Information report for AT4G18960
Gene Details
|
|
Functional Descriptions
- PO:0020003 — plant ovule — óvulo vegetal (Spanish, exact), 胚珠 (Japanese, exact), Poaceae ovule (narrow), Zea ovule (narrow)
- PO:0004703 — carpel primordium — carpel primordia (exact, plural), portion of carpel primordium tissue (exact), primordio de carpelo (Spanish, exact), 心皮原基(可視的） (Japanese, exact)
- PO:0004705 — stamen primordium — portion of stamen primordium tissue (exact), primordio de estambre (Spanish, exact), stamen primordia (exact, plural), 雄蕊原基（可視的） (Japanese, exact)
- GO:0006357 — involved in — regulation of transcription by RNA polymerase II
- GO:0005515 — enables — protein binding
- GO:0048443 — acts upstream of or within — stamen development
- GO:0003677 — enables — DNA binding
- GO:0046983 — enables — protein dimerization activity
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0005634 — located in — nucleus
- GO:0048440 — acts upstream of or within — carpel development
- GO:0045944 — involved in — positive regulation of transcription by RNA polymerase II
- GO:0048497 — acts upstream of or within — maintenance of floral organ identity
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0000978 — enables — RNA polymerase II cis-regulatory region sequence-specific DNA binding
- GO:0000981 — enables — DNA-binding transcription factor activity, RNA polymerase II-specific
- GO:0048366 — acts upstream of or within — leaf development
Functional Keywords
Literature and News
- AINTEGUMENTA promotes petal identity and acts as a negative regulator of AGAMOUS. DOI: 10.1105/tpc.12.8.1357 ; PMID: 10948255
- Spatially and temporally regulated expression of rice MADS box genes with similarity to Arabidopsis class A, B and C genes. DOI: 10.1093/pcp/41.6.710 ; PMID: 10945340
- Specific and heritable genetic interference by double-stranded RNA in Arabidopsis thaliana. DOI: 10.1073/pnas.060034297 ; PMID: 10781109
- Analysis of the C-terminal region of Arabidopsis thaliana APETALA1 as a transcription activation domain. DOI: 10.1023/a:1006273127067 ; PMID: 10437826
- Development of amplified consensus genetic markers (ACGM) in Brassica napus from Arabidopsis thaliana sequences of known biological function. DOI: NA ; PMID: 10382288
- Molecular genetics of gynoecium development in Arabidopsis. DOI: 10.1016/s0070-2153(08)60316-6 ; PMID: 10332605
- The Arabidopsis FILAMENTOUS FLOWER gene is required for flower formation. DOI: 10.1242/dev.126.12.2715 ; PMID: 10331982
- CRABS CLAW and SPATULA, two Arabidopsis genes that control carpel development in parallel with AGAMOUS. DOI: 10.1242/dev.126.11.2377 ; PMID: 10225997
- The CURLY LEAF gene controls both division and elongation of cells during the expansion of the leaf blade in Arabidopsis thaliana. DOI: 10.1007/s004250050389 ; PMID: 9736998
- HASTY: a gene that regulates the timing of shoot maturation in Arabidopsis thaliana. DOI: 10.1242/dev.125.10.1889 ; PMID: 9550721
- Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3. DOI: 10.1242/dev.125.9.1711 ; PMID: 9521909
- Specific interactions between the K domains of AG and AGLs, members of the MADS domain family of DNA binding proteins. DOI: 10.1046/j.1365-313x.1997.12050999.x ; PMID: 9418042
- ETTIN patterns the Arabidopsis floral meristem and reproductive organs. DOI: 10.1242/dev.124.22.4481 ; PMID: 9409666
- EMF genes regulate Arabidopsis inflorescence development. DOI: 10.1105/tpc.9.11.2011 ; PMID: 9401124
- Developmental regulation of cell interactions in the Arabidopsis fiddlehead-1 mutant: a role for the epidermal cell wall and cuticle. DOI: 10.1006/dbio.1997.8671 ; PMID: 9299123
- Determination of floral organ identity by Arabidopsis MADS domain homeotic proteins AP1, AP3, PI, and AG is independent of their DNA-binding specificity. DOI: 10.1091/mbc.8.7.1243 ; PMID: 9243505
- Targeted misexpression of AGAMOUS in whorl 2 of Arabidopsis flowers. DOI: 10.1046/j.1365-313x.1997.11040825.x ; PMID: 9161038
- A serine/threonine protein kinase gene isolated by an in vivo binding procedure using the Arabidopsis floral homeotic gene product, AGAMOUS. DOI: 10.1093/oxfordjournals.pcp.a029160 ; PMID: 9150601
- Determination of Arabidopsis floral meristem identity by AGAMOUS. DOI: 10.1105/tpc.9.3.393 ; PMID: 9090883
- Molecular dissection of the AGAMOUS control region shows that cis elements for spatial regulation are located intragenically. DOI: 10.1105/tpc.9.3.355 ; PMID: 9090880
- TOUSLED participates in apical tissue formation during gynoecium development in Arabidopsis. DOI: 10.1105/tpc.9.3.335 ; PMID: 9090879
