Information report for AT4G19170
Gene Details
|
|
Functional Descriptions
- GO:0009507 — located in — chloroplast
- GO:0010436 — enables — carotenoid dioxygenase activity
- GO:1901811 — involved in — beta-carotene catabolic process
- GO:0010287 — located in — plastoglobule
- GO:0016121 — involved in — carotene catabolic process
- GO:0009570 — is active in — chloroplast stroma
- GO:0005515 — enables — protein binding
- GO:0005829 — located in — cytosol
Functional Keywords
Literature and News
- Abscisic acid regulation of gene expression during water-deficit stress in the era of the Arabidopsis genome. DOI: 10.1046/j.1365-3040.2002.00746.x ; PMID: 11841660
- Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. DOI: 10.1104/pp.008532 ; PMID: 12481097
- Leaf vitamin C contents modulate plant defense transcripts and regulate genes that control development through hormone signaling. DOI: 10.1105/tpc.010538 ; PMID: 12671089
- Genome organization in Arabidopsis thaliana: a survey for genes involved in isoprenoid and chlorophyll metabolism. DOI: 10.1023/a:1023005504702 ; PMID: 12777052
- Expression profiling of cytokinin action in Arabidopsis. DOI: 10.1104/pp.103.021436 ; PMID: 12913156
- Microarray analysis of E2Fa-DPa-overexpressing plants uncovers a cross-talking genetic network between DNA replication and nitrogen assimilation. DOI: 10.1242/jcs.00715 ; PMID: 12953064
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- The zinc finger protein Zat12 is required for cytosolic ascorbate peroxidase 1 expression during oxidative stress in Arabidopsis. DOI: 10.1074/jbc.M313350200 ; PMID: 14722088
- Comparative genomics in salt tolerance between Arabidopsis and aRabidopsis-related halophyte salt cress using Arabidopsis microarray. DOI: 10.1104/pp.104.039909 ; PMID: 15247402
- Reversible histone acetylation and deacetylation mediate genome-wide, promoter-dependent and locus-specific changes in gene expression during plant development. DOI: 10.1534/genetics.104.033142 ; PMID: 15371352
- Arabidopsis VARIEGATED 3 encodes a chloroplast-targeted, zinc-finger protein required for chloroplast and palisade cell development. DOI: 10.1242/jcs.01360 ; PMID: 15340011
- Microarray analysis of genes that respond to gamma-irradiation in Arabidopsis. DOI: 10.1021/jf0486895 ; PMID: 15713015
- Abscisic acid biosynthesis and catabolism. DOI: 10.1146/annurev.arplant.56.032604.144046 ; PMID: 15862093
- Systemic signalling of environmental cues in Arabidopsis leaves. DOI: 10.1093/jxb/erj033 ; PMID: 16330523
- Tocopherol cyclase (VTE1) localization and vitamin E accumulation in chloroplast plastoglobule lipoprotein particles. DOI: 10.1074/jbc.M511939200 ; PMID: 16414959
- Protein profiling of plastoglobules in chloroplasts and chromoplasts. A surprising site for differential accumulation of metabolic enzymes. DOI: 10.1104/pp.105.076083 ; PMID: 16461379
