AT4G24670

Gene Details

Gene ID: AT4G24670
Gene Symbol: AtTAR2, TAR2
Gene Name: tryptophan aminotransferase related 2
Description: tryptophan aminotransferase related 2;(source:Araport11)
TAIR Accession: locus:2121999
Genome: Araport11_genome_release
Species: Arabidopsis thaliana

Functional Descriptions

PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)

GO:0042742 — acts upstream of or within — defense response to bacterium
GO:0048527 — acts upstream of or within — lateral root development
GO:0048825 — acts upstream of or within — cotyledon development
GO:0009793 — acts upstream of or within — embryo development ending in seed dormancy
GO:0048367 — acts upstream of or within — shoot system development
GO:0009908 — acts upstream of or within — flower development
GO:0016846 — enables — carbon-sulfur lyase activity
GO:0008483 — enables — transaminase activity
GO:0009723 — acts upstream of or within — response to ethylene
GO:0010588 — acts upstream of or within — cotyledon vascular tissue pattern formation
GO:0043562 — acts upstream of or within — cellular response to nitrogen levels
GO:0005789 — located in — endoplasmic reticulum membrane
GO:0009684 — acts upstream of or within — indoleacetic acid biosynthetic process
GO:0010087 — acts upstream of or within — phloem or xylem histogenesis
GO:0010078 — acts upstream of or within — maintenance of root meristem identity
GO:0006520 — involved in — amino acid metabolic process
GO:0048467 — acts upstream of or within — gynoecium development
GO:0050362 — enables — L-tryptophan:2-oxoglutarate aminotransferase activity
GO:0009958 — acts upstream of or within — positive gravitropism
GO:0080022 — acts upstream of or within — primary root development
GO:0080097 — enables — L-tryptophan:pyruvate aminotransferase activity

CS16404 — No visible phenotype.
CS16405 — No visible phenotype.
CS16406 — No visible phenotype.
CS16410 — No visible phenotype.
CS16411 — No visible phenotype.
CS16413 — Segregates ~1/4 of wei8-1 tar2-1 double mutant plants that show agravitropic ethylene-insensitive roots and reduced apical hook angles after 3 days in the dark; ~1/2 of wei8-1 tar2-1/+ that develop normal hooks but have ethylene insensitive roots; ~1/4 of wei8-1 that display weak ethylene insensitivity in roots; adult plants in double mutants show dwarfism, reduced apical dominance, venation defects, abnormal flowers and sterility.
CS16414 — Segregates ~1/4 of wei8-1 tar2-1 double mutant plants that show agravitropic ethylene-insensitive roots and reduced apical hook angles after 3 days in the dark; ~3/4 of wild-type-like seedlings; adult double mutant plants show dwarfism, reduced apical dominance, venation defects, abnormal flowers and sterility.
CS16415 — Segregates ~3/4 seedlings (1/4 wei8-1 tar2-2 and 3/4 wei8-1 tar2-2/+) that show moderate ethylene insensitivity in roots and ~1/4 seedlings (wei8-1) that display weak ethylene insensitivity in roots of 3-day-old dark-grown seedlings; adult double mutant plants show reduced apical dominance, venation defects, abnormal flowers and sterility.
CS16416 — Segregates ~1/4 of wei8-1 tar2-2 double mutant plants that show moderate ethylene insensitivity in roots of 3-day-old etiolated seedlings and ~3/4 of wild-type-like seedlings; adult double mutant plants show reduced apical dominance, venation defects, abnormal flowers and sterility.
CS16417 — Segregates ~1/4 of wei8-2 tar2-1 double mutant plants that show agravitropic ethylene-insensitive roots and reduced apical hook angles after 3 days in the dark; ~1/2 of wei8-2 tar2-1/+ that develop normal hooks but have ethylene insensitive roots; ~1/4 of wei8-2 that display weak ethylene insensitivity in roots; adult double mutant plants show dwarfism, reduced apical dominance, venation defects, abnormal flowers and sterility.
CS16418 — Segregates ~3/4 seedlings (1/4 wei8-2 tar2-2 and 3/4 wei8-2 tar2-2/+) that show moderate ethylene insensitivity in roots and ~1/4 seedlings (wei8-2) that display weak ethylene insensitivity in roots of 3-day-old dark-grown seedlings.
CS16419 — Segragegates ~1/4 of monopteros-like seedlings (wei8-1 tar1-1 tar2-1 triple mutant plants), ~1/2 of seedlings with moderately ethylene-insensitive roots after 3 days in the dark (wei8-1 tar1-1 tar2-1/+), and ~1/4 of weakly ethylene insensitive seedlings (wei8-1 tar1-1 double mutant plants); triple mutant plants do not survive on soil.
CS16420 — Segragegates ~1/4 of monopteros-like seedlings (wei8-1 tar1-1 tar2-2 triple mutant plants), ~1/2 of seedlings with moderately ethylene-insensitive roots after 3 days in the dark (wei8-1 tar1-1 tar2-2/+), and ~1/4 of weakly ethylene insensitive seedlings (wei8-1 tar1-1 double mutant plants); some of the triple mutant plants survive on soil and adults show reduced apical dominance, venation defects, abnormal flowers and sterility.
CS16422 — Segregates triple mutant plants; ethylene insensitivity of wei8 tar2 seedlings is partially alleviated by sur2, but adults defects of wei8 tar2 (reduced apical dominance, venation defects, abnormal flowers and sterility) are not.
CS16423 — Segregates triple mutant plants; ethylene insensitivity of wei8 tar2 seedlings is partially alleviated by rty1; adult triple mutant plants are lethal.
CS16424 — Segregates triple mutant plants; ethylene insensitivity of wei8 tar2 seedlings is partially alleviated by rty1; adult triple mutant plants are lethal.
CS16426 — Plants show constitutive triple response in the absence of ethylene (ctr1-like phenotype).
CS16427 — Plants show constitutive triple response in the absence of ethylene (ctr1-like phenotype).
CS16430 — Segregates triple mutant plants that show partial triple response in seedlings (short hypocotyls, long and agravitropic roots, open apical hooks); adult triple mutant plants display dwarfism, reduced apical dominance, venation defects, abnormal flowers and sterility.
CS16431 — Segregates triple mutant plants that show partial triple response in seedlings (short hypocotyls, long and agravitropic roots, open apical hooks); adult triple mutant plants display dwarfism, reduced apical dominance, venation defects, abnormal flowers and sterility.
SALK_021258C — This mutant does not have any obvious morphological defects and it responds normally to ACC and IAA in hypocotyl and root elongation assays.
tar2-2 — This mutant does not have any obvious morphological defects and it responds normally to ACC and IAA.
tar2-3 — This mutant does not have any obvious morphological defects and it responds normally to ACC and IAA.
wei8-1 tar1-1 tar2-1 — These triple mutants do not make a primary root, they have an extremely reduced hypocotyl, and they lack discernible vasculature in their cotyledons. These mutants have a higher propensity to develop a single cotyledon than wild-type embryos.
wei8-1 tar2-1 — The roots of this mutant show almost no sensitivity to the ethylene precursor ACC, but sensitivity is largely restored by the addition of low levels of IAA (but not tryptophan). ACC-triggered dark-grown apical hook formation is also compromised in this mutant, and it is not restored by the addition of IAA. Root gravitropism is more disrupted in this double mutant than in either single mutant. The mutant plants are shorter than wild type, have reduced venation in their leaves, exhibit reduced apical dominance, and produce abnormal flowers. DR5:GUS expression is also diminished in these double mutants, consistent with a ~50% reduction in IAA levels in these mutants. Root meristematic cells differentiate in this mutant, leading to a loss of the stem cell niche and the cessation of root growth.
wei8-1 tar2-2 — ACC-triggered dark-grown apical hook formation is compromised in this mutant. Root meristematic cells differentiate in this mutant, leading to a loss of the stem cell niche and the cessation of root growth. This mutant also lacks valves in the gynoecia.