- FON1, an Arabidopsis gene that terminates floral meristem activity and controls flower organ number. DOI: 10.1105/tpc.9.2.115 ; PMID: 9061945
- Flowers into shoots: photo and hormonal control of a meristem identity switch in Arabidopsis. DOI: 10.1073/pnas.93.24.13831 ; PMID: 8943021
- DNA-binding properties of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA and AGAMOUS. DOI: 10.1093/nar/24.16.3134 ; PMID: 8774892
- Dimerization specificity of Arabidopsis MADS domain homeotic proteins APETALA1, APETALA3, PISTILLATA, and AGAMOUS. DOI: 10.1073/pnas.93.10.4793 ; PMID: 8643482
- Mapping the protein regions responsible for the functional specificities of the Arabidopsis MADS domain organ-identity proteins. DOI: 10.1073/pnas.93.9.4063 ; PMID: 8633017
- Benzylaminopurine induces phenocopies of floral meristem and organ identity mutants in wild-type Arabidopsis plants. DOI: 10.1007/BF00620066 ; PMID: 8717139
- The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. DOI: 10.1242/dev.122.1.87 ; PMID: 8565856
- Separation of AG function in floral meristem determinacy from that in reproductive organ identity by expressing antisense AG RNA. DOI: 10.1007/BF00042064 ; PMID: 7640351
- Genetic regulation of shoot development in Arabidopsis: role of the EMF genes. DOI: 10.1006/dbio.1995.1158 ; PMID: 7781888
- Temporal relationship between the transcription of two Arabidopsis MADS box genes and the floral organ identity genes. DOI: 10.1105/tpc.7.6.721 ; PMID: 7647563
- Molecular evolution of flower development: diversification of the plant MADS-box regulatory gene family. DOI: 10.1093/genetics/140.1.345 ; PMID: 7635298
- LEUNIG regulates AGAMOUS expression in Arabidopsis flowers. DOI: 10.1242/dev.121.4.975 ; PMID: 7743940
- Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. DOI: 10.1105/tpc.6.9.1211 ; PMID: 7919989
- Regulation of the arabidopsis floral homeotic gene APETALA1. DOI: 10.1016/0092-8674(94)90178-3 ; PMID: 7506995
- CLAVATA1, a regulator of meristem and flower development in Arabidopsis. DOI: 10.1242/dev.119.2.397 ; PMID: 8287795
- LEAFY controls floral meristem identity in Arabidopsis. DOI: 10.1016/0092-8674(92)90295-n ; PMID: 1350515
- AGL1-AGL6, an Arabidopsis gene family with similarity to floral homeotic and transcription factor genes. DOI: 10.1101/gad.5.3.484 ; PMID: 1672119
- Function of the apetala-1 gene during Arabidopsis floral development. DOI: 10.1105/tpc.2.8.741 ; PMID: 1983792
- FRL1 is required for petal and sepal development in Arabidopsis. DOI: 10.1046/j.1365-313x.2000.00851.x ; PMID: 11029701
- Genetic analysis of incurvata mutants reveals three independent genetic operations at work in Arabidopsis leaf morphogenesis. DOI: 10.1093/genetics/156.3.1363 ; PMID: 11063708
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- HUA1, a regulator of stamen and carpel identities in Arabidopsis, codes for a nuclear RNA binding protein. DOI: 10.1105/tpc.010201 ; PMID: 11595801
- SEUSS, a member of a novel family of plant regulatory proteins, represses floral homeotic gene expression with LEUNIG. DOI: 10.1242/dev.129.1.253 ; PMID: 11782418
- SPATULA, a gene that controls development of carpel margin tissues in Arabidopsis, encodes a bHLH protein. DOI: 10.1242/dev.128.7.1089 ; PMID: 11245574
- Complexes of MADS-box proteins are sufficient to convert leaves into floral organs. DOI: 10.1038/35054083 ; PMID: 11206550
- early bolting in short days: an Arabidopsis mutation that causes early flowering and partially suppresses the floral phenotype of leafy. DOI: 00-0536 ; PMID: 11340178
- KNAT2: evidence for a link between knotted-like genes and carpel development. DOI: 10.1105/tpc.010184 ; PMID: 11487688
- A molecular link between stem cell regulation and floral patterning in Arabidopsis. DOI: 10.1016/s0092-8674(01)00384-1 ; PMID: 11440721
- Termination of stem cell maintenance in Arabidopsis floral meristems by interactions between WUSCHEL and AGAMOUS. DOI: 10.1016/s0092-8674(01)00390-7 ; PMID: 11440722
- New members of the floral organ identity AGAMOUS pathway. DOI: 10.1016/s1360-1385(02)02294-x ; PMID: 12119159
- A Mutation in the Arabidopsis TFL1 Gene Affects Inflorescence Meristem Development. DOI: 10.1105/tpc.3.9.877 ; PMID: 12324621
- LEAFY Interacts with Floral Homeotic Genes to Regulate Arabidopsis Floral Development. DOI: 10.1105/tpc.4.8.901 ; PMID: 12297664
- Role of petunia pMADS3 in determination of floral organ and meristem identity, as revealed by its loss of function. DOI: 10.1046/j.1365-313x.2002.01402.x ; PMID: 12366805
