Information report for AT4G21980
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- GO:0050832 — acts upstream of or within — defense response to fungus
- GO:0019776 — enables — Atg8-family ligase activity
- GO:0006914 — acts upstream of or within — autophagy
- GO:0005776 — located in — autophagosome
- GO:0019786 — enables — protein-phosphatidylethanolamide deconjugating activity
- GO:0009507 — located in — chloroplast
- GO:0006995 — involved in — cellular response to nitrogen starvation
- GO:0005515 — enables — protein binding
- GO:0005775 — located in — vacuolar lumen
- GO:0005737 — located in — cytoplasm
- GO:0061908 — located in — phagophore
- GO:0019779 — enables — Atg8 activating enzyme activity
Functional Keywords
- root , flower , pollen tube cell , pollen
Literature and News
- The APG8/12-activating enzyme APG7 is required for proper nutrient recycling and senescence in Arabidopsis thaliana. DOI: 10.1074/jbc.M204630200 ; PMID: 12070171
- Leaf senescence and starvation-induced chlorosis are accelerated by the disruption of an Arabidopsis autophagy gene. DOI: 10.1104/pp.011024 ; PMID: 12114572
- Arabidopsis homologues of the autophagy protein Atg8 are a novel family of microtubule binding proteins. DOI: 10.1016/j.febslet.2004.04.088 ; PMID: 15178341
- Processing of ATG8s, ubiquitin-like proteins, and their deconjugation by ATG4s are essential for plant autophagy. DOI: 10.1105/tpc.104.025395 ; PMID: 15494556
- Post-translational regulation in plants employing a diverse set of polypeptide tags. DOI: 10.1042/BST0330393 ; PMID: 15787614
- Autophagic nutrient recycling in Arabidopsis directed by the ATG8 and ATG12 conjugation pathways. DOI: 10.1104/pp.105.060673 ; PMID: 16040659
- Starvation-induced expression of autophagy-related genes in Arabidopsis. DOI: 10.1042/BC20040516 ; PMID: 16354162
- Genome-wide analysis of Arabidopsis responsive transcriptome to nitrogen limitation and its regulation by the ubiquitin ligase gene NLA. DOI: 10.1007/s11103-007-9241-0 ; PMID: 17885809
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- An autophagy-associated Atg8 protein is involved in the responses of Arabidopsis seedlings to hormonal controls and abiotic stresses. DOI: 10.1093/jxb/ern244 ; PMID: 18836138
- Homologs of genes associated with programmed cell death in animal cells are differentially expressed during senescence of Ipomoea nil petals. DOI: 10.1093/pcp/pcp019 ; PMID: 19182226
- A critical role of autophagy in plant resistance to necrotrophic fungal pathogens. DOI: 10.1111/j.1365-313X.2011.04553.x ; PMID: 21395886
- Degradation of the antiviral component ARGONAUTE1 by the autophagy pathway. DOI: 10.1073/pnas.1209487109 ; PMID: 23019378
- The deubiquitinating enzyme AMSH1 and the ESCRT-III subunit VPS2.1 are required for autophagic degradation in Arabidopsis. DOI: 10.1105/tpc.113.113399 ; PMID: 23800962