- Genome-wide transcriptional analysis of the Arabidopsis thaliana interaction with the plant pathogen Pseudomonas syringae pv. tomato DC3000 and the human pathogen Escherichia coli O157:H7. DOI: 10.1111/j.1365-313X.2006.02725.x ; PMID: 16553894
- The early dark-response in Arabidopsis thaliana revealed by cDNA microarray analysis. DOI: 10.1007/s11103-005-4211-x ; PMID: 16514558
- Characterization of three members of the Arabidopsis carotenoid cleavage dioxygenase family demonstrates the divergent roles of this multifunctional enzyme family. DOI: 10.1111/j.1365-313X.2006.02666.x ; PMID: 16507088
- Gene expression profiles of Arabidopsis Cvi seeds during dormancy cycling indicate a common underlying dormancy control mechanism. DOI: 10.1111/j.1365-313X.2006.02738.x ; PMID: 16709196
- Abscisic acid antagonizes ethylene-induced hyponastic growth in Arabidopsis. DOI: 10.1104/pp.106.092700 ; PMID: 17158582
- Temporal responses of transcripts, enzyme activities and metabolites after adding sucrose to carbon-deprived Arabidopsis seedlings. DOI: 10.1111/j.1365-313X.2006.02979.x ; PMID: 17217462
- Genome-wide gene expression analysis reveals a critical role for CRYPTOCHROME1 in the response of Arabidopsis to high irradiance. DOI: 10.1104/pp.107.098293 ; PMID: 17478635
- Analysis of the Arabidopsis histidine kinase ATHK1 reveals a connection between vegetative osmotic stress sensing and seed maturation. DOI: 10.1105/tpc.107.055871 ; PMID: 18441212
- Tissue-Specific Apocarotenoid Glycosylation Contributes to Carotenoid Homeostasis in Arabidopsis Leaves. DOI: 10.1104/pp.15.00243 ; PMID: 26134165
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Phosphorylation of plastoglobular proteins in Arabidopsis thaliana. DOI: 10.1093/jxb/erw091 ; PMID: 26962209
- Enzymatic study on AtCCD4 and AtCCD7 and their potential to form acyclic regulatory metabolites. DOI: 10.1093/jxb/erw356 ; PMID: 27811075
- The Plastoglobule-Localized Metallopeptidase PGM48 Is a Positive Regulator of Senescence in Arabidopsis thaliana. DOI: 10.1105/tpc.16.00745 ; PMID: 27895226
- Molecular Modeling and Dynamic Simulation of Arabidopsis Thaliana Carotenoid Cleavage Dioxygenase Gene: A Comparison with Bixa orellana and Crocus Sativus. DOI: 10.1002/jcb.25919 ; PMID: 28145590
- The membrane-localized protein kinase MAP4K4/TOT3 regulates thermomorphogenesis. DOI: 10.1038/s41467-021-23112-0 ; PMID: 33990595
- Fibrillin2 in chloroplast plastoglobules participates in photoprotection and jasmonate-induced senescence. DOI: 10.1093/plphys/kiac166 ; PMID: 35404409
- The 9-cis-epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water-stressed bean. DOI: 10.1073/pnas.96.26.15354 ; PMID: 10611388