- Arabidopsis is susceptible to the cereal ear blight fungal pathogens Fusarium graminearum and Fusarium culmorum. DOI: 10.1046/j.1365-313x.2002.01480.x ; PMID: 12492838
- ATX-1, an Arabidopsis homolog of trithorax, activates flower homeotic genes. DOI: 10.1016/s0960-9822(03)00243-4 ; PMID: 12699618
- Arabidopsis histone acetyltransferase AtGCN5 regulates the floral meristem activity through the WUSCHEL/AGAMOUS pathway. DOI: 10.1074/jbc.M302787200 ; PMID: 12740375
- Arabidopsis TERMINAL FLOWER 2 gene encodes a heterochromatin protein 1 homolog and represses both FLOWERING LOCUS T to regulate flowering time and several floral homeotic genes. DOI: 10.1093/pcp/pcg091 ; PMID: 12826620
- The F-box-containing protein UFO and AGAMOUS participate in antagonistic pathways governing early petal development in Arabidopsis. DOI: 10.1073/pnas.1033043100 ; PMID: 12826617
- Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: new openings to the MADS world. DOI: 10.1105/tpc.011544 ; PMID: 12837945
- PAUSED, a putative exportin-t, acts pleiotropically in Arabidopsis development but is dispensable for viability. DOI: 10.1104/pp.103.023291 ; PMID: 12913148
- Arabidopsis MSI1 is required for epigenetic maintenance of reproductive development. DOI: 10.1242/dev.00470 ; PMID: 12736201
- Isolation and expression analysis of petunia CURLY LEAF-like genes. DOI: 10.1093/pcp/pcg102 ; PMID: 12941873
- MADS-box protein complexes control carpel and ovule development in Arabidopsis. DOI: 10.1105/tpc.015123 ; PMID: 14555696
- The major clades of MADS-box genes and their role in the development and evolution of flowering plants. DOI: 10.1016/s1055-7903(03)00207-0 ; PMID: 14615187
- Partial conservation of LFY function between rice and Arabidopsis. DOI: 10.1093/pcp/pcg155 ; PMID: 14701926
- FIE and CURLY LEAF polycomb proteins interact in the regulation of homeobox gene expression during sporophyte development. DOI: 10.1111/j.1365-313x.2003.01996.x ; PMID: 14871310
- Genome-wide analysis of spatial gene expression in Arabidopsis flowers. DOI: 10.1105/tpc.021741 ; PMID: 15100403
- Functional characterization of SEPALLATA3 and AGAMOUS orthologues in silver birch. DOI: 10.1111/j.0031-9317.2004.00303.x ; PMID: 15086829
- Regulation of flower development in Arabidopsis by SCF complexes. DOI: 10.1104/pp.103.031971 ; PMID: 15047903
- Floral homeotic genes are targets of gibberellin signaling in flower development. DOI: 10.1073/pnas.0402377101 ; PMID: 15128937
- The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS. DOI: 10.1038/nature02733 ; PMID: 15254538
- The role of SEUSS in auxin response and floral organ patterning. DOI: 10.1242/dev.01306 ; PMID: 15358669
- The ULTRAPETALA1 gene functions early in Arabidopsis development to restrict shoot apical meristem activity and acts through WUSCHEL to regulate floral meristem determinacy. DOI: 10.1534/genetics.104.028787 ; PMID: 15342527
- Activation of CRABS CLAW in the Nectaries and Carpels of Arabidopsis. DOI: 10.1105/tpc.104.026666 ; PMID: 15598802
- Transcriptional program controlled by the floral homeotic gene AGAMOUS during early organogenesis. DOI: 10.1242/dev.01600 ; PMID: 15634696
- The PRETTY FEW SEEDS2 gene encodes an Arabidopsis homeodomain protein that regulates ovule development. DOI: 10.1242/dev.01654 ; PMID: 15659481
- Plant meristems: a ménage à trois to end it all. DOI: 10.1016/s0960-9822(01)00471-7 ; PMID: 11591338
- A new role of the Arabidopsis SEPALLATA3 gene revealed by its constitutive expression. DOI: 10.1111/j.1365-313X.2005.02476.x ; PMID: 16098111
- Evolution in action: following function in duplicated floral homeotic genes. DOI: 10.1016/j.cub.2005.07.063 ; PMID: 16111944
- The Arabidopsis heterochromatin protein1 homolog (TERMINAL FLOWER2) silences genes within the euchromatic region but not genes positioned in heterochromatin. DOI: 10.1093/pcp/pci195 ; PMID: 16131496
- Expression of floral MADS-box genes in basal angiosperms: implications for the evolution of floral regulators. DOI: 10.1111/j.1365-313X.2005.02487.x ; PMID: 16115069
- RABBIT EARS is a second-whorl repressor of AGAMOUS that maintains spatial boundaries in Arabidopsis flowers. DOI: 10.1111/j.1365-313X.2005.02633.x ; PMID: 16412084
- APETALA2 regulates the stem cell niche in the Arabidopsis shoot meristem. DOI: 10.1105/tpc.105.038398 ; PMID: 16387832
- SEUSS and LEUNIG regulate cell proliferation, vascular development and organ polarity in Arabidopsis petals. DOI: 10.1007/s00425-006-0264-6 ; PMID: 16625397
