Gene Details:
- Gene ID: AT4G18710
- Gene Symbol: ATSK21, BIN2, DWF12, SK21, UCU1
- Gene Name: SHAGGY-LIKE KINASE 21, BRASSINOSTEROID-INSENSITIVE 2, DWARF 12, SHAGGY-LIKE KINASE 21, ULTRACURVATA 1
- Description: Protein kinase superfamily protein;(source:Araport11)
- TAIR Accession: locus:2124082
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0020108 — suspensor — suspensor (Spanish, exact), 胚柄 (Japanese, exact)
- PO:0000003 — whole plant — planta entera (Spanish, exact), 植物体全体 (Japanese, exact), clonal colony (related), colony (related), bush (narrow), frutex (narrow), frutices (narrow), gametophyte (narrow), herb (narrow), liana (narrow), prothalli (narrow), prothallium (narrow), prothallus (narrow), seedling (narrow), shrub (narrow), sporophyte (narrow), suffrutex (narrow), suffrutices (narrow), tree (narrow), vine (narrow), woody clump (narrow), genet (broad), ramet (broad)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0004674 — enables — protein serine/threonine kinase activity
- GO:0005515 — enables — protein binding
- GO:1900458 — involved in — negative regulation of brassinosteroid mediated signaling pathway
- GO:0048765 — acts upstream of or within — root hair cell differentiation
- GO:0006468 — acts upstream of or within — protein phosphorylation
- GO:0006468 — involved in — protein phosphorylation
- GO:0046827 — acts upstream of or within — positive regulation of protein export from nucleus
- GO:0042802 — enables — identical protein binding
- GO:0004672 — enables — protein kinase activity
- GO:0005634 — located in — nucleus
- GO:0046777 — acts upstream of or within — protein autophosphorylation
- GO:0009416 — acts upstream of or within — response to light stimulus
- GO:0005737 — located in — cytoplasm
- GO:0005737 — is active in — cytoplasm
- GO:0005886 — located in — plasma membrane
- GO:0009553 — involved in — embryo sac development
- GO:0009729 — acts upstream of or within — detection of brassinosteroid stimulus
- GO:0009733 — acts upstream of or within — response to auxin
- GO:0007033 — involved in — vacuole organization
- GO:0009414 — acts upstream of or within — response to water deprivation
- GO:0010508 — involved in — positive regulation of autophagy
- GO:0009965 — acts upstream of or within — leaf morphogenesis
Function-related keywords:
- suspensor , whole plant , root
Literature:
- The GSK3-like kinase BIN2 phosphorylates and destabilizes BZR1, a positive regulator of the brassinosteroid signaling pathway in Arabidopsis. DOI: 10.1073/pnas.152342599 ; PMID: 12114546
- Two putative BIN2 substrates are nuclear components of brassinosteroid signaling. DOI: 10.1104/pp.102.010918 ; PMID: 12427989
- Expression profiling of the whole Arabidopsis shaggy-like kinase multigene family by real-time reverse transcriptase-polymerase chain reaction. DOI: 10.1104/pp.009175 ; PMID: 12376626
