Gene Details:
- Gene ID: AT4G17390
- Gene Symbol: eL15y
- Gene Name: Ribosomal Protein eL15y
- Description: Ribosomal protein L23/L15e family protein;(source:Araport11)
- TAIR Accession: locus:2130923
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Gene Ontology:
- GO:0002181 — involved in — cytoplasmic translation
- GO:0005737 — located in — cytoplasm
- GO:0003735 — enables — structural constituent of ribosome
- GO:0022625 — located in — cytosolic large ribosomal subunit
- GO:0003723 — enables — RNA binding
- GO:0022625 — part of — cytosolic large ribosomal subunit
- GO:0003729 — enables — mRNA binding
- GO:0005829 — located in — cytosol
- GO:0005730 — located in — nucleolus
Function-related keywords:
- root , pollen tube cell , pollen , guard cell
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- a high-density colony array study (HDCA). DOI: 10.1046/j.1365-313x.2003.01847.x ; PMID: 12969430
- Identification of cis-elements that regulate gene expression during initiation of axillary bud outgrowth in Arabidopsis. DOI: 10.1104/pp.104.057984 ; PMID: 15908603
- Comparative genomics of Brassica oleracea and Arabidopsis thaliana reveal gene loss, fragmentation, and dispersal after polyploidy. DOI: 10.1105/tpc.106.041665 ; PMID: 16632643
- The Arabidopsis co-expression tool (ACT): a WWW-based tool and database for microarray-based gene expression analysis. DOI: 10.1111/j.1365-313X.2006.02681.x ; PMID: 16623895
- Identification of plant promoter constituents by analysis of local distribution of short sequences. DOI: 10.1186/1471-2164-8-67 ; PMID: 17346352
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. DOI: 10.1091/mbc.e04-09-0791 ; PMID: 15496452
- Membrane proteomic analysis of Arabidopsis thaliana using alternative solubilization techniques. DOI: 10.1021/pr060525b ; PMID: 17432890
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Analysis of the Arabidopsis cytosolic proteome highlights subcellular partitioning of central plant metabolism. DOI: 10.1021/pr1009433 ; PMID: 21166475
Sequences:
cDNA Sequence
- >AT4G17390.1
GGGCTTTCTTTGTCTGATGGAAACCCTAATTCCCATGGAGCCATCTATTTAAAGCACAAACCTAATTCGAAGAAAGAAGTGACTGCGACGCCGGAAAATCGCAATGGGTGCGTACAAATACGTGTCGGAGCTATGGAGGAAGAAGCAGTCGGATGTGATGAGGTTTCTTCAGAGGGTTAGGTGTTGGGAGTATCGCCAGCAGCCTTCCATTGTTCGTCTTGTTCGTCCCACTCGTCCCGACAAGGCTCGTCGTCTCGGCTACAAGGCCAAGCAGGGGTTTGTTGTCTACCGTGTTCGAGTCAGACGTGGTGGACGCAAGAGGCCAGTGCCTAAGGGTATCGTGTACGGTAAACCCACCAACCAGGGAGTGACACAGCTCAAATTCCAGCGTAGTAAGAGATCTGTTGCTGAGGAACGTGCTGGTCGCAAACTGGGAGGCCTTAGGGTTGTTAACTCCTACTGGCTCAATGAGGACTCTACCTACAAGTACTACGAGATTATCCTTGTAGACCCTGCACACAATGCCGTCCGAAATGATCCAAGGATCAACTGGATCTGCAACCCTGTGCACAAGCACAGAGAACTCAGAGGTCTCACCTCCGAAGGAAAGAAGAATCGTGGTCTTCGTGGAAAGGGTCACAACAACCACAAGAACAGACCTTCCCGCAGGGCAACCTGGAAGAAGAACAACAGTATCTCTCTCCGTCGTTACCGGTGATCAGTTTTATGTTTTGTTTTTTCTCGAACTGGTATATCTTCAGTGTGGATTGTGTTTCGGAATTCTGGAATTACATTGGGATGGAAGACTTTCACATTCAAGAGTTTGTTTCAAGTTTTGAGTTCTTTGATTCTGACCATAAAGCAATGTTTCTTAGTTATTACTTATTTTTGATGATTAATTTTTCCCTACTTAATATCAAGAGTGTAGATTTGCTCCTACCTTTAGCCTCTGAAAGCCAACAAATCGAAAGCTCACTTGGGACTAGTAATGTAGAACCCTTATAGACATTGCAATTAAAACGTGAATGTATCC
CDS Sequence
Protein Sequence