- MGOUN3: evidence for chromatin-mediated regulation of FLC expression. DOI: 10.1093/jxb/erj169 ; PMID: 16728410
- AGL24, SHORT VEGETATIVE PHASE, and APETALA1 redundantly control AGAMOUS during early stages of flower development in Arabidopsis. DOI: 10.1105/tpc.106.041798 ; PMID: 16679456
- APETALA1 and SEPALLATA3 interact with SEUSS to mediate transcription repression during flower development. DOI: 10.1242/dev.02498 ; PMID: 16854969
- BIGPETALp, a bHLH transcription factor is involved in the control of Arabidopsis petal size. DOI: 10.1038/sj.emboj.7601270 ; PMID: 16902407
- DamID, a new tool for studying plant chromatin profiling in vivo, and its use to identify putative LHP1 target loci. DOI: 10.1111/j.1365-313X.2006.02859.x ; PMID: 16972870
- Flowering and determinacy in Arabidopsis. DOI: 10.1093/jxb/erm002 ; PMID: 17293602
- The KNOX gene SHOOT MERISTEMLESS is required for the development of reproductive meristematic tissues in Arabidopsis. DOI: 10.1111/j.1365-313X.2007.03095.x ; PMID: 17461793
- miR172 regulates stem cell fate and defines the inner boundary of APETALA3 and PISTILLATA expression domain in Arabidopsis floral meristems. DOI: 10.1111/j.1365-313X.2007.03181.x ; PMID: 17573799
- The Arabidopsis homologs of trithorax (ATX1) and enhancer of zeste (CLF) establish 'bivalent chromatin marks' at the silent AGAMOUS locus. DOI: 10.1093/nar/gkm464 ; PMID: 17881378
- Tagging of MADS domain proteins for chromatin immunoprecipitation. DOI: 10.1186/1471-2229-7-47 ; PMID: 17868439
- The homeotic protein AGAMOUS controls late stamen development by regulating a jasmonate biosynthetic gene in Arabidopsis. DOI: 10.1105/tpc.107.055467 ; PMID: 17981996
- An AGAMOUS-related MADS-box gene, XAL1 (AGL12), regulates root meristem cell proliferation and flowering transition in Arabidopsis. DOI: 10.1104/pp.107.108647 ; PMID: 18203871
- CAUT lines: a novel resource for studies of cell autonomy in Arabidopsis. DOI: 10.1111/j.1365-313X.2007.03321.x ; PMID: 18269574
- Arabidopsis TFL2/LHP1 specifically associates with genes marked by trimethylation of histone H3 lysine 27. DOI: 10.1371/journal.pgen.0030086 ; PMID: 17542647
- REBELOTE, SQUINT, and ULTRAPETALA1 function redundantly in the temporal regulation of floral meristem termination in Arabidopsis thaliana. DOI: 10.1105/tpc.107.053306 ; PMID: 18441215
- LEUNIG_HOMOLOG and LEUNIG perform partially redundant functions during Arabidopsis embryo and floral development. DOI: 10.1104/pp.108.115923 ; PMID: 18390806
- A novel role of BELL1-like homeobox genes, PENNYWISE and POUND-FOOLISH, in floral patterning. DOI: 10.1007/s00425-008-0867-1 ; PMID: 19082619
- In planta localisation patterns of MADS domain proteins during floral development in Arabidopsis thaliana. DOI: 10.1186/1471-2229-9-5 ; PMID: 19138429
- Dual roles of the bZIP transcription factor PERIANTHIA in the control of floral architecture and homeotic gene expression. DOI: 10.1242/dev.033647 ; PMID: 19395639
- Floral stem cell termination involves the direct regulation of AGAMOUS by PERIANTHIA. DOI: 10.1242/dev.035436 ; PMID: 19395638
- Target genes of the MADS transcription factor SEPALLATA3: integration of developmental and hormonal pathways in the Arabidopsis flower. DOI: 10.1371/journal.pbio.1000090 ; PMID: 19385720
- A transformation booster sequence (TBS) from Petunia hybrida functions as an enhancer-blocking insulator in Arabidopsis thaliana. DOI: 10.1007/s00299-009-0700-8 ; PMID: 19373469
- The role of ARGONAUTE1 (AGO1) in meristem formation and identity. DOI: 10.1016/j.ydbio.2005.01.031 ; PMID: 15882589
- Regulated RNA processing in the control of Arabidopsis flowering. DOI: 10.1387/ijdb.051995vq ; PMID: 16096981
- Silencing by plant Polycomb-group genes requires dispersed trimethylation of histone H3 at lysine 27. DOI: 10.1038/sj.emboj.7601311 ; PMID: 16957776
- Ectopic expression of a hyacinth AGL6 homolog caused earlier flowering and homeotic conversion in Arabidopsis. DOI: 10.1007/s11427-007-0083-4 ; PMID: 17879068
- Enhanced AGAMOUS expression in the centre of the Arabidopsis flower causes ectopic expression over its outer expression boundaries. DOI: 10.1007/s00425-009-0966-7 ; PMID: 19554348
- A timing mechanism for stem cell maintenance and differentiation in the Arabidopsis floral meristem. DOI: 10.1101/gad.1800409 ; PMID: 19651987
- A terminator of floral stem cells. DOI: 10.1101/gad.1834409 ; PMID: 19651982
- Ovule integument identity determination in Arabidopsis. DOI: 10.4161/psb.3.4.5175 ; PMID: 19704643
- Epigenetic regulation of gene programs by EMF1 and EMF2 in Arabidopsis. DOI: 10.1104/pp.109.143495 ; PMID: 19783648
