Information report for AT4G17530
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- GO:0005794 — located in — Golgi apparatus
- GO:0009860 — acts upstream of or within — pollen tube growth
- GO:0005829 — located in — cytosol
- GO:0016192 — involved in — vesicle-mediated transport
- GO:0005886 — located in — plasma membrane
- GO:0005794 — is active in — Golgi apparatus
- GO:0003924 — enables — GTPase activity
- GO:0009555 — acts upstream of or within — pollen development
- GO:0009506 — located in — plasmodesma
- GO:0000325 — located in — plant-type vacuole
Functional Keywords
- root , pollen , pollen tube cell , pollen
Literature and News
- The Arabidopsis Rab GTPase family: another enigma variation. DOI: 10.1016/s1369-5266(02)00307-2 ; PMID: 12393015
- Analysis of the small GTPase gene superfamily of Arabidopsis. DOI: 10.1104/pp.013052 ; PMID: 12644670
- A genome-wide identification of E2F-regulated genes in Arabidopsis. DOI: 10.1046/j.1365-313x.2003.01662.x ; PMID: 12609051
- Comparative analysis of expressed sequence tags from Sesamum indicum and Arabidopsis thaliana developing seeds. DOI: 10.1023/b:plan.0000004304.22770.e9 ; PMID: 14682612
- Identification of new intrinsic proteins in Arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M400001-MCP200 ; PMID: 15060130
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- Gene expression changes in Arabidopsis thaliana seedling roots exposed to the munition hexahydro-1,3,5-trinitro-1,3,5-triazine. DOI: 10.1021/es050385r ; PMID: 16173598
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- Comparison of gene expression in segregating families identifies genes and genomic regions involved in a novel adaptation, zinc hyperaccumulation. DOI: 10.1111/j.1365-294X.2006.02981.x ; PMID: 16911220
- Articulation of three core metabolic processes in Arabidopsis: fatty acid biosynthesis, leucine catabolism and starch metabolism. DOI: 10.1186/1471-2229-8-76 ; PMID: 18616834
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Subcellular localization and functional analysis of the Arabidopsis GTPase RabE. DOI: 10.1104/pp.108.132092 ; PMID: 19233904
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- AtRabD2b and AtRabD2c have overlapping functions in pollen development and pollen tube growth. DOI: 10.1186/1471-2229-11-25 ; PMID: 21269510
- Mediator of tolerance to abiotic stress ERF6 regulates susceptibility of Arabidopsis to Meloidogyne incognita. DOI: 10.1111/mpp.12745 ; PMID: 30160354
- A novel calmodulin-interacting Domain of Unknown Function 506 protein represses root hair elongation in Arabidopsis. DOI: 10.1111/pce.14316 ; PMID: 35312071
- Identification of new intrinsic proteins in Arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M400001-MCP200 ; PMID: 15060130
- The vegetative vacuole proteome of Arabidopsis thaliana reveals predicted and unexpected proteins. DOI: 10.1105/tpc.104.027078 ; PMID: 15539469
- Proteome mapping of mature pollen of Arabidopsis thaliana. DOI: 10.1002/pmic.200402011 ; PMID: 16247729
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
Gene Resources
- UniProt: A0A178USY3
- EMBL: CACSHJ010000095, LUHQ01000004
- AlphaFoldDB: A0A178USY3
- EnsemblPlants: AT4G17530.1
- Gramene: AT4G17530.1
- KEGG: ath:AT4G17530
- Orthologous matrix: TQMAKDF
- ExpressionAtlas: AT4G17530
- InterPro: IPR001806, IPR005225, IPR027417
- PANTHER: PTHR47977
- SUPFAM: SSF52540
- PROSITE: PS51419, PS51420, PS51421
- Gene3D: 3.40.50.300
- OrthoDB: A0A178USY3
- SWISS-MODEL: A0A178USY3
- Conserved Domain Database: cd01869
Sequences
cDNA Sequence
- >AT4G17530.1
CTTCTGGGTTGGCGAAGACACGTCAGCAATGCAACCAAAAAAAAGAAGCATTTAAAAACAATAGTTGTAGTGTGGCCCTTTCTCATTTCTTAACCACGTCGTCGACACAACAAACCGATCGTGTTACGTCTCTCTCTCTCTCAGTCTCTCATCACCGACGAAGATCACGGCTCTTTTCTCTGTTTAATCGGCGGAATCTCTCTTCTTATTTTATTTTTCTTCCGGTAGATCGATCCAGCTCCGAGATCAATCATGAATCCTGAATATGACTATTTGTTCAAGCTTTTGCTCATTGGTGATTCTGGTGTTGGAAAGTCGTGCTTGCTTCTAAGGTTTGCTGATGATTCCTACCTGGATAGCTACATCAGCACCATTGGTGTCGACTTTAAAATCCGAACAGTCGAACAAGATGGAAAGACCATCAAACTCCAGATTTGGGATACGGCAGGCCAGGAACGTTTCAGAACGATTACTAGCAGTTACTACAGAGGAGCTCATGGAATTATTGTGACTTATGATGTAACAGATCTAGAAAGCTTCAACAACGTCAAGCAATGGCTAAATGAAATCGACCGCTATGCAAGTGAGAATGTTAACAAGCTACTGGTTGGGAACAAGTGTGATCTCACATCACAGAAAGTTGTATCCACTGAGACAGCTAAGGCTTTCGCTGATGAACTTGGGATCCCATTCTTGGAAACAAGTGCTAAGAATGCTACCAATGTCGAAGAAGCTTTCATGGCCATGACTGCTGCAATCAAGACCAGAATGGCGAGCCAACCTGCAGGAGGATCTAAGCCACCAACGGTCCAGATCCGAGGACAACCTGTTAACCAGCAATCAGGCTGCTGCTCCTCTTAATTCGCTTTGGTAACACTTAACCATATTATGTCATTCGTTTGCATGTAAGAAATCTAAACAACGTTGCTTCTTAAATCTTTTGTATTTGGTTTTTCAATTTTTCACTTGTGTCCAAAAGCTTTTAAATTCTTTGTAATGGTACTTGGATTATTAATAAACTTCTTTAGTAAAAA
CDS Sequence
Protein Sequence