Functional Keywords

Literature and News

Gene Resources

Sequences

cDNA Sequence

>AT4G24670.1
CTTAAAATCGTGATTGGTAATATTTATGAGTTAAGTACATGAGTTAGGTTCGTAATCCAATATAAACACATTGTTATACATACCTTTATCTCTTGAGATTCTTCAAGGGTTATTTTAATCTCTTACAAAAATCATAACTTCGAATATCAGCCAAAAAAAGGATCAGTCTCGTTGGACACCACTTGTTTGTTTCCTTTGTTTTTTTTAAAAGAGGTCTTTATCCAGCTATCCCACTCTGCTCTTCTTCTTTAAGCATTTTGCATTCTTGTTTCTTGGTTTTGTGTTTTAGTTTTGAGAGAAAATGGGACAGATTCCGAGGTTTCTTTCTTGGAGGAATATGTTGGTCCTCTCGTTGGCCATCAACTTCAGCTTGATTCTAAAGATTTTGAAGGGTGATAGAGAACGAGGAGATTCATGGGACAGAACAGCGTATGTTAGCATATGGCCCGTGGTATCCACCACGGCTTCAGAATCTTCTTCGTTGTCTTCAGCATCTTGCAACTATAGCAAGATTGAAGAAGACGATGATAGAATTATCAATCTCAAATTTGGTGATCCAACGGTGTATGAGAGATATTGGCAGGAAAATGGAGAGGTGACAACAATGGTGATACCTGGATGGCAATCTCTTAGCTATTTTTCAGATGAAAACAACCTCTGTTGGTTTCTTGAGCCAGAGCTTGCCAAAGAGATTGTGAGGGTGCATAAGGTTGTTGGGAATGCTGTAACGCAAGACCGCTTCATTGTTGTTGGCACTGGCTCAACACAATTGTATCAGGCTGCTCTCTATGCTCTCTCCCCACATGATGACTCCGGTCCCATTAATGTCGTGTCAGCCACACCCTATTATAGTACATACCCGTTGATTACAGACTGCCTCAAATCAGGTTTATATCGATGGGGTGGAGATGCAAAGACGTACAAAGAAGATGGTCCATACATTGAACTTGTTACATCTCCAAACAACCCTGATGGGTTCTTGAGAGAATCAGTAGTGAACAGTACTGAAGGTATATTGATCCATGATTTGGCTTACTATTGGCCACAGTATACACCGATAACATCACCAGCTGATCACGATGTTATGCTCTTCACTGCTTCAAAGAGCACTGGCCATGCAGGGATACGGATTGGATGGGCTTTGGTGAAAGACAGAGAGACGGCTAGGAAAATGATAGAGTACATTGAACTCAACACGATTGGGGTTTCAAAGGACTCACAGCTTAGAGTAGCCAAGGTTCTTAAGGTTGTGTCAGACAGTTGTGGGAATGTAACGGGCAAATCTTTCTTTGACCATAGTTATGATGCTATGTATGAGAGGTGGAAACTATTGAAACAAGCAGCAAAGGATACTAAACGTTTCAGTGTTCCTGATTTCGTCTCTCAACGTTGCAATTTCTTTGGCAGGGTCTTTGAGCCACAACCAGCATTTGCATGGTTTAAGTGTGAAGAAGGGATAGTGGATTGTGAGAAGTTTCTTAGAGAGGAGAAGAAGATTCTAACTAAAAGTGGAAAGTACTTCGGAGATGAGCTAAGTAATGTGAGGATAAGCATGTTGGATAGAGATACTAACTTTAATATTTTCCTTCACAGGATTACATCTTCCTTTAATTCAACTTTGTAAGTGCATATGCATGTGATTATGATCGATTGTCATAACTTGCAACAAGTGTTTTGCTCCATAAATATTATTGGAAATTTGAATAATGTGAAGGATCAATCAAAGACCTATTCATCAAACCATCTCTGATGATATGAATGAGCAAACATTCATTCACTACGACACAACCGAGAGTTTGTTCAAGCGTTGTCAGCATTTTGGTCTGGAACTTTGTAATCTCGAAGGATCAGATCCAACATCTCATAGCTTTTTCAGTATTAAATTCCAGCCTTAGGTAATCCTTCAGAGTCATATCAACATTTTTGCTACGGAAGGATCATTGTCGCTACCTTCCATTTTACATTTGTGTCAGCTTTATTCACAGCACCGTTTTTTAGCCGCATCAACTTTCTTTCTTTGTATAATTCAGAAG
>AT4G24670.2
CTTAAAATCGTGATTGGTAATATTTATGAGTTAAGTACATGAGTTAGGTTCGTAATCCAATATAAACACATTGTTATACATACCTTTATCTCTTGAGATTCTTCAAGGGTTATTTTAATCTCTTACAAAAATCATAACTTCGAATATCAGCCAAAAAAAGGATCAGTCTCGTTGGACACCACTTGTTTGTTTCCTTTGTTTTTTTTAAAAGAGGTCTTTATCCAGCTATCCCACTCTGCTCTTCTTCTTTAAGCATTTTGCATTCTTGTTTCTTGGTTTTGTGTTTTAGTTTTGAGAGAAAATGGGACAGATTCCGAGGTTTCTTTCTTGGAGGAATATGTTGGTCCTCTCGTTGGCCATCAACTTCAGCTTGATTCTAAAGATTTTGAAGGGTGATAGAGAACGAGGAGATTCATGGGACAGAACAGCGTATGTTAGCATATGGCCCGTGGTATCCACCACGGCTTCAGAATCTTCTTCGTTGTCTTCAGCATCTTGCAACTATAGCAAGATTGAAGAAGACGATGATAGAATTATCAATCTCAAATTTGGTGATCCAACGGTGTATGAGAGATATTGGCAGGAAAATGGAGAGGTGACAACAATGGTGATACCTGGATGGCAATCTCTTAGCTATTTTTCAGATGAAAACAACCTCTGTTGGTTTCTTGAGCCAGAGCTTGCCAAAGAGATTGTGAGGGTGCATAAGGTTGTTGGGAATGCTGTAACGCAAGACCGCTTCATTGTTGTTGGCACTGGCTCAACACAATTGTATCAGGCTGCTCTCTATGCTCTCTCCCCACATGATGACTCCGGTCCCATTAATGTCGTGTCAGCCACACCCTATTATAGTACATACCCGTTGATTACAGACTGCCTCAAATCAGGTTTATATCGATGGGGTGGAGATGCAAAGACGTACAAAGAAGATGGTCCATACATTGAACTTGTTACATCTCCAAACAACCCTGATGGGTTCTTGAGAGAATCAGTAGTGAACAGTACTGAAGGTATATTGATCCATGATTTGGCTTACTATTGGCCACAGTATACACCGATAACATCACCAGCTGATCACGATGTTATGCTCTTCACTGCTTCAAAGAGCACTGGCCATGCAGGGATACGGATTGGATGGGCTTTGGTGAAAGACAGAGAGACGGCTAGGAAAATGATAGAGTACATTGAACTCAACACGATTGGGGTTTCAAAGGACTCACAGCTTAGAGTAGCCAAGGTTCTTAAGGTTGTGTCAGACAGTTGTGGGAATGTAACGGGCAAATCTTTCTTTGACCATAGTTATGATGCTATGTATGAGAGGTGGAAACTATTGAAACAAGCAGCAAAGGATACTAAACGTTTCAGTGTTCCTGATTTCGTCTCTCAACGTTGCAATTTCTTTGGCAGGGTCTTTGAGCCACAACCAGCATTTGCATGGTTTAAGTGTGAAGAAGGGATAGTGGATTGTGAGAAGTTTCTTAGAGAGGAGAAGAAGATTCTAACTAAAAGTGGAAAGTACTTCGGAGATGAGCTAAGTAATGTGAGGATAAGCATGTTGGATAGAGATACTAACTTTAATATTTTCCTTCACAGGATTACATCTTCCTTTAATTCAACTTTGTAAGTGCATATGCATGTGATTATGATCGATTGTCATAACTTGCAACAAGTGTTTTGCTCCATAAATATTATTGGAAATTTGAATAATGTGAAGGATCAATCAAAGACCTATTCATCAAACCATCTCTGATGATATGAATGAGCAAACATTCATTCACTACGACACAACCGAGAGTTTGTTCAAGCGTTGTCAGCATTTTGGTCTGGAACTTTGTAATCTCGAAGGATCAGATCCAACATCTCATAGCTTTTTCAGTATTAAATTCCAGCCTTAGGTAATCCTTCAGAGTCATATCAACATTTTTGCTACGGAAGGATCATTGTCGCTACCTTCCATTTTACATTTGTGTCAGCTTTATTCACAGCACCGTTTTTTAGCCGCATCAACTTTCTTTCTTTGTATAATTCAGAAG

CDS Sequence

Protein Sequence