Information report for AT4G20370
Gene Details
|
|
Functional Descriptions
- PO:0005417 — phloem — floema (Spanish, exact), portion of phloem tissue (exact), 師部、師管 (Japanese, exact)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
Functional Keywords
Literature and News
- A pair of related genes with antagonistic roles in mediating flowering signals. DOI: 10.1126/science.286.5446.1960 ; PMID: 10583960
- Integration of flowering signals in winter-annual Arabidopsis. DOI: 10.1104/pp.104.052811 ; PMID: 15618421
- TWIN SISTER OF FT (TSF) acts as a floral pathway integrator redundantly with FT. DOI: 10.1093/pcp/pci151 ; PMID: 15951566
- Towards the proteome of Brassica napus phloem sap. DOI: 10.1002/pmic.200500155 ; PMID: 16400686
- Export of FT protein from phloem companion cells is sufficient for floral induction in Arabidopsis. DOI: 10.1016/j.cub.2007.05.009 ; PMID: 17540570
- The FLOWERING LOCUS T/TERMINAL FLOWER 1 family in Lombardy poplar. DOI: 10.1093/pcp/pcn010 ; PMID: 18203732
- Genetic and spatial interactions between FT, TSF and SVP during the early stages of floral induction in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.03986.x ; PMID: 19656342
- A plant-specific histone H3 lysine 4 demethylase represses the floral transition in Arabidopsis. DOI: 10.1111/j.1365-313X.2010.04182.x ; PMID: 20202164
- Cytokinin promotes flowering of Arabidopsis via transcriptional activation of the FT paralogue TSF. DOI: 10.1111/j.1365-313X.2011.04482.x ; PMID: 21205031
- The role of the miR399-PHO2 module in the regulation of flowering time in response to different ambient temperatures in Arabidopsis thaliana. DOI: 10.1007/s10059-011-1043-1 ; PMID: 21533549
- CRYPTIC PRECOCIOUS/MED12 is a novel flowering regulator with multiple target steps in Arabidopsis. DOI: 10.1093/pcp/pcs002 ; PMID: 22247249
- Analysis of the Arabidopsis shoot meristem transcriptome during floral transition identifies distinct regulatory patterns and a leucine-rich repeat protein that promotes flowering. DOI: 10.1105/tpc.111.092791 ; PMID: 22319055
- A survey of dominant mutations in Arabidopsis thaliana. DOI: 10.1016/j.tplants.2012.08.006 ; PMID: 22995285
- Spatial control of flowering by DELLA proteins in Arabidopsis thaliana. DOI: 10.1242/dev.080879 ; PMID: 22992955
- The E3 ubiquitin ligase HOS1 regulates low ambient temperature-responsive flowering in Arabidopsis thaliana. DOI: 10.1093/pcp/pcs123 ; PMID: 22960247
- The florigen genes FT and TSF modulate lateral shoot outgrowth in Arabidopsis thaliana. DOI: 10.1093/pcp/pcs168 ; PMID: 23220822
- BRANCHED1 interacts with FLOWERING LOCUS T to repress the floral transition of the axillary meristems in Arabidopsis. DOI: 10.1105/tpc.112.109090 ; PMID: 23613197
- GIGANTEA enables drought escape response via abscisic acid-dependent activation of the florigens and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS. DOI: 10.1104/pp.113.217729 ; PMID: 23719890
- TWIN SISTER OF FT, GIGANTEA, and CONSTANS have a positive but indirect effect on blue light-induced stomatal opening in Arabidopsis. DOI: 10.1104/pp.113.217984 ; PMID: 23669744
- Transcriptional dynamics of two seed compartments with opposing roles in Arabidopsis seed germination. DOI: 10.1104/pp.113.223511 ; PMID: 23858430
- Florigen is involved in axillary bud development at multiple stages in Arabidopsis. DOI: 10.4161/psb.27167 ; PMID: 24305631
- Elevated levels of MYB30 in the phloem accelerate flowering in Arabidopsis through the regulation of FLOWERING LOCUS T. DOI: 10.1371/journal.pone.0089799 ; PMID: 24587042
- A flowering integrator, SOC1, affects stomatal opening in Arabidopsis thaliana. DOI: 10.1093/pcp/pcu214 ; PMID: 25588388