- Perception of Arabidopsis AtPep peptides, but not bacterial elicitors, accelerates starvation-induced senescence. DOI: 10.3389/fpls.2015.00014 ; PMID: 25667591
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- TRAF Family Proteins Regulate Autophagy Dynamics by Modulating AUTOPHAGY PROTEIN6 Stability in Arabidopsis. DOI: 10.1105/tpc.17.00056 ; PMID: 28351989
- Dicot-specific ATG8-interacting ATI3 proteins interact with conserved UBAC2 proteins and play critical roles in plant stress responses. DOI: 10.1080/15548627.2017.1422856 ; PMID: 29313416
- Overexpression of ATG8 in Arabidopsis Stimulates Autophagic Activity and Increases Nitrogen Remobilization Efficiency and Grain Filling. DOI: 10.1093/pcp/pcy214 ; PMID: 30407574
- The Local Phosphate Deficiency Response Activates Endoplasmic Reticulum Stress-Dependent Autophagy. DOI: 10.1104/pp.18.01379 ; PMID: 30510038
- ATG8-Binding UIM Proteins Define a New Class of Autophagy Adaptors and Receptors. DOI: 10.1016/j.cell.2019.02.009 ; PMID: 30955882
- Cadmium induces reactive oxygen species-dependent pexophagy in Arabidopsis leaves. DOI: 10.1111/pce.13597 ; PMID: 31152467
- Arabidopsis cargo receptor NBR1 mediates selective autophagy of defective proteins. DOI: 10.1093/jxb/erz404 ; PMID: 31494674
- Arabidopsis SINAT Proteins Control Autophagy by Mediating Ubiquitylation and Degradation of ATG13. DOI: 10.1105/tpc.19.00413 ; PMID: 31732704
- Phytopathogen Effectors Use Multiple Mechanisms to Manipulate Plant Autophagy. DOI: 10.1016/j.chom.2020.07.010 ; PMID: 32810441
- C53 is a cross-kingdom conserved reticulophagy receptor that bridges the gap betweenselective autophagy and ribosome stalling at the endoplasmic reticulum. DOI: 10.1080/15548627.2020.1846304 ; PMID: 33164651
- Salicylic acid is a key player of Arabidopsis autophagy mutant susceptibility to the necrotrophic bacterium Dickeya dadantii. DOI: 10.1038/s41598-021-83067-6 ; PMID: 33574453
- Subcellular Localization of Acyl-CoA: Lysophosphatidylethanolamine Acyltransferases (LPEATs) and the Effects of Knocking-Out and Overexpression of Their Genes on Autophagy Markers Level and Life Span of A. thaliana. DOI: 10.3390/ijms22063006 ; PMID: 33809440
- Autophagic Degradation of the 26S Proteasome Is Mediated by the Dual ATG8/Ubiquitin Receptor RPN10 in Arabidopsis. DOI: 10.1016/j.molcel.2021.03.026 ; PMID: 33961777
- A small peptide inhibits siRNA amplification in plants by mediating autophagic degradation of SGS3/RDR6 bodies. DOI: 10.15252/embj.2021108050 ; PMID: 34155657
- Thermopriming-Induced Autophagy in Shoot Apical Meristem of Arabidopsis. DOI: 10.30498/ijb.2021.253616.2901 ; PMID: 35350643
- An Arabidopsis nonhost resistance gene, IMPORTIN ALPHA 2 provides immunity against rice sheath blight pathogen, Rhizoctonia solani. DOI: 10.1016/j.crmicr.2022.100109 ; PMID: 35243446