- A single amino acid change in the enhancer of zeste ortholog CURLY LEAF results in vernalization-independent, rapid flowering in Arabidopsis. DOI: 10.1104/pp.109.145581 ; PMID: 19755537
- The SPOROCYTELESS/NOZZLE gene is involved in controlling stamen identity in Arabidopsis. DOI: 10.1104/pp.109.145896 ; PMID: 19726570
- Arabidopsis WUSCHEL is a bifunctional transcription factor that acts as a repressor in stem cell regulation and as an activator in floral patterning. DOI: 10.1105/tpc.109.069997 ; PMID: 19897670
- AGAMOUS controls GIANT KILLER, a multifunctional chromatin modifier in reproductive organ patterning and differentiation. DOI: 10.1371/journal.pbio.1000251 ; PMID: 19956801
- The SAND domain protein ULTRAPETALA1 acts as a trithorax group factor to regulate cell fate in plants. DOI: 10.1101/gad.1812609 ; PMID: 19952107
- EARLY IN SHORT DAYS 7 (ESD7) encodes the catalytic subunit of DNA polymerase epsilon and is required for flowering repression through a mechanism involving epigenetic gene silencing. DOI: 10.1111/j.1365-313X.2009.04093.x ; PMID: 19947980
- Shedding light on the role of AT-hook/PPC domain protein in Arabidopsis thaliana. DOI: 10.4161/psb.5.2.11111 ; PMID: 20173412
- Intercellular transport of epidermis-expressed MADS domain transcription factors and their effect on plant morphology and floral transition. DOI: 10.1111/j.1365-313X.2010.04221.x ; PMID: 20374529
- VERDANDI is a direct target of the MADS domain ovule identity complex and affects embryo sac differentiation in Arabidopsis. DOI: 10.1105/tpc.109.068627 ; PMID: 20581305
- On reconciling the interactions between APETALA2, miR172 and AGAMOUS with the ABC model of flower development. DOI: 10.1242/dev.036673 ; PMID: 20876650
- Investigation of MADS domain transcription factor dynamics in the floral meristem. DOI: 10.4161/psb.5.10.12949 ; PMID: 20861681
- Overexpression of AtCSP4 affects late stages of embryo development in Arabidopsis. DOI: 10.1093/jxb/erq400 ; PMID: 21282328
- An E3 ligase complex regulates SET-domain polycomb group protein activity in Arabidopsis thaliana. DOI: 10.1073/pnas.1104232108 ; PMID: 21518870
- [Interaction between the PINOID/ABRUPTUS gene with the AGAMOUS gene: the negative regulator of stem cells in the meristem of Arabidopsis thaliana flower]. DOI: NA ; PMID: 21542343
- Modelling the Molecular Interactions in the Flower Developmental Network of Arabidopsis thaliana. DOI: NA ; PMID: 21685577
- AGAMOUS terminates floral stem cell maintenance in Arabidopsis by directly repressing WUSCHEL through recruitment of Polycomb Group proteins. DOI: 10.1105/tpc.111.091538 ; PMID: 22028461
- Characterization of MADS-domain transcription factor complexes in Arabidopsis flower development. DOI: 10.1073/pnas.1112871109 ; PMID: 22238427
- Antagonistic roles of SEPALLATA3, FT and FLC genes as targets of the polycomb group gene CURLY LEAF. DOI: 10.1371/journal.pone.0030715 ; PMID: 22363474
- Repression of floral meristem fate is crucial in shaping tomato inflorescence. DOI: 10.1371/journal.pone.0031096 ; PMID: 22347436
- Kiwifruit floral gene APETALA2 is alternatively spliced and accumulates in aberrant indeterminate flowers in the absence of miR172. DOI: 10.1007/s11103-012-9877-2 ; PMID: 22290408
- Modelling the molecular interactions in the flower developmental network of Arabidopsis thaliana. DOI: 10.3233/ISB-2010-0414 ; PMID: 22430225
- SWI2/SNF2 chromatin remodeling ATPases overcome polycomb repression and control floral organ identity with the LEAFY and SEPALLATA3 transcription factors. DOI: 10.1073/pnas.1113409109 ; PMID: 22323601
- Targeted inactivation of transcription factors by overexpression of their truncated forms in plants. DOI: 10.1111/j.1365-313X.2012.05069.x ; PMID: 22672153
- APETALA2 negatively regulates multiple floral organ identity genes in Arabidopsis by recruiting the co-repressor TOPLESS and the histone deacetylase HDA19. DOI: 10.1242/dev.085407 ; PMID: 23034631
- POWERDRESS and diversified expression of the MIR172 gene family bolster the floral stem cell network. DOI: 10.1371/journal.pgen.1003218 ; PMID: 23349639
- Mediator subunit18 controls flowering time and floral organ identity in Arabidopsis. DOI: 10.1371/journal.pone.0053924 ; PMID: 23326539
- Genetic identification of a novel locus, ACCELERATED FLOWERING 1 that controls chromatin modification associated with histone H3 lysine 27 trimethylation in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2013.03.009 ; PMID: 23683925