- BES1 accumulates in the nucleus in response to brassinosteroids to regulate gene expression and promote stem elongation. DOI: 10.1016/s0092-8674(02)00721-3 ; PMID: 12007405
- Nuclear protein phosphatases with Kelch-repeat domains modulate the response to brassinosteroids in Arabidopsis. DOI: 10.1101/gad.1174204 ; PMID: 14977918
- The regulation of DWARF4 expression is likely a critical mechanism in maintaining the homeostasis of bioactive brassinosteroids in Arabidopsis. DOI: 10.1104/pp.105.067918 ; PMID: 16407451
- Brassinosteroid signaling: a paradigm for steroid hormone signaling from the cell surface. DOI: 10.1126/science.1134040 ; PMID: 17138891
- An essential role for 14-3-3 proteins in brassinosteroid signal transduction in Arabidopsis. DOI: 10.1016/j.devcel.2007.06.009 ; PMID: 17681130
- Nucleocytoplasmic shuttling of BZR1 mediated by phosphorylation is essential in Arabidopsis brassinosteroid signaling. DOI: 10.1105/tpc.107.053728 ; PMID: 17873094
- Modulation of brassinosteroid-regulated gene expression by Jumonji domain-containing proteins ELF6 and REF6 in Arabidopsis. DOI: 10.1073/pnas.0802254105 ; PMID: 18467490
- BIN2 functions redundantly with other Arabidopsis GSK3-like kinases to regulate brassinosteroid signaling. DOI: 10.1104/pp.109.138099 ; PMID: 19395409
- Downstream nuclear events in brassinosteroid signalling. DOI: 10.1038/nature04681 ; PMID: 16672972
- 14-3-3 proteins in plant brassinosteroid signaling. DOI: 10.1016/j.devcel.2007.07.009 ; PMID: 17681126
- The primary signaling outputs of brassinosteroids are regulated by abscisic acid signaling. DOI: 10.1073/pnas.0900349106 ; PMID: 19240210
- Brassinosteroid signal transduction from receptor kinases to transcription factors. DOI: 10.1146/annurev.arplant.043008.092057 ; PMID: 20192752
- Predominant actions of cytosolic BSU1 and nuclear BIN2 regulate subcellular localization of BES1 in brassinosteroid signaling. DOI: 10.1007/s10059-010-0034-y ; PMID: 20387035
- A direct docking mechanism for a plant GSK3-like kinase to phosphorylate its substrates. DOI: 10.1074/jbc.M110.142547 ; PMID: 20522560
- Phosphorylation dependent nucleocytoplasmic shuttling of BES1 is a key regulatory event in brassinosteroid signaling. DOI: 10.1007/s10059-010-0035-x ; PMID: 20387034
- PP2A activates brassinosteroid-responsive gene expression and plant growth by dephosphorylating BZR1. DOI: 10.1038/ncb2151 ; PMID: 21258370
- Autophosphorylation profiling of Arabidopsis protein kinases using the cell-free system. DOI: 10.1016/j.phytochem.2011.02.029 ; PMID: 21477822
- The CDG1 kinase mediates brassinosteroid signal transduction from BRI1 receptor kinase to BSU1 phosphatase and GSK3-like kinase BIN2. DOI: 10.1016/j.molcel.2011.05.037 ; PMID: 21855796
- Brassinosteroid regulates stomatal development by GSK3-mediated inhibition of a MAPK pathway. DOI: 10.1038/nature10794 ; PMID: 22307275
- Molecular nature of mutations induced by high-LET irradiation with argon and carbon ions in Arabidopsis thaliana. DOI: 10.1016/j.mrfmmm.2012.04.010 ; PMID: 22579628
