Gene Details:
- Gene ID: AT4G20780
- Gene Symbol: CML42
- Gene Name: calmodulin like 42
- Description: calmodulin like 42;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Function-related keywords:
Literature:
- A crucial role for the putative Arabidopsis topoisomerase VI in plant growth and development. DOI: 10.1073/pnas.152337599 ; PMID: 12119417
- Analysis of EF-hand-containing proteins in Arabidopsis. DOI: 10.1186/gb-2002-3-10-research0056 ; PMID: 12372144
- BES1 accumulates in the nucleus in response to brassinosteroids to regulate gene expression and promote stem elongation. DOI: 10.1016/s0092-8674(02)00721-3 ; PMID: 12007405
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- The transcriptional innate immune response to flg22. Interplay and overlap with Avr gene-dependent defense responses and bacterial pathogenesis. DOI: 10.1104/pp.103.036749 ; PMID: 15181213
- Binding of arabinogalactan proteins by Yariv phenylglycoside triggers wound-like responses in Arabidopsis cell cultures. DOI: 10.1104/pp.104.039370 ; PMID: 15235117
- and darkness-regulated Arabidopsis genes: a focus on calmodulin-like and XTH genes. DOI: 10.1111/j.1469-8137.2004.01238.x ; PMID: 15720654
- Microarray analysis of genes that respond to gamma-irradiation in Arabidopsis. DOI: 10.1021/jf0486895 ; PMID: 15713015
- Handling calcium signaling: Arabidopsis CaMs and CMLs. DOI: 10.1016/j.tplants.2005.07.001 ; PMID: 16023399
- The cold-induced early activation of phospholipase C and D pathways determines the response of two distinct clusters of genes in Arabidopsis cell suspensions. DOI: 10.1104/pp.105.068171 ; PMID: 16258011
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- CML42-mediated calcium signaling coordinates responses to Spodoptera herbivory and abiotic stresses in Arabidopsis. DOI: 10.1104/pp.112.198150 ; PMID: 22570470
- Linking genes of unknown function with abiotic stress responses by high-throughput phenotype screening. DOI: 10.1111/ppl.12013 ; PMID: 23517122
- Handling calcium signaling: Arabidopsis CaMs and CMLs. DOI: 10.1016/j.tplants.2005.07.001 ; PMID: 16023399
Sequences:
cDNA Sequence
- >AT4G20780.1
GGGTCTGATGCTAGAAGTTCTTACATGGCGGGCCAGACAAAGTCAATGCCGGCAACAACGGACTCCTACACATAAATTTTTTAATTCACCAATTGTTTCTCTTCTATAATTAGCCCTCATCACTCAATTTCTCAATCTCAGATTATAATTCCACAAACGAACAAGAAGAAGAAGAAGAACACAAGATAACAATGGAGAGTAACAACAACGAGAAGAAGAAAGTTGCAAGACAATCATCATCCTTCAGACTACGTAGCCCAAGCCTAAACGCACTTCGTCTCCAACGAATCTTCGACTTATTCGACAAAAACGGCGACGGATTCATAACCGTCGAAGAGCTAAGCCAAGCTCTAACACGTCTTGGTCTCAACGCTGATCTCTCCGATCTCAAATCCACCGTTGAATCATACATCCAACCTGGTAACACTGGTCTCAATTTCGATGATTTCTCTTCTCTTCACAAAACACTCGACGATTCTTTCTTCGGTGGAGCTTGTGGAGGAGGAGAAAACGAAGATGATCCTTCTTCCGCAGCTGAAAATGAATCGGATCTCGCCGAGGCGTTTAAGGTGTTTGATGAGAACGGTGATGGATTCATCTCCGCTAGAGAACTGCAAACTGTTCTGAAGAAACTTGGTTTACCTGAAGGTGGAGAAATGGAGAGAGTGGAGAAGATGATCGTTTCCGTTGACCGGAATCAAGATGGTCGCGTTGACTTTTTTGAATTCAAGAACATGATGCGTACTGTTGTCATCCCTTCTTCTTGATTCTCCAAAAAAACATTTTTTCTCCAAAAGATTATTATTTTTACTTTTTGTCTTTTAAGTTTGTATTTTTTCCAGTTTATGTAATGATTGATTCAAACATTATAAACAAATAAATTTTTTCTTTTTTGTACTTACTGAATTTGGCACGAAAAATTCGTACCAAACGCATATTGTCGCCTATAAACAATATTCAATCTAATATATTTGTTTGAAA
CDS Sequence
Protein Sequence