAACCCCAAGGCCTTTGTGGTCAATATCGGCGATACTTTCATGGCTCTATCGAACGATAGATACAAGAGCTGCTTGCACCGGGCGGTGGTGAACAGCGAGAGCGAGAGGAAATCACTTGCATTCTTCTTGTGTCCGAAAAAAGACAGAGTAGTGACGCCACCGAGAGAGCTTTTGGACAGCATCACATCAAGAAGATACCCTGACTTCACATGGTCTATGTTCCTTGAGTTCACTCAGAAACATTATAGAGCAGACATGAACACTCTCCAAGCCTTTTCAGATTGGCTCACCAAACCCATCTAAGAAATAAAATATTCATGTCTTGTCTTGTTAGTTACTAGTATCTTCTTTATATTTCATGTATGTATATGGTAATAGGCAATAACACCTTTTAGCATCTCATTTATAAAATCTATCCGTTAAACTAAAATACT - >AT4G25420.2
TTGATAACTCCATTACAGACTATAGTATTGTACTACTAGAAAACAAAAACAACAAAAAAAGAAGTGGACAACACTATACGATCGACTTAAATGCTTGCTTATATAAAGACTAAAAGGACCATTGGTTCCCGTATCTCCTCGCAATACTACTACTCACTTTACTATAATCTCTCAAAATGGCCGTAAGTTTCGTAACAACATCTCCTGAGGAAGAAGACAAACCGAAGCTAGGCCTTGGAAATATTCAAACTCCGTTAATCTTCAACCCTTCAATGCTTAACCTTCAAGCCAATATCCCAAACCAATTCATCTGGCCTGACGACGAAAAACCTTCCATCAACGTTCTCGAGCTTGATGTTCCTCTCATCGACCTTCAAAACCTTCTCTCTGATCCATCCTCCACTTTAGATGCTTCGAGACTGATCTCTGAGGCCTGTAAGAAGCACGGTTTCTTCCTCGTGGTCAATCACGGCATCAGCGAGGAGCTTATTTCAGACGCTCATGAATACACGAGCCGCTTCTTTGATATGCCTCTCTCCGAAAAACAGAGGGTTCTTAGAAAATCCGGTGAGAGTGTTGGCTACGCAAGCAGTTTCACCGGACGCTTCTCCACCAAGCTTCCATGGAAGGAGACCCTTTCTTTCCGGTTTTGCGACGACATGAGCCGCTCAAAATCCGTTCAAGATTACTTCTGCGATGCGTTGGGACATGGGTTTCAGCCATTTGGGAAGGTGTATCAAGAGTATTGTGAAGCAATGAGTTCTCTATCACTGAAGATCATGGAGCTTCTGGGGCTAAGTTTAGGCGTAAAACGGGACTACTTTAGAGAGTTTTTCGAAGAAAACGATTCAATAATGAGACTGAATTACTACCCTCCATGTATAAAACCAGATCTCACACTAGGAACAGGACCTCATTGTGATCCAACATCTCTTACCATCCTTCACCAAGACCATGTTAATGGCCTTCAAGTCTTTGTGGAAAATCAATGGCGCTCCATTCGTCCCAACCCCAAGGCCTTTGTGGTCAATATCGGCGATACTTTCATGGCTCTATCGAACGATAGATACAAGAGCTGCTTGCACCGGGCGGTGGTGAACAGCGAGAGCGAGAGGAAATCACTTGCATTCTTCTTGTGTCCGAAAAAAGACAGAGTAGTGACGCCACCGAGAGAGCTTTTGGACAGCATCACATCAAGAAGATACCCTGACTTCACATGGTCTATGTTCCTTGAGTTCACTCAGAAACATTATAGAGCAGACATGAACACTCTCCAAGCCTTTTCAGATTGGCTCACCAAACCCATCTAAGAAATAAAATATTCATGTCTTGTCTTGTTAGTTACTAGTATCTTCTTTATATTTCATGTATGTATATGGTAATAGGCAATAACACCTTTTAGCATCTCATTTATAAAATCTATCCGTTAAACTAAAATACT
CDS Sequence
Protein Sequence