- A survey of dominant mutations in Arabidopsis thaliana. DOI: 10.1016/j.tplants.2012.08.006 ; PMID: 22995285
- Constitutive activation of brassinosteroid signaling in the Arabidopsis elongated-D/bak1 mutant. DOI: 10.1007/s11103-012-9963-5 ; PMID: 22961663
- MYBL2 is a substrate of GSK3-like kinase BIN2 and acts as a corepressor of BES1 in brassinosteroid signaling pathway in Arabidopsis. DOI: 10.1073/pnas.1205232109 ; PMID: 23169658
- Brassinosteroid-regulated GSK3/Shaggy-like kinases phosphorylate mitogen-activated protein (MAP) kinase kinases, which control stomata development in Arabidopsis thaliana. DOI: 10.1074/jbc.M112.384453 ; PMID: 23341468
- BSKs are partially redundant positive regulators of brassinosteroid signaling in Arabidopsis. DOI: 10.1111/tpj.12175 ; PMID: 23496207
- Arabidopsis heterotrimeric G protein β subunit, AGB1, regulates brassinosteroid signalling independently of BZR1. DOI: 10.1093/jxb/ert159 ; PMID: 23814276
- Identification of BZR1-interacting proteins as potential components of the brassinosteroid signaling pathway in Arabidopsis through tandem affinity purification. DOI: 10.1074/mcp.M113.029256 ; PMID: 24019147
- Transcription factor HAT1 is phosphorylated by BIN2 kinase and mediates brassinosteroid repressed gene expression in Arabidopsis. DOI: 10.1111/tpj.12368 ; PMID: 24164091
- Structural and functional characterization of Arabidopsis GSK3-like kinase AtSK12. DOI: 10.1007/s10059-013-0266-8 ; PMID: 24292946
- A secreted peptide acts on BIN2-mediated phosphorylation of ARFs to potentiate auxin response during lateral root development. DOI: 10.1038/ncb2893 ; PMID: 24362628
- Brassinosteroids control root epidermal cell fate via direct regulation of a MYB-bHLH-WD40 complex by GSK3-like kinases. DOI: 10.7554/eLife.02525 ; PMID: 24771765
- BRASSINOSTEROID INSENSITIVE2 interacts with ABSCISIC ACID INSENSITIVE5 to mediate the antagonism of brassinosteroids to abscisic acid during seed germination in Arabidopsis. DOI: 10.1105/tpc.114.130849 ; PMID: 25415975
- The Arabidopsis transcription factor BRASSINOSTEROID INSENSITIVE1-ETHYL METHANESULFONATE-SUPPRESSOR1 is a direct substrate of MITOGEN-ACTIVATED PROTEIN KINASE6 and regulates immunity. DOI: 10.1104/pp.114.250985 ; PMID: 25609555
- Transcription factors involved in brassinosteroid repressed gene expression and their regulation by BIN2 kinase. DOI: 10.4161/psb.27849 ; PMID: 24526246
- OCTOPUS Negatively Regulates BIN2 to Control Phloem Differentiation in Arabidopsis thaliana. DOI: 10.1016/j.cub.2015.08.033 ; PMID: 26387715
- Immunophilin-like FKBP42/TWISTED DWARF1 Interacts with the Receptor Kinase BRI1 to Regulate Brassinosteroid Signaling in Arabidopsis. DOI: 10.1016/j.molp.2016.01.008 ; PMID: 26808213
- Plant GSK3 proteins regulate xylem cell differentiation downstream of TDIF-TDR signalling. DOI: 10.1038/ncomms4504 ; PMID: 24662460