- AGAMOUS-LIKE13, a putative ancestor for the E functional genes, specifies male and female gametophyte morphogenesis. DOI: 10.1111/tpj.12363 ; PMID: 24164574
- The miR172 target TOE3 represses AGAMOUS expression during Arabidopsis floral patterning. DOI: 10.1016/j.plantsci.2013.10.010 ; PMID: 24388512
- The ERECTA receptor kinase regulates Arabidopsis shoot apical meristem size, phyllotaxy and floral meristem identity. DOI: 10.1242/dev.104687 ; PMID: 24496620
- Novel functional roles for PERIANTHIA and SEUSS during floral organ identity specification, floral meristem termination, and gynoecial development. DOI: 10.3389/fpls.2014.00130 ; PMID: 24778638
- DNA topoisomerase I affects polycomb group protein-mediated epigenetic regulation and plant development by altering nucleosome distribution in Arabidopsis. DOI: 10.1105/tpc.114.124941 ; PMID: 25070639
- AUXIN RESPONSE FACTOR 3 integrates the functions of AGAMOUS and APETALA2 in floral meristem determinacy. DOI: 10.1111/tpj.12658 ; PMID: 25187180
- APETALA1 establishes determinate floral meristem through regulating cytokinins homeostasis in Arabidopsis. DOI: 10.4161/15592324.2014.989039 ; PMID: 26359644
- The Arabidopsis homologs of trithorax (ATX1) and enhancer of zeste (CLF) establish 'bivalent chromatin marks' at the silent AGAMOUS locus. DOI: 10.1093/nar/gkv1489 ; PMID: 26673722
- APETALA2 antagonizes the transcriptional activity of AGAMOUS in regulating floral stem cells in Arabidopsis thaliana. DOI: 10.1111/nph.14151 ; PMID: 27604611
- An Evolutionary Framework for Carpel Developmental Control Genes. DOI: 10.1093/molbev/msw229 ; PMID: 28049761
- The N-Terminus of the Floral Arabidopsis TGA Transcription Factor PERIANTHIA Mediates Redox-Sensitive DNA-Binding. DOI: 10.1371/journal.pone.0153810 ; PMID: 27128442
- Cis and trans determinants of epigenetic silencing by Polycomb repressive complex 2 in Arabidopsis. DOI: 10.1038/ng.3937 ; PMID: 28825728
- Fine-tuning of auxin homeostasis governs the transition from floral stem cell maintenance to gynoecium formation. DOI: 10.1038/s41467-017-01252-6 ; PMID: 29066759
- Regulation of floral meristem activity through the interaction of AGAMOUS, SUPERMAN, and CLAVATA3 in Arabidopsis. DOI: 10.1007/s00497-017-0315-0 ; PMID: 29218596
- At-MINI ZINC FINGER2 and Sl-INHIBITOR OF MERISTEM ACTIVITY, a Conserved Missing Link in the Regulation of Floral Meristem Termination in Arabidopsis and Tomato. DOI: 10.1105/tpc.17.00653 ; PMID: 29298836
- Arabidopsis AGAMOUS Regulates Sepal Senescence by Driving Jasmonate Production. DOI: 10.3389/fpls.2017.02101 ; PMID: 29312374
- AUXIN RESPONSE FACTOR3 Regulates Floral Meristem Determinacy by Repressing Cytokinin Biosynthesis and Signaling. DOI: 10.1105/tpc.17.00705 ; PMID: 29371438
- Floral homeotic proteins modulate the genetic program for leaf development to suppress trichome formation in flowers. DOI: 10.1242/dev.157784 ; PMID: 29361563
- Tetramerization of MADS family transcription factors SEPALLATA3 and AGAMOUS is required for floral meristem determinacy in Arabidopsis. DOI: 10.1093/nar/gky205 ; PMID: 29562355
- A chromatin loop represses WUSCHEL expression in Arabidopsis. DOI: 10.1111/tpj.13921 ; PMID: 29660180
- SUPERMAN regulates floral whorl boundaries through control of auxin biosynthesis. DOI: 10.15252/embj.201797499 ; PMID: 29764982
- A noncoding RNA transcribed from the AGAMOUS (AG) second intron binds to CURLY LEAF and represses AG expression in leaves. DOI: 10.1111/nph.15231 ; PMID: 29862530
- INCURVATA11 and CUPULIFORMIS2 Are Redundant Genes That Encode Epigenetic Machinery Components in Arabidopsis. DOI: 10.1105/tpc.18.00300 ; PMID: 29915151
- Comparative analysis of binding patterns of MADS-domain proteins in Arabidopsis thaliana. DOI: 10.1186/s12870-018-1348-8 ; PMID: 29940855
- Chromatin-mediated feed-forward auxin biosynthesis in floral meristem determinacy. DOI: 10.1038/s41467-018-07763-0 ; PMID: 30538233
- Integration of Transcriptional Repression and Polycomb-Mediated Silencing of WUSCHEL in Floral Meristems. DOI: 10.1105/tpc.18.00450 ; PMID: 31068455
- Hierarchical graphical model reveals HFR1 bridging circadian rhythm and flower development in Arabidopsis thaliana. DOI: 10.1038/s41540-019-0106-3 ; PMID: 31428455
- Paf1c defects challenge the robustness of flower meristem termination in Arabidopsis thaliana. DOI: 10.1242/dev.173377 ; PMID: 31540913
- Nuclear import of LIKE HETEROCHROMATIN PROTEIN1 is redundantly mediated by importins α-1, α-2 and α-3. DOI: 10.1111/tpj.14796 ; PMID: 32365248
