Gene Details:
- Gene ID: AT4G21330
- Gene Symbol: DYT1
- Gene Name: DYSFUNCTIONAL TAPETUM 1
- Description: basic helix-loop-helix (bHLH) DNA-binding superfamily protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000229 — flower meristem — floral meristem (exact), mersitema floral (Spanish, exact), 花芽分裂組織 (Japanese, exact), floral apical meristem (related), Poaceae floret meristem (narrow), ear floret meristem (narrow), floret meristem (narrow), tassel floret meristem (narrow)
- PO:0006089 — anther primordium — portion of anther primordium tissue (exact), primordio de la antera (Spanish, exact), 葯原基(可視的) (Japanese, exact)
- PO:0009071 — anther wall tapetum — pollen sac tapetum (exact), portion of anther wall tapetal tissue (exact), tapete (Spanish, exact), 葯壁タペート組織 (Japanese, exact), Poaceae tapetum (narrow), Zea tapetum (narrow)
Function-related keywords:
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. DOI: 10.1093/molbev/msg088 ; PMID: 12679534
- The Arabidopsis basic/helix-loop-helix transcription factor family. DOI: 10.1105/tpc.013839 ; PMID: 12897250
- Update on the basic helix-loop-helix transcription factor gene family in Arabidopsis thaliana. DOI: 10.1105/tpc.151140 ; PMID: 14600211
- Analysis of sequence, map position, and gene expression reveals conserved essential genes for iron uptake in Arabidopsis and tomato. DOI: 10.1104/pp.104.047233 ; PMID: 15531708
- Regulation of Arabidopsis tapetum development and function by DYSFUNCTIONAL TAPETUM1 (DYT1) encoding a putative bHLH transcription factor. DOI: 10.1242/dev.02463 ; PMID: 16831835
- ROXY1 and ROXY2, two Arabidopsis glutaredoxin genes, are required for anther development. DOI: 10.1111/j.1365-313X.2007.03375.x ; PMID: 18036205
- Basic helix-loop-helix transcription factor gene family phylogenetics and nomenclature. DOI: 10.1016/j.diff.2010.02.003 ; PMID: 20219281
- A genetic pathway for tapetum development and function in Arabidopsis. DOI: 10.1111/j.1744-7909.2011.01078.x ; PMID: 21957980
- The Arabidopsis LFR gene is required for the formation of anther cell layers and normal expression of key regulatory genes. DOI: 10.1093/mp/sss024 ; PMID: 22461668
- Pollen wall development: the associated enzymes and metabolic pathways. DOI: 10.1111/j.1438-8677.2012.00706.x ; PMID: 23252839
- Trace concentrations of imazethapyr (IM) affect floral organs development and reproduction in Arabidopsis thaliana: IM-induced inhibition of key genes regulating anther and pollen biosynthesis. DOI: 10.1007/s10646-014-1369-5 ; PMID: 25348600
- DYT1 directly regulates the expression of TDF1 for tapetum development and pollen wall formation in Arabidopsis. DOI: 10.1111/tpj.12694 ; PMID: 25284309
- The DYT1-interacting proteins bHLH010, bHLH089 and bHLH091 are redundantly required for Arabidopsis anther development and transcriptome. DOI: 10.1111/tpj.12942 ; PMID: 26216374
- Feedback Regulation of DYT1 by Interactions with Downstream bHLH Factors Promotes DYT1 Nuclear Localization and Anther Development. DOI: 10.1105/tpc.15.00986 ; PMID: 27113773
- Analyses of functional conservation and divergence reveal requirement of bHLH010/089/091 for pollen development at elevated temperature in Arabidopsis. DOI: 10.1016/j.jgg.2020.09.001 ; PMID: 33393464
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The basic helix-loop-helix transcription factor family in plants: a genome-wide study of protein structure and functional diversity. DOI: 10.1093/molbev/msg088 ; PMID: 12679534
Sequences:
cDNA Sequence
- >AT4G21330.1
ATGGGTGGAGGAAGCAGATTTCAAGAACCAGTGAGGATGAGCCGTAGGAAACAAGTAACAAAAGAGAAGGAAGAAGATGAAAACTTCAAATCTCCAAATCTTGAAGCAGAGAGACGTAGAAGAGAGAAGCTTCATTGTCGGCTTATGGCTCTGCGATCTCATGTCCCCATTGTCACCAACATGACTAAAGCAAGTATTGTTGAAGATGCGATTACTTACATAGGAGAGCTTCAAAACAATGTTAAGAATCTCTTAGAGACATTTCATGAAATGGAAGAAGCTCCTCCTGAGATTGATGAAGAACAAACGGATCCAATGATAAAACCTGAAGTTGAAACTAGTGATCTTAACGAAGAGATGAAGAAACTCGGAATCGAGGAGAATGTGCAATTGTGTAAGATTGGGGAGAGGAAGTTTTGGTTAAAGATCATAACAGAGAAGAGAGATGGGATCTTTACTAAATTCATGGAGGTTATGAGATTTCTCGGATTCGAGATTATCGATATTAGTCTAACAACTTCAAATGGAGCAATTCTTATTAGTGCCTCTGTTCAGACACAGGAACTCTGTGATGTTGAACAGACAAAAGATTTTCTTTTGGAAGTTATGAGAAGCAATCCATAA
CDS Sequence
Protein Sequence