- GSK3-like kinases positively modulate abscisic acid signaling through phosphorylating subgroup III SnRK2s in Arabidopsis. DOI: 10.1073/pnas.1316717111 ; PMID: 24928519
- BR-dependent phosphorylation modulates PIF4 transcriptional activity and shapes diurnal hypocotyl growth. DOI: 10.1101/gad.243675.114 ; PMID: 25085420
- Heat shock protein 90 acts in brassinosteroid signaling through interaction with BES1/BZR1 transcription factor. DOI: 10.1016/j.jplph.2015.02.003 ; PMID: 25778412
- BZR1 Positively Regulates Freezing Tolerance via CBF-Dependent and CBF-Independent Pathways in Arabidopsis. DOI: 10.1016/j.molp.2017.01.004 ; PMID: 28089951
- Noncanonical role of Arabidopsis COP1/SPA complex in repressing BIN2-mediated PIF3 phosphorylation and degradation in darkness. DOI: 10.1073/pnas.1700850114 ; PMID: 28292892
- Light involved regulation of BZR1 stability and phosphorylation status to coordinate plant growth in Arabidopsis. DOI: 10.1042/BSR20170069 ; PMID: 28396515
- The F-box Protein KIB1 Mediates Brassinosteroid-Induced Inactivation and Degradation of GSK3-like Kinases in Arabidopsis. DOI: 10.1016/j.molcel.2017.05.012 ; PMID: 28575660
- High-temperature promotion of callus formation requires the BIN2-ARF-LBD axis in Arabidopsis. DOI: 10.1007/s00425-017-2747-z ; PMID: 28766014
- C4 Protein of Sweet Potato Leaf Curl Virus Regulates Brassinosteroid Signaling Pathway through Interaction with AtBIN2 and Affects Male Fertility in Arabidopsis. DOI: 10.3389/fpls.2017.01689 ; PMID: 29021807
- Brassinosteroids regulate pavement cell growth by mediating BIN2-induced microtubule stabilization. DOI: 10.1093/jxb/erx467 ; PMID: 29329424
- Comparative Analysis of CDPK Family in Maize, Arabidopsis, Rice, and Sorghum Revealed Potential Targets for Drought Tolerance Improvement. DOI: 10.3389/fchem.2017.00115 ; PMID: 29312925
- Reactive oxygen species-mediated BIN2 activity revealed by single-molecule analysis. DOI: 10.1111/nph.15669 ; PMID: 30597572
- Identification of critical cysteine sites in brassinosteroid-insensitive 1 and novel signaling regulators using a transient expression system. DOI: 10.1111/nph.15709 ; PMID: 30685894
- The Blue-Light Receptor CRY1 Interacts with BZR1 and BIN2 to Modulate the Phosphorylation and Nuclear Function of BZR1 in Repressing BR Signaling in Arabidopsis. DOI: 10.1016/j.molp.2019.02.001 ; PMID: 30763615
- Plant U-Box40 Mediates Degradation of the Brassinosteroid-Responsive Transcription Factor BZR1 in Arabidopsis Roots. DOI: 10.1105/tpc.18.00941 ; PMID: 30814258
- TTL Proteins Scaffold Brassinosteroid Signaling Components at the Plasma Membrane to Optimize Signal Transduction in Arabidopsis. DOI: 10.1105/tpc.19.00150 ; PMID: 31189737
- GSK3-like kinase BIN2 phosphorylates RD26 to potentiate drought signaling in Arabidopsis. DOI: 10.1111/tpj.14484 ; PMID: 31357236
- BRASSINOSTEROID-INSENSITIVE2 Negatively Regulates the Stability of Transcription Factor ICE1 in Response to Cold Stress in Arabidopsis. DOI: 10.1105/tpc.19.00058 ; PMID: 31409630