- The LEAFY floral regulator displays pioneer transcription factor properties. DOI: 10.1016/j.molp.2021.03.004 ; PMID: 33684542
- Transcriptome analysis of gynoecium morphogenesis uncovers the chronology of gene regulatory network activity. DOI: 10.1093/plphys/kiaa090 ; PMID: 33793890
- The Relationship between AGAMOUS and Cytokinin Signaling in the Establishment of Carpeloid Features. DOI: 10.3390/plants10050827 ; PMID: 33919177
- The intervening domain is required for DNA-binding and functional identity of plant MADS transcription factors. DOI: 10.1038/s41467-021-24978-w ; PMID: 34362909
- Robust control of floral meristem determinacy by position-specific multifunctions of KNUCKLES. DOI: 10.1073/pnas.2102826118 ; PMID: 34462349
- RNA-Binding Protein MAC5A Is Required for Gibberellin-Regulated Stamen Development. DOI: 10.3390/ijms23042009 ; PMID: 35216125
- Replication protein RPA2A regulates floral transition by cooperating with PRC2 in Arabidopsis. DOI: 10.1111/nph.18279 ; PMID: 35633113
- and noncell-autonomous AUXIN RESPONSE FACTOR3 controls meristem proliferation and phyllotactic patterns. DOI: 10.1093/plphys/kiac370 ; PMID: 35972411
- Genome-wide analysis of long non-coding RNAs under diel light exhibits role in floral development and the circadian clock in Arabidopsis thaliana. DOI: 10.1016/j.ijbiomac.2022.09.295 ; PMID: 36257367
- H2A.Z contributes to trithorax activity at the AGAMOUS locus. DOI: 10.1016/j.molp.2022.01.005 ; PMID: 35026437
- LEAFY and APETALA1 down-regulate ZINC FINGER PROTEIN 1 and 8 to release their repression on class B and C floral homeotic genes. DOI: 10.1073/pnas.2221181120 ; PMID: 37216511
- How flower development genes were identified using forward genetic screens in Arabidopsis thaliana. DOI: 10.1093/genetics/iyad102 ; PMID: 37294732
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- REBELOTE, SQUINT, and ULTRAPETALA1 function redundantly in the temporal regulation of floral meristem termination in Arabidopsis thaliana. DOI: 10.1105/tpc.107.053306 ; PMID: 18441215
- Dual roles of the bZIP transcription factor PERIANTHIA in the control of floral architecture and homeotic gene expression. DOI: 10.1242/dev.033647 ; PMID: 19395639
- AGAMOUS controls GIANT KILLER, a multifunctional chromatin modifier in reproductive organ patterning and differentiation. DOI: 10.1371/journal.pbio.1000251 ; PMID: 19956801
Gene Resources
- UniProt: F4JSC8
- EMBL: CP002687
- AlphaFoldDB: F4JSC8
- EnsemblPlants: AT4G18960.2, AT4G18960.3
- Gramene: AT4G18960.2, AT4G18960.3
Sequences
cDNA Sequence
- >AT4G18960.2
CTAAATGTACTGAAAAGAAACACCAGTTTAATTAATTATACTTCCCTCATATATAACTATCAACCAAGTACAAAACTTTTGTCAATTCTCAAAATCAACTTTCACCACATAATTATCTAACATGTGTATGTTCCAAAACCAGTTTAAATAGAATTACTTTTCAGAAAATACATGTATATTAACTCTATCTAATAAAGAAGAAACACATACTTATCTCATAGATTCCATTCATAAAACTATGCTTTAGTGAGTAAGAAAACCAGTAATCAAACACAAATTGACAAGACACTATATGGATGTAAAAAGTGGGGAAAAATGGTGATAAATAGTAGAGAAAATTAAAAAGAAAAAAAATATTCCTTTATAAATGTATATACCCATCTCTTCACCAGCACAACCTTACCTTCCATTTTCTGCAACTTCTCCAAATCTCATACTTTCCAGAAAATCATTTTCCCAAGAAAAATAAAACTTTCCCCTTTGTTCTTCTCCCCCCAACAGCAATCACGGCGTACCAATCGGAGCTAGGAGGAGATTCCTCTCCCTTGAGGAAATCTGGGAGAGGAAAGATCGAAATCAAACGGATCGAGAACACAACGAATCGTCAAGTCACTTTTTGCAAACGTAGAAATGGTTTGCTCAAGAAAGCTTACGAGCTCTCTGTTCTTTGTGATGCTGAAGTCGCACTCATCGTCTTCTCTAGCCGTGGTCGTCTCTATGAGTACTCTAACAACAGGTTTCGTATTAGAATCACTTAACTGTGCAAGTGGTCGATTTGACCCTATCAATTTTATTTTTTATTACTTATCAAAATGCAGATTTAAGCGGACTATTGAGAGGTACAAGAAGGCAATATCGGACAATTCTAACACCGGATCGGTGGCAGAAATTAATGCACAGTATTATCAACAAGAATCAGCCAAATTGCGTCAACAAATAATCAGCATACAAAACTCCAACAGGCAATTGATGGGTGAGACGATAGGGTCAATGTCTCCCAAAGAGCTCAGGAACTTGGAAGGCAGATTAGAGAGAAGTATTACCCGAATCCGATCCAAGAAGAATGAGCTCTTATTTTCTGAAATCGACTACATGCAGAAAAGAGAAGTTGATTTGCATAACGATAACCAGATTCTTCGTGCAAAGATAGCTGAAAATGAGAGGAACAATCCGAGTATAAGTCTAATGCCAGGAGGATCTAACTACGAGCAGCTTATGCCACCACCTCAAACGCAATCTCAACCGTTTGATTCACGGAATTATTTCCAAGTCGCGGCATTGCAACCTAACAATCACCATTACTCATCCGCGGGTCGCCAAGACCAAACCGCTCTCCAGTTAGTGTAATATAGGCTGAAGGAAATGGCCGGGAGTGAATAAAAACCAGAATTGGGTTGAGCAAGCAATATAAAGCTAATGCATGTTATATATATATTTATCCCATGAATGTTGTATCAGTGAATTTTATGCTTATGTTGATGTGAAATTAATATCTTAAAGACATGTCATTAATGTGCTTAATTTGCTTCAAAACATCTATGTGTATAAGTGTACTATTAGTTCAATTGTTGTATTTAATTACCAATTCCTGCTCTATTAATGATTTTATTATAG - >AT4G18960.4