- Type one protein phosphatase regulates fixed-carbon starvation-induced autophagy in Arabidopsis. DOI: 10.1093/plcell/koac251 ; PMID: 35961047
- TraB family proteins are components of ER-mitochondrial contact sites and regulate ER-mitochondrial interactions and mitophagy. DOI: 10.1038/s41467-022-33402-w ; PMID: 36163196
- The phosphatidylinositol 3-phosphate effector FYVE3 regulates FYVE2-dependent autophagy in Arabidopsis thaliana. DOI: 10.3389/fpls.2023.1160162 ; PMID: 37008475
- An emerging role of non-canonical conjugation of ATG8 proteins in plant response to heat stress. DOI: 10.1080/15548627.2023.2219161 ; PMID: 37246814
- The APG8/12-activating enzyme APG7 is required for proper nutrient recycling and senescence in Arabidopsis thaliana. DOI: 10.1074/jbc.M204630200 ; PMID: 12070171
Gene Resources
- UniProt: A8MS84
- EMBL: CP002687
- AlphaFoldDB: A8MS84
- EnsemblPlants: AT4G21980.2
- Gramene: AT4G21980.2
- ExpressionAtlas: AT4G21980
- InterPro: IPR004241, IPR029071
Sequences
cDNA Sequence
- >AT4G21980.2
ATTAGGAAAACCCTAACTAAATTCCATTATTAATTTCTTTTATAATCCCTTTCTCTTGACATTGACTTCTCTCTCTCGATTCTTCTTCTCCAGTTTCAATCAAACTCAATTTCTTCTCAACGAACCCTAATTTCCAACAAATCGGATTCAGTTTCTTCTTCGGGTATGTTTCTTCTCACCAATAAATTCGAGATCTTTTAGGGTTTTCTGGGTTTGTTTCTCCCCCGATCTAGCAGACGATCGAGTTTATTAATTATGATCTTTGCTTGCTTGAAATTCGCAGAGACTAATCGAATCGCAATGGCTAAGAGTTCCTTCAAGATCTCTAACCCTCTCGAGGCAAGGATGAGTGAATCTTCTCGAATCAGAGAGAAGTACCCTGACAGAATTCCCGTGATTGTGGAGAAGGCTGGACAAAGTGATGTTCCTGACATTGACAAGAAGAAGTATCTTGTACCAGCTGATCTAACAGTGGGACAATTTGTATACGTGGTTCGTAAAAGAATCAAGCTTGGAGCTGAGAAAGCTATTTTTGTCTTTGTTAAGAACACATTGCCTCCAACTGCTGCATTGATGTCTGCGATCTATGAAGAACACAAAGATGAGGATGGGTTCCTCTACATGACTTACAGTGGAGAGAACACTTTTGGATCTCTTACCGTTGCTTGAATAAAAATCGATCTTTGGATGACTTTGATGTACATACATAAATCAGGAAGATAAAGATGTACATTGCTTCCTTCTTTTCTCTGGCTTTTAACTTTGCTTTGGATGTTTGGATATCTTTCCCTTTGGGTTTATTAATCGTCAGAAACTTCTCCTTTTCTTACTTTCCTCTTTTGCTTTTACTTAAATAACATTGATTTTGGGGCTAATGAGTAATGAGTCACTTTC - >AT4G21980.1
ATTAGGAAAACCCTAACTAAATTCCATTATTAATTTCTTTTATAATCCCTTTCTCTTGACATTGACTTCTCTCTCTCGATTCTTCTTCTCCAGTTTCAATCAAACTCAATTTCTTCTCAACGAACCCTAATTTCCAACAAATCGGATTCAGTTTCTTCTTCGGGTATGTTTCTTCTCACCAATAAATTCGAGATCTTTTAGGGTTTTCTGGGTTTGTTTCTCCCCCGATCTAGCAGACGATCGAGTTTATTAATTATGATCTTTGCTTGCTTGAAATTCGCAGAGACTAATCGAATCGCAATGGCTAAGAGTTCCTTCAAGATCTCTAACCCTCTCGAGGCAAGGATGAGTGAATCTTCTCGAATCAGAGAGAAGTACCCTGACAGAATTCCCGTGATTGTGGAGAAGGCTGGACAAAGTGATGTTCCTGACATTGACAAGAAGAAGTATCTTGTACCAGCTGATCTAACAGTGGGACAATTTGTATACGTGGTTCGTAAAAGAATCAAGCTTGGAGCTGAGAAAGCTATTTTTGTCTTTGTTAAGAACACATTGCCTCCAACTGCTGCATTGATGTCTGCGATCTATGAAGAACACAAAGATGAGGATGGGTTCCTCTACATGACTTACAGTGGAGAGAACACTTTTGGATCTCTTACCGTTGCTTGAATAAAAATCGATCTTTGGATGACTTTGATGTACATACATAAATCAGGAAGATAAAGATGTACATTGCTTCCTTCTTTTCTCTGGCTTTTAACTTTGCTTTGGATGTTTGGATATCTTTCCCTTTGGGTTTATTAATCGTCAGAAACTTCTCCTTTTCTTACTTTCCTCTTTTGCTTTTACTTAAATAACATTGATTTTGGGGCTAATGAGTAATGAGTCACTTTC
CDS Sequence
Protein Sequence