- A cell surface arabinogalactan-peptide influences root hair cell fate. DOI: 10.1111/nph.16487 ; PMID: 32064614
- SUMO Conjugation to BZR1 Enables Brassinosteroid Signaling to Integrate Environmental Cues to Shape Plant Growth. DOI: 10.1016/j.cub.2020.01.089 ; PMID: 32109396
- Molecular Mechanisms of Brassinosteroid-Mediated Responses to Changing Environments in Arabidopsis. DOI: 10.3390/ijms21082737 ; PMID: 32326491
- Brassinosteroids regulate root meristem development by mediating BIN2-UPB1 module in Arabidopsis. DOI: 10.1371/journal.pgen.1008883 ; PMID: 32609718
- The GSK3-like Kinase BIN2 Is a Molecular Switch between the Salt Stress Response and Growth Recovery in Arabidopsis thaliana. DOI: 10.1016/j.devcel.2020.08.005 ; PMID: 32891194
- A BIN2-GLK1 Signaling Module Integrates Brassinosteroid and Light Signaling to Repress Chloroplast Development in the Dark. DOI: 10.1016/j.devcel.2020.12.001 ; PMID: 33357403
- Protein farnesylation negatively regulates brassinosteroid signaling via reducing BES1 stability in Arabidopsis thaliana. DOI: 10.1111/jipb.13093 ; PMID: 33764637
- Arabidopsis NF-YCs play dual roles in repressing brassinosteroid biosynthesis and signaling during light-regulated hypocotyl elongation. DOI: 10.1093/plcell/koab112 ; PMID: 33871651
- Sugar inhibits brassinosteroid signaling by enhancing BIN2 phosphorylation of BZR1. DOI: 10.1371/journal.pgen.1009540 ; PMID: 33989283
- BIN2 negatively regulates plant defence against Verticillium dahliae in Arabidopsis and cotton. DOI: 10.1111/pbi.13640 ; PMID: 34036698
- Gene co-expression network analysis identifies BEH3 as a stabilizer of secondary vascular development in Arabidopsis. DOI: 10.1093/plcell/koab151 ; PMID: 34059919
- GSK3s: nodes of multilayer regulation of plant development and stress responses. DOI: 10.1016/j.tplants.2021.07.017 ; PMID: 34417080
- Stress response of ABI5 to BR stress and its regulation on hypocotyls growth in Arabidopsis thaliana. DOI: 10.16288/j.yczz.21-199 ; PMID: 34702702
- ROPGAP-dependent interaction between brassinosteroid and ROP2-GTPase signaling controls pavement cell shape in Arabidopsis. DOI: 10.1016/j.cub.2021.12.043 ; PMID: 35085499
- [Regulation of crop agronomic traits and abiotic stress responses by brassinosteroids: a review]. DOI: 10.13345/j.cjb.210236 ; PMID: 35142117
- The CCCH zinc finger protein C3H15 negatively regulates cell elongation by inhibiting brassinosteroid signaling. DOI: 10.1093/plphys/kiac046 ; PMID: 35139225
- Heat Shock-Induced Accumulation of the Glycogen Synthase Kinase 3-Like Kinase BRASSINOSTEROID INSENSITIVE 2 Promotes Early Flowering but Reduces Thermotolerance in Arabidopsis. DOI: 10.3389/fpls.2022.838062 ; PMID: 35154235
- The photomorphogenic repressors BBX28 and BBX29 integrate light and brassinosteroid signaling to inhibit seedling development in Arabidopsis. DOI: 10.1093/plcell/koac092 ; PMID: 35294019