CTAAATGTACTGAAAAGAAACACCAGTTTAATTAATTATACTTCCCTCATATATAACTATCAACCAAGTACAAAACTTTTGTCAATTCTCAAAATCAACTTTCACCACATAATTATCTAACATGTGTATGTTCCAAAACCAGTTTAAATAGAATTACTTTTCAGAAAATACATGTATATTAACTCTATCTAATAAAGAAGAAACACATACTTATCTCATAGATTCCATTCATAAAACTATGCTTTAGTGAGTAAGAAAACCAGTAATCAAACACAAATTGACAAGACACTATATGGATGTAAAAAGTGGGGAAAAATGGTGATAAATAGTAGAGAAAATTAAAAAGAAAAAAAATATTCCTTTATAAATGTATATACCCATCTCTTCACCAGCACAACCTTACCTTCCATTTTCTGCAACTTCTCCAAATCTCATACTTTCCAGAAAATCATTTTCCCAAGAAAAATAAAACTTTCCCCTTTGTTCTTCTCCCCCCAACAGCAATCACGGCGTACCAATCGGAGCTAGGAGGAGATTCCTCTCCCTTGAGGAAATCTGGGAGAGGAAAGATCGAAATCAAACGGATCGAGAACACAACGAATCGTCAAGTCACTTTTTGCAAACGTAGAAATGGTTTGCTCAAGAAAGCTTACGAGCTCTCTGTTCTTTGTGATGCTGAAGTCGCACTCATCGTCTTCTCTAGCCGTGGTCGTCTCTATGAGTACTCTAACAACAGGTTTCGTATTAGAATCACTTAACTGTGCAAGTGGTCGATTTGACCCTATCAATTTTATTTTTTATTACTTATCAAAATGCAGATTTAAGCGGACTATTGAGAGGTACAAGAAGGCAATATCGGACAATTCTAACACCGGATCGGTGGCAGAAATTAATGCACAGTATTATCAACAAGAATCAGCCAAATTGCGTCAACAAATAATCAGCATACAAAACTCCAACAGGCAATTGATGGGTGAGACGATAGGGTCAATGTCTCCCAAAGAGCTCAGGAACTTGGAAGGCAGATTAGAGAGAAGTATTACCCGAATCCGATCCAAGAAGAATGAGCTCTTATTTTCTGAAATCGACTACATGCAGAAAAGAGAAGTTGATTTGCATAACGATAACCAGATTCTTCGTGCAAAGATAGCTGAAAATGAGAGGAACAATCCGAGTATAAGTCTAATGCCAGGAGGATCTAACTACGAGCAGCTTATGCCACCACCTCAAACGCAATCTCAACCGTTTGATTCACGGAATTATTTCCAAGTCGCGGCATTGCAACCTAACAATCACCATTACTCATCCGCGGGTCGCCAAGACCAAACCGCTCTCCAGTTAGTGTAATATAGGCTGAAGGAAATGGCCGGGAGTGAATAAAAACCAGAATTGGGTTGAGCAAGCAATATAAAGCTAATGCATGTTATATATATATTTATCCCATGAATGTTGTATCAGTGAATTTTATGCTTATGTTGATGTGAAATTAATATCTTAAAGACATGTCATTAATGTGCTTAATTTGCTTCAAAACATCTATGTGTATAAGTGTACTATTAGTTCAATTGTTGTATTTAATTACCAATTCCTGCTCTATTAATGATTTTATTATAG - >AT4G18960.1
CTAAATGTACTGAAAAGAAACACCAGTTTAATTAATTATACTTCCCTCATATATAACTATCAACCAAGTACAAAACTTTTGTCAATTCTCAAAATCAACTTTCACCACATAATTATCTAACATGTGTATGTTCCAAAACCAGTTTAAATAGAATTACTTTTCAGAAAATACATGTATATTAACTCTATCTAATAAAGAAGAAACACATACTTATCTCATAGATTCCATTCATAAAACTATGCTTTAGTGAGTAAGAAAACCAGTAATCAAACACAAATTGACAAGACACTATATGGATGTAAAAAGTGGGGAAAAATGGTGATAAATAGTAGAGAAAATTAAAAAGAAAAAAAATATTCCTTTATAAATGTATATACCCATCTCTTCACCAGCACAACCTTACCTTCCATTTTCTGCAACTTCTCCAAATCTCATACTTTCCAGAAAATCATTTTCCCAAGAAAAATAAAACTTTCCCCTTTGTTCTTCTCCCCCCAACAGCAATCACGGCGTACCAATCGGAGCTAGGAGGAGATTCCTCTCCCTTGAGGAAATCTGGGAGAGGAAAGATCGAAATCAAACGGATCGAGAACACAACGAATCGTCAAGTCACTTTTTGCAAACGTAGAAATGGTTTGCTCAAGAAAGCTTACGAGCTCTCTGTTCTTTGTGATGCTGAAGTCGCACTCATCGTCTTCTCTAGCCGTGGTCGTCTCTATGAGTACTCTAACAACAGGTTTCGTATTAGAATCACTTAACTGTGCAAGTGGTCGATTTGACCCTATCAATTTTATTTTTTATTACTTATCAAAATGCAGATTTAAGCGGACTATTGAGAGGTACAAGAAGGCAATATCGGACAATTCTAACACCGGATCGGTGGCAGAAATTAATGCACAGTATTATCAACAAGAATCAGCCAAATTGCGTCAACAAATAATCAGCATACAAAACTCCAACAGGCAATTGATGGGTGAGACGATAGGGTCAATGTCTCCCAAAGAGCTCAGGAACTTGGAAGGCAGATTAGAGAGAAGTATTACCCGAATCCGATCCAAGAAGAATGAGCTCTTATTTTCTGAAATCGACTACATGCAGAAAAGAGAAGTTGATTTGCATAACGATAACCAGATTCTTCGTGCAAAGATAGCTGAAAATGAGAGGAACAATCCGAGTATAAGTCTAATGCCAGGAGGATCTAACTACGAGCAGCTTATGCCACCACCTCAAACGCAATCTCAACCGTTTGATTCACGGAATTATTTCCAAGTCGCGGCATTGCAACCTAACAATCACCATTACTCATCCGCGGGTCGCCAAGACCAAACCGCTCTCCAGTTAGTGTAATATAGGCTGAAGGAAATGGCCGGGAGTGAATAAAAACCAGAATTGGGTTGAGCAAGCAATATAAAGCTAATGCATGTTATATATATATTTATCCCATGAATGTTGTATCAGTGAATTTTATGCTTATGTTGATGTGAAATTAATATCTTAAAGACATGTCATTAATGTGCTTAATTTGCTTCAAAACATCTATGTGTATAAGTGTACTATTAGTTCAATTGTTGTATTTAATTACCAATTCCTGCTCTATTAATGATTTTATTATAG - >AT4G18960.3
CTAAATGTACTGAAAAGAAACACCAGTTTAATTAATTATACTTCCCTCATATATAACTATCAACCAAGTACAAAACTTTTGTCAATTCTCAAAATCAACTTTCACCACATAATTATCTAACATGTGTATGTTCCAAAACCAGTTTAAATAGAATTACTTTTCAGAAAATACATGTATATTAACTCTATCTAATAAAGAAGAAACACATACTTATCTCATAGATTCCATTCATAAAACTATGCTTTAGTGAGTAAGAAAACCAGTAATCAAACACAAATTGACAAGACACTATATGGATGTAAAAAGTGGGGAAAAATGGTGATAAATAGTAGAGAAAATTAAAAAGAAAAAAAATATTCCTTTATAAATGTATATACCCATCTCTTCACCAGCACAACCTTACCTTCCATTTTCTGCAACTTCTCCAAATCTCATACTTTCCAGAAAATCATTTTCCCAAGAAAAATAAAACTTTCCCCTTTGTTCTTCTCCCCCCAACAGCAATCACGGCGTACCAATCGGAGCTAGGAGGAGATTCCTCTCCCTTGAGGAAATCTGGGAGAGGAAAGATCGAAATCAAACGGATCGAGAACACAACGAATCGTCAAGTCACTTTTTGCAAACGTAGAAATGGTTTGCTCAAGAAAGCTTACGAGCTCTCTGTTCTTTGTGATGCTGAAGTCGCACTCATCGTCTTCTCTAGCCGTGGTCGTCTCTATGAGTACTCTAACAACAGGTTTCGTATTAGAATCACTTAACTGTGCAAGTGGTCGATTTGACCCTATCAATTTTATTTTTTATTACTTATCAAAATGCAGATTTAAGCGGACTATTGAGAGGTACAAGAAGGCAATATCGGACAATTCTAACACCGGATCGGTGGCAGAAATTAATGCACAGTATTATCAACAAGAATCAGCCAAATTGCGTCAACAAATAATCAGCATACAAAACTCCAACAGGCAATTGATGGGTGAGACGATAGGGTCAATGTCTCCCAAAGAGCTCAGGAACTTGGAAGGCAGATTAGAGAGAAGTATTACCCGAATCCGATCCAAGAAGAATGAGCTCTTATTTTCTGAAATCGACTACATGCAGAAAAGAGAAGTTGATTTGCATAACGATAACCAGATTCTTCGTGCAAAGATAGCTGAAAATGAGAGGAACAATCCGAGTATAAGTCTAATGCCAGGAGGATCTAACTACGAGCAGCTTATGCCACCACCTCAAACGCAATCTCAACCGTTTGATTCACGGAATTATTTCCAAGTCGCGGCATTGCAACCTAACAATCACCATTACTCATCCGCGGGTCGCCAAGACCAAACCGCTCTCCAGTTAGTGTAATATAGGCTGAAGGAAATGGCCGGGAGTGAATAAAAACCAGAATTGGGTTGAGCAAGCAATATAAAGCTAATGCATGTTATATATATATTTATCCCATGAATGTTGTATCAGTGAATTTTATGCTTATGTTGATGTGAAATTAATATCTTAAAGACATGTCATTAATGTGCTTAATTTGCTTCAAAACATCTATGTGTATAAGTGTACTATTAGTTCAATTGTTGTATTTAATTACCAATTCCTGCTCTATTAATGATTTTATTATAG
CDS Sequence
Protein Sequence