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- Tocopherol cyclase (VTE1) localization and vitamin E accumulation in chloroplast plastoglobule lipoprotein particles. DOI: 10.1074/jbc.M511939200 ; PMID: 16414959
- Protein profiling of plastoglobules in chloroplasts and chromoplasts. A surprising site for differential accumulation of metabolic enzymes. DOI: 10.1104/pp.105.076083 ; PMID: 16461379
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
Gene Resources
Sequences
cDNA Sequence
- >AT4G19170.1
TAGACAAACCAATATTTGTAGATTAGAACTTCACATAAACTACGAACCAAAGGATTTTAGTAGCTTCACATCAAAGAATAAAAATCTAAGTTTCACAAAGAAACAATTAAATGATTTTTGATTTTGAAAATTTAATAAATAGCCCCACACAACACACTCATCTTCCTTCACAGCCTTAAACGTGGAGCCAAAGAAAGTAAAAACAAAAGGAGAGCAATGGACTCTGTTTCTTCTTCTTCCTTCCTCTCCTCCACATTCTCTCTTCATCACTCTCTTCTTCGCCGCCGATCTTCCTCTCCTACTCTCCTCCGTATCAACTCCGCCGTCGTCGAAGAACGTTCTCCAATCACAAACCCAAGCGACAACAATGATCGTCGTAACAAACCCAAAACACTCCACAACCGAACCAATCACACCTTAGTCTCATCACCACCGAAACTCCGACCAGAAATGACTCTCGCAACAGCTCTCTTCACCACCGTCGAAGATGTAATCAACACGTTCATCGATCCACCTTCACGTCCTTCCGTTGATCCAAAACATGTCCTCTCTGATAACTTCGCTCCTGTCCTCGACGAGCTTCCTCCAACAGACTGTGAAATCATCCACGGCACTCTTCCACTGTCACTTAACGGCGCTTACATCCGTAACGGTCCAAATCCACAGTTTCTCCCTCGTGGTCCTTACCATCTCTTCGACGGCGACGGTATGCTTCACGCCATAAAAATCCACAACGGTAAAGCCACTCTCTGTAGCAGATACGTCAAGACTTATAAATACAACGTCGAGAAACAAACCGGAGCTCCGGTTATGCCTAACGTGTTTTCCGGATTCAACGGTGTAACGGCGTCAGTAGCTCGTGGAGCTTTAACGGCAGCTAGGGTTTTAACCGGACAGTATAATCCGGTTAACGGCATTGGTTTAGCTAATACAAGTCTAGCTTTCTTCAGTAACCGTCTCTTTGCTTTAGGTGAATCTGATTTACCCTACGCCGTCCGATTAACCGAATCAGGAGATATTGAAACGATCGGACGGTACGATTTCGACGGGAAATTAGCGATGAGTATGACAGCTCATCCTAAAACCGATCCAATAACCGGAGAAACTTTCGCTTTCCGGTACGGTCCGGTTCCACCGTTTTTAACATATTTCCGGTTTGATTCCGCCGGGAAAAAACAAAGAGACGTTCCGATATTCTCGATGACGTCTCCGTCGTTTCTCCATGACTTCGCGATCACGAAACGTCACGCGATTTTCGCAGAGATTCAGCTTGGCATGAGGATGAACATGTTGGATTTGGTTCTCGAAGGTGGTTCTCCGGTTGGTACTGATAACGGAAAAACTCCAAGGCTTGGAGTGATTCCTAAGTACGCCGGAGATGAGTCGGAGATGAAATGGTTCGAAGTTCCTGGATTCAATATCATTCACGCTATTAATGCTTGGGATGAAGATGATGGAAACAGCGTCGTTTTGATTGCACCGAATATTATGTCGATTGAACATACTTTAGAGAGGATGGATCTGGTTCATGCTTTGGTGGAGAAGGTGAAGATCGATCTCGTCACCGGGATTGTGAGACGTCATCCGATCTCAGCGAGGAATCTCGATTTCGCTGTGATTAATCCGGCGTTTCTCGGGAGATGTAGCAGGTACGTTTACGCGGCGATTGGAGATCCGATGCCGAAGATCTCCGGTGTGGTGAAGCTTGATGTGTCTAAAGGAGATCGGGATGATTGTACGGTGGCCCGTAGAATGTACGGTTCAGGTTGTTACGGCGGAGAACCGTTTTTCGTAGCTAGGGATCCTGGTAATCCGGAGGCGGAGGAGGATGATGGTTATGTGGTGACGTATGTTCACGATGAAGTGACTGGAGAATCGAAGTTTCTGGTGATGGACGCTAAATCGCCGGAGCTTGAAATCGTCGCCGCCGTGAGGTTGCCGCGAAGGGTTCCGTACGGATTCCATGGGTTATTTGTCAAGGAAAGTGACCTTAATAAGCTTTAACAATATAGGTAACTGCAATAGTTAATAGAATAATTAAGTCTTAATTACGTCCCGTACAACAAATCGCATAGTGTTGTTGCACACTTGCACTTTATACATTAAACTAAAGTACACATAGTTTGGTGGTGGTCGATGTATATAAAACATACCAAAGCTTATGAATATTATTTTTTTCTTTTAAATATGCAGCTTCTGTTATTGGCAATAAATCTTATAAATATTCATTCATTCCGAGAGTTATCAGATCTTAACACAAC
CDS Sequence
Protein Sequence