- BAK1 plays contrasting roles in regulating abscisic acid-induced stomatal closure and abscisic acid-inhibited primary root growth in Arabidopsis. DOI: 10.1111/jipb.13257 ; PMID: 35352463
- Phytochromes A and B Mediate Light Stabilization of BIN2 to Regulate Brassinosteroid Signaling and Photomorphogenesis in Arabidopsis. DOI: 10.3389/fpls.2022.865019 ; PMID: 35432407
- Brassinosteroids enhance salicylic acid-mediated immune responses by inhibiting BIN2 phosphorylation of clade I TGA transcription factors in Arabidopsis. DOI: 10.1016/j.molp.2022.05.002 ; PMID: 35524409
- Adenosine monophosphate deaminase modulates BIN2 activity through hydrogen peroxide-induced oligomerization. DOI: 10.1093/plcell/koac203 ; PMID: 35876813
- Brassinosteroids promote thermotolerance through releasing BIN2-mediated phosphorylation and suppression of HsfA1 transcription factors in Arabidopsis. DOI: 10.1016/j.xplc.2022.100419 ; PMID: 35927943
- Salicylic acid-activated BIN2 phosphorylation of TGA3 promotes Arabidopsis PR gene expression and disease resistance. DOI: 10.15252/embj.2022110682 ; PMID: 35950443
- Brassinosteroids modulate autophagy through phosphorylation of RAPTOR1B by the GSK3-like kinase BIN2 in Arabidopsis. DOI: 10.1080/15548627.2022.2124501 ; PMID: 36151786
- HOP1 and HOP2 are involved in salt tolerance by facilitating the brassinosteroid-related nucleo-cytoplasmic partitioning of the HSP90-BIN2 complex. DOI: 10.1111/pce.14441 ; PMID: 36123951
- A role for brassinosteroid signalling in decision-making processes in the Arabidopsis seedling. DOI: 10.1371/journal.pgen.1010541 ; PMID: 36508461
- Spatiotemporal formation of the large vacuole regulated by the BIN2-VLG module is required for female gametophyte development in Arabidopsis. DOI: 10.1093/plcell/koad007 ; PMID: 36648110
- Histidine kinase inhibitors impair shoot regeneration in Arabidopsis thaliana via cytokinin signaling and SAM patterning determinants. DOI: 10.3389/fpls.2022.894208 ; PMID: 36684719
- BIN2 phosphorylates the Thr280 of CO to restrict its function in promoting Arabidopsis flowering. DOI: 10.3389/fpls.2023.1068949 ; PMID: 36794216
- Coordinated regulation of vegetative phase change by brassinosteroids and the age pathway in Arabidopsis. DOI: 10.1038/s41467-023-38207-z ; PMID: 37147280
- Analyses of genes encoding the Glycogen Synthase Kinases in rice and Arabidopsis reveal mechanisms which regulate their expression during development and responses to abiotic stresses. DOI: 10.1016/j.plantsci.2023.111724 ; PMID: 37142096
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Comparative Analysis of CDPK Family in Maize, Arabidopsis, Rice, and Sorghum Revealed Potential Targets for Drought Tolerance Improvement. DOI: 10.3389/fchem.2017.00115 ; PMID: 29312925
Sequences:
cDNA Sequence
- >AT4G18710.2