- Non-inductive conditions expose the cryptic bract of flower phytomeres in Arabidopsis thaliana. DOI: 10.1080/15592324.2015.1010868 ; PMID: 25924005
- FLOWERING LOCUS T has higher protein mobility than TWIN SISTER OF FT. DOI: 10.1093/jxb/erv326 ; PMID: 26139827
- SHORT VEGETATIVE PHASE Up-Regulates TEMPRANILLO2 Floral Repressor at Low Ambient Temperatures. DOI: 10.1104/pp.15.00570 ; PMID: 26243615
- Florigens and antiflorigens: a molecular genetic understanding. DOI: 10.1042/bse0580133 ; PMID: 26374892
- Gibberellic acid signaling is required for ambient temperature-mediated induction of flowering in Arabidopsis thaliana. DOI: 10.1111/tpj.13051 ; PMID: 26466761
- Photoperiodic and thermosensory pathways interact through CONSTANS to promote flowering at high temperature under short days. DOI: 10.1111/tpj.13183 ; PMID: 27117775
- ABA-dependent control of GIGANTEA signalling enables drought escape via up-regulation of FLOWERING LOCUS T in Arabidopsis thaliana. DOI: 10.1093/jxb/erw384 ; PMID: 27733440
- TWIN SISTER OF FT (TSF) Interacts with FRUCTOKINASE6 and Inhibits Its Kinase Activity in Arabidopsis. DOI: 10.3389/fpls.2017.01807 ; PMID: 29093731
- Genome-wide signatures of flowering adaptation to climate temperature: Regional analyses in a highly diverse native range of Arabidopsis thaliana. DOI: 10.1111/pce.13189 ; PMID: 29520809
- Reduction of the geomagnetic field delays Arabidopsis thaliana flowering time through downregulation of flowering-related genes. DOI: 10.1002/bem.22123 ; PMID: 29709075
- Genetic interactions reveal the antagonistic roles of FT/TSF and TFL1 in the determination of inflorescence meristem identity in Arabidopsis. DOI: 10.1111/tpj.14335 ; PMID: 30943325
- PIF transcription factors link a neighbor threat cue to accelerated reproduction in Arabidopsis. DOI: 10.1038/s41467-019-11882-7 ; PMID: 31488833
- Two B-box domain proteins, BBX28 and BBX29, regulate flowering time at low ambient temperature in Arabidopsis. DOI: 10.1007/s11103-021-01123-1 ; PMID: 33554307
- The splicing factor 1-FLOWERING LOCUS M module spatially regulates temperature-dependent flowering by modulating FLOWERING LOCUS T and LEAFY expression. DOI: 10.1007/s00299-022-02881-y ; PMID: 35589978
- Early flowering phenotype of the Arabidopsis altered meristem program1 mutant is dependent on the FLOWERING LOCUS T-mediated pathway. DOI: 10.5511/plantbiotechnology.22.0515a ; PMID: 36349233
- COP1 Mediates Dark-Induced Stomatal Closure by Suppressing FT, TSF and SOC1 Expression to Promote NO Accumulation in Arabidopsis Guard Cells. DOI: 10.3390/ijms232315037 ; PMID: 36499365
Gene Resources
- UniProt: Q587R2
- EMBL: AB204805, AB204807, AB204808
- AlphaFoldDB: Q587R2
- EnsemblPlants: AT4G20370.1
- Gramene: AT4G20370.1
- KEGG: ath:AT4G20370
- Orthologous matrix: QEVICYE
- ExpressionAtlas: AT4G20370
Sequences
cDNA Sequence
- >AT4G20370.1
AAGAAGCAAAACATTTGATTGAGATACTTGAGATCCAAGATAAATATGTCTTTAAGTCGTAGAGATCCTCTTGTGGTCGGCAGTGTTGTTGGAGATGTTCTTGATCCTTTCACGAGGTTGGTCTCTCTTAAGGTCACTTATGGCCATAGAGAGGTTACTAATGGCTTGGATCTAAGGCCTTCTCAAGTTCTGAACAAACCAATAGTGGAGATTGGAGGAGACGACTTCAGAAATTTCTACACCTTGGTTATGGTGGATCCAGATGTGCCGAGTCCAAGCAACCCTCACCAACGAGAATATCTCCACTGGTTGGTGACTGATATACCTGCCACCACTGGAAATGCCTTTGGCAATGAGGTGGTGTGCTACGAGAGTCCACGTCCCCCCTCGGGAATTCATCGTATTGTGTTGGTATTGTTCCGGCAACTCGGAAGACAAACGGTTTATGCACCGGGGTGGCGCCAACAGTTCAACACTCGTGAGTTTGCTGAGATCTACAATCTTGGTCTTCCTGTGGCTGCCTCTTACTTCAACTGCCAGAGGGAGAATGGCTGTGGGGGAAGAAGAACGTAGATGCGTACCTACTTACGTTAACTAATAATCTAATCGTATAATATTCCCTTAATGAAGTATTTAAGCATCTATGTCAATGTAATAAGAATTTAAAGATACGAGCTAAAAAAAATGATGCATATGCTGACATCGATGTAAAGTAGTTTACACTTTTAATGTAATAACTAGGTTTTAACCCGCGGTACACCGCGAGACTATTTTGTTTTTTTAAGAATAAAAATATAATTTGTTTAGTCGATT
CDS Sequence
Protein Sequence