Information report for AT4G17090
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- GO:0000024 — acts upstream of or within — maltose biosynthetic process
- GO:0009409 — acts upstream of or within — response to cold
- GO:0005576 — located in — extracellular region
- GO:0005983 — acts upstream of or within — starch catabolic process
- GO:0005829 — located in — cytosol
- GO:0009570 — located in — chloroplast stroma
- GO:0016161 — enables — beta-amylase activity
- GO:0102229 — enables — amylopectin maltohydrolase activity
Functional Keywords
Literature and News
- Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. DOI: 10.1126/science.290.5499.2110 ; PMID: 11118138
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- Diurnal changes in the transcriptome encoding enzymes of starch metabolism provide evidence for both transcriptional and posttranscriptional regulation of starch metabolism in Arabidopsis leaves. DOI: 10.1104/pp.104.044347 ; PMID: 15347792
- Starch degradation. DOI: 10.1146/annurev.arplant.56.032604.144257 ; PMID: 15862090
- Daylength and circadian effects on starch degradation and maltose metabolism. DOI: 10.1104/pp.105.061903 ; PMID: 16055686
- The cold-induced early activation of phospholipase C and D pathways determines the response of two distinct clusters of genes in Arabidopsis cell suspensions. DOI: 10.1104/pp.105.068171 ; PMID: 16258011
- RNA interference of Arabidopsis beta-amylase8 prevents maltose accumulation upon cold shock and increases sensitivity of PSII photochemical efficiency to freezing stress. DOI: 10.1111/j.1365-313X.2005.02565.x ; PMID: 16297066
- ABI4 mediates the effects of exogenous trehalose on Arabidopsis growