Gene Details:
- Gene ID: AT4G25200
- Gene Symbol: ATHSP23.6-MITO, HSP23.6-MITO
- Gene Name: mitochondrion-localized small heat shock protein 23.6, mitochondrion-localized small heat shock protein 23.6
- Description: mitochondrion-localized small heat shock protein 23.6;(source:Araport11)
- TAIR Accession: locus:2122649
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
Gene Ontology:
- GO:0050832 — acts upstream of or within — defense response to fungus
- GO:0010286 — acts upstream of or within — heat acclimation
- GO:0071310 — acts upstream of or within — cellular response to organic substance
- GO:0014070 — acts upstream of or within — response to organic cyclic compound
- GO:0007165 — acts upstream of or within — signal transduction
- GO:0003674 — enables — molecular_function
- GO:0009507 — located in — chloroplast
Function-related keywords:
Literature:
- Cell cycle-regulated gene expression in Arabidopsis. DOI: 10.1074/jbc.M207570200 ; PMID: 12169696
- Diverse RNA viruses elicit the expression of common sets of genes in susceptible Arabidopsis thaliana plants. DOI: 10.1046/j.1365-313x.2003.01625.x ; PMID: 12535341
- Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome. DOI: 10.1104/pp.103.028241 ; PMID: 14500793
- Clp protease complexes from photosynthetic and non-photosynthetic plastids and mitochondria of plants, their predicted three-dimensional structures, and functional implications. DOI: 10.1074/jbc.M309212200 ; PMID: 14593120
- Gene trapping with firefly luciferase in Arabidopsis. Tagging of stress-responsive genes. DOI: 10.1104/pp.103.027151 ; PMID: 14730060
- Harpin inactivates mitochondria in Arabidopsis suspension cells. DOI: 10.1094/MPMI.2004.17.2.131 ; PMID: 14964527
- When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress. DOI: 10.1104/pp.103.033431 ; PMID: 15047901
- 12-oxo-phytodienoic acid triggers expression of a distinct set of genes and plays a role in wound-induced gene expression in Arabidopsis. DOI: 10.1104/pp.105.067058 ; PMID: 16258017
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Identification and characterization of a stress-inducible and a constitutive small heat-shock protein targeted to the matrix of plant peroxisomes. DOI: 10.1104/pp.105.073841 ; PMID: 16531488
- Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. DOI: 10.1111/j.1365-313X.2006.02889.x ; PMID: 17059409
- A heat-inducible transcription factor, HsfA2, is required for extension of acquired thermotolerance in Arabidopsis. DOI: 10.1104/pp.106.091322 ; PMID: 17085506
- Detoxification of the explosive 2,4,6-trinitrotoluene in Arabidopsis: discovery and C-glucosyltransferases. DOI: 10.1111/j.1365-313X.2008.03653.x ; PMID: 18702669
- The AtHSP17.4C1 Gene Expression Is Mediated by Diverse Signals that Link Biotic and Abiotic Stress Factors with ROS and Can Be a Useful Molecular Marker for Oxidative Stress. DOI: 10.3390/ijms20133201 ; PMID: 31261879
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
Sequences:
cDNA Sequence
- >AT4G25200.1
CCCCACTTCTCCAGAACATTCACTCACTGACAATATCCCACCTTCAACACTTAACTCCTGTATATAGTCCTCCCCTGTCTCCAGTTTCGTCGCACACAGTTCTCAGATAAATACTAAACTCACTGTTAAAACTTTCTCAACAAAGCTTCCTGTTTCTCTACAAATGGCATCTGCTCTCGCTCTTAAGAGACTCCTATCATCCTCCATCGCTCCACGTTCCCGTAGTGTTCTTCGTCCAGCTGTTTCCTCTCGCCTCTTCAACACCAACGCCGTTAGGAGCTACGACGACGACGGCGAAAATGGAGACGGCGTTGATTTATATCGCCGCTCTGTTCCTCGCCGCCGTGGTGATTTCTTCTCAGATGTGTTTGATCCGTTTTCGCCGACGAGGAGCGTTAGTCAAGTGCTGAATCTGATGGACCAGTTCATGGAGAATCCTCTGTTATCAGCTACTCGTGGCATGGGAGCTTCAGGAGCTCGTCGTGGTTGGGATATAAAAGAGAAAGACGATGCTCTGTACCTGAGAATCGACATGCCTGGGCTGAGCAGAGAGGATGTGAAGCTGGCTTTGGAGCAGGACACTCTGGTGATTAGAGGAGAAGGAAAAAACGAGGAAGATGGTGGCGAGGAAGGAGAGAGCGGTAATCGGAGATTCACAAGCAGGATTGGATTACCGGATAAGATTTACAAGATCGATGAGATTAAGGCGGAGATGAAGAACGGAGTGTTGAAAGTTGTGATCCCGAAGATGAAAGAACAAGAGAGAAATGATGTTCGTCAGATCGAGATCAACTAAAAACGTCGACGTTTTTTTCTGTTCTAGTTTTGTTGATAGGTCTTTGAATAAGAAGTGTGTGTAGTTTGGCACGGTCGATGTTGAGTCATGTAGTCTCTAAAGACTAAAAGGTTATATGTTTCTTTCTTGAGACGGTGGTTTTTTGTCTTGCTTAAACCAAAATTTGCATTCCAAATCAAAGCACTAATTAAATAAGTTCCTAATCGTGTATTCTTTTAGCTAACTCGGTCGGTTTACATGCCTTTGTGGTTA
CDS Sequence
Protein Sequence