Gene Details:
- Gene ID: AT4G24650
- Gene Symbol: ATIPT4, IPT4
- Gene Name: ARABIDOPSIS THALIANA ISOPENTENYLTRANSFERASE 4, isopentenyltransferase 4
- Description: isopentenyltransferase 4;(source:Araport11)
- TAIR Accession: locus:2121979
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009089 — endosperm — albumen (exact), endosperma (Spanish, exact), 内胚乳、胚乳 (Japanese, exact)
Gene Ontology:
- GO:0009824 — enables — AMP dimethylallyltransferase activity
- GO:0009691 — acts upstream of or within — cytokinin biosynthetic process
- GO:0005634 — located in — nucleus
- GO:0005515 — enables — protein binding
- GO:0006400 — involved in — tRNA modification
- GO:0005739 — is active in — mitochondrion
- GO:0005829 — located in — cytosol
- GO:0052622 — enables — ATP dimethylallyltransferase activity
- GO:0052623 — enables — ADP dimethylallyltransferase activity
- GO:0009691 — involved in — cytokinin biosynthetic process
- GO:0052381 — enables — tRNA dimethylallyltransferase activity
Germplasm Phenotype:
- atipt1 atipt 3 atipt4 atipt5-1 atipt6 atipt7 atipt8 — Thin, small plants.
- atipt1 atipt 4 atipt 6 atipt 8 — No visible phenotype.
- atipt4 atipt 6 atipt 8 — No visible phenotype.
- atipt4-1 — No visible phenotype.
- atipt4-2 — No visible phenotype.
Function-related keywords:
Literature:
- Identification of plant cytokinin biosynthetic enzymes as dimethylallyl diphosphate:ATP/ADP isopentenyltransferases. DOI: 10.1093/pcp/pce112 ; PMID: 11479373
- Monitoring genome-wide changes in gene expression in response to endogenous cytokinin reveals targets in Arabidopsis thaliana. DOI: 10.1016/s0014-5793(03)01194-3 ; PMID: 14623097
- Immediate-early and delayed cytokinin response genes of Arabidopsis thaliana identified by genome-wide expression profiling reveal novel cytokinin-sensitive processes and suggest cytokinin action through transcriptional cascades. DOI: 10.1111/j.1365-313X.2005.02530.x ; PMID: 16212609
- A transcriptome-based characterization of habituation in plant tissue culture. DOI: 10.1104/pp.105.076059 ; PMID: 16489130
- Roles of Arabidopsis ATP/ADP isopentenyltransferases and tRNA isopentenyltransferases in cytokinin biosynthesis. DOI: 10.1073/pnas.0603522103 ; PMID: 17062755
- Modulation of the hormone setting by Rhodococcus fascians results in ectopic KNOX activation in Arabidopsis. DOI: 10.1104/pp.107.113969 ; PMID: 18184732
- Agrobacterium tumefaciens increases cytokinin production in plastids by modifying the biosynthetic pathway in the host plant. DOI: 10.1073/pnas.0500793102 ; PMID: 15998742
- Cytokinin overproduction-caused alteration of flower development is partially mediated by CUC2 and CUC3 in Arabidopsis. DOI: 10.1016/j.gene.2009.11.003 ; PMID: 19913077
- Expression of cytokinin biosynthetic isopentenyltransferase genes in Arabidopsis: tissue specificity and regulation by auxin, cytokinin, and nitrate. DOI: 10.1046/j.1365-313x.2003.01945.x ; PMID: 14675438
Sequences:
cDNA Sequence
- >AT4G24650.1
GTAACCAAAATATGATATTAGCATAGCAACATTGTTTGTGTATATTCGTGTTTCTCAATCTCAATTTACGACATGAAGTGTAATGACAAAATGGTTGTGATCATGGGTGCCACCGGTTCTGGCAAGTCATCACTCTCTGTTGATCTCGCTTTACATTTTAAAGCCGAGATCATCAACTCTGACAAAATGCAGTTCTACGATGGCTTGAAGATCACCACGAATCAATCGACCATTGAAGATCGACGTGGAGTGCCACATCACCTTCTCGGTGAACTAAACCCGGAGGCTGGAGAAGTCACAGCGGCAGAATTTCGCGTTATGGCGGCTGAAGCCATCTCCGAGATTACTCAACGTAAAAAGCTCCCAATCCTTGCCGGTGGATCCAACTCATACATTCATGCTCTCCTTGCAAAATCTTATGACCCTGAAAACTATCCGTTTTCTGATCACAAGGGCTCAATCTGCTCCGAGTTGAAATATGATTGTTGTTTCATTTGGATAGATGTGGATCAGTCTGTGTTATTCGAGTATCTTTCTTTACGTTTGGATCTTATGATGAAGTCAGGTATGTTCGAGGAGATCGCTGAGTTCCACCGCTCTAAGAAGGCCCCGAAAGAGCCATTGGGGATATGGAAGGCTATAGGAGTGCAAGAGTTTGATGACTACCTCAAAATGTACAAGTGGGACAATGACATGGATAAATGGGACCCTATGAGAAAGGAGGCTTATGAGAAGGCGGTGAGAGCCATCAAAGAAAACACATTTCAGCTCACAAAGGATCAAATCACGAAGATCAACAAGCTGAGAAATGCCGGGTGGGACATAAAGAAGGTGGATGCTACAGCATCGTTTCGAGAGGCAATTAGGGCAGCCAAGGAAGGCGAAGGTGTAGCCGAGATGCAGAGAAAGATATGGAACAAGGAAGTGTTGGAACCGTGTGTGAAGATTGTCAGGAGCCACTTGGACCAACCGATCAACTATTATTATTATTACTTTTATTTACTAAAAAGATTTTTAAGTCTTAACTAGTTTGGACTAATATCACCGCAA
CDS Sequence
Protein Sequence