AAAGAAAGAGAAAGAGAAGAGCTGGATTCACATGAAGAAGATCCTGTTTTTTGGTTTTTCCACATTTGACCCTTCAATTAGTTGTCTTGAGATTCCTGTTCTTACAGATGTTTTGTGATAATAAATCTAGTTTAGTTAGTACTCTTGAAGTTGAACGGTTTTGAGTTCTGGGTTTGTCCAAAGTTTTGAGCTTTCGTTAACTTTTTGACTTACCCTGAGATCTCTGAGGGTTTTGAGTTCTGAGCTTAGAATTTTCTAAGTTAGCTCTGTTGGGATGATCCATGTCTATATATCTCGATCTGTGATTAATCCAGAGTTTATACAAGCTGCTAGATCCATAATTGAACATAGATTAGTCCTTGTTTGGTTTGTTATATGTATTTGTTTTGTTTACCATTCTTTTGGCGTGACAAAAGTATATATTTTTAGTTTTAACTAAATCAGATTCACTCTGCGTAACGGTTATTTTGTAACCACTCTTTTAGGATAAAAGTTTCCTTCTTTAGACTTTTGATTCTCAGACAAGCATTATTCTTTTAGCTTTTGATAATGGTTTTGTGCTGATATTAAAGCTTTTCTCTTTCAGGAGATGCCTGCTGCTGTAGTTGATGGACATGATCAAGTCACTGGTCATATTATTTCCACCACAATCGGTGGCAAAAATGGTGAACCAAAACAGACAATTAGTTACATGGCGGAGCGAGTTGTTGGTACAGGCTCGTTCGGGATCGTTTTCCAAGCAAAATGTTTGGAGACTGGAGAAACCGTGGCGATAAAGAAGGTTTTGCAAGATAGAAGATACAAGAACCGAGAACTTCAGTTGATGCGTGTGATGGATCATCCGAATGTGGTTTGTTTGAAGCATTGCTTCTTTTCGACTACAAGTAAAGACGAGCTTTTCTTGAACTTGGTTATGGAGTATGTCCCTGAGAGCTTGTATCGAGTTCTGAAACATTATAGTAGTGCAAACCAAAGAATGCCTCTTGTCTATGTTAAACTTTACATGTATCAGATCTTCCGGGGACTTGCTTACATTCACAATGTTGCTGGAGTTTGTCACAGAGATCTAAAGCCTCAAAATCTTCTGGTTGATCCTCTTACTCATCAAGTCAAAATCTGTGACTTTGGCAGTGCGAAACAGCTCGTTAAAGGTGAAGCCAACATTTCTTACATCTGCTCACGATTCTACCGTGCACCCGAGCTCATATTTGGTGCCACTGAGTACACAACTTCTATTGATATCTGGTCTGCTGGTTGTGTTCTTGCTGAGCTTCTTCTTGGTCAGCCATTATTTCCCGGAGAAAATGCTGTGGATCAGCTCGTTGAAATTATAAAAGTTCTTGGTACACCAATTCGAGAAGAAATCCGTTGTATGAATCCACGCATTACACAGATTTCAGGTTTCCGCAGATAAAGGCACATCTGTGGCACAAGGTTCGTGTCTTTTCTCTTTTTACATACATTCTTGAGAGAACCAAACGCTCATTTACTTAA - >AT4G18710.1
AAAGAAAGAGAAAGAGAAGAGCTGGATTCACATGAAGAAGATCCTGTTTTTTGGTTTTTCCACATTTGACCCTTCAATTAGTTGTCTTGAGATTCCTGTTCTTACAGATGTTTTGTGATAATAAATCTAGTTTAGTTAGTACTCTTGAAGTTGAACGGTTTTGAGTTCTGGGTTTGTCCAAAGTTTTGAGCTTTCGTTAACTTTTTGACTTACCCTGAGATCTCTGAGGGTTTTGAGTTCTGAGCTTAGAATTTTCTAAGTTAGCTCTGTTGGGATGATCCATGTCTATATATCTCGATCTGTGATTAATCCAGAGTTTATACAAGCTGCTAGATCCATAATTGAACATAGATTAGTCCTTGTTTGGTTTGTTATATGTATTTGTTTTGTTTACCATTCTTTTGGCGTGACAAAAGTATATATTTTTAGTTTTAACTAAATCAGATTCACTCTGCGTAACGGTTATTTTGTAACCACTCTTTTAGGATAAAAGTTTCCTTCTTTAGACTTTTGATTCTCAGACAAGCATTATTCTTTTAGCTTTTGATAATGGTTTTGTGCTGATATTAAAGCTTTTCTCTTTCAGGAGATGCCTGCTGCTGTAGTTGATGGACATGATCAAGTCACTGGTCATATTATTTCCACCACAATCGGTGGCAAAAATGGTGAACCAAAACAGACAATTAGTTACATGGCGGAGCGAGTTGTTGGTACAGGCTCGTTCGGGATCGTTTTCCAAGCAAAATGTTTGGAGACTGGAGAAACCGTGGCGATAAAGAAGGTTTTGCAAGATAGAAGATACAAGAACCGAGAACTTCAGTTGATGCGTGTGATGGATCATCCGAATGTGGTTTGTTTGAAGCATTGCTTCTTTTCGACTACAAGTAAAGACGAGCTTTTCTTGAACTTGGTTATGGAGTATGTCCCTGAGAGCTTGTATCGAGTTCTGAAACATTATAGTAGTGCAAACCAAAGAATGCCTCTTGTCTATGTTAAACTTTACATGTATCAGATCTTCCGGGGACTTGCTTACATTCACAATGTTGCTGGAGTTTGTCACAGAGATCTAAAGCCTCAAAATCTTCTGGTTGATCCTCTTACTCATCAAGTCAAAATCTGTGACTTTGGCAGTGCGAAACAGCTCGTTAAAGGTGAAGCCAACATTTCTTACATCTGCTCACGATTCTACCGTGCACCCGAGCTCATATTTGGTGCCACTGAGTACACAACTTCTATTGATATCTGGTCTGCTGGTTGTGTTCTTGCTGAGCTTCTTCTTGGTCAGCCATTATTTCCCGGAGAAAATGCTGTGGATCAGCTCGTTGAAATTATAAAAGTTCTTGGTACACCAATTCGAGAAGAAATCCGTTGTATGAATCCACGCATTACACAGATTTCAGGTTTCCGCAGATAAAGGCACATCTGTGGCACAAGGTTCGTGTCTTTTCTCTTTTTACATACATTCTTGAGAGAACCAAACGCTCATTTACTTAA
CDS Sequence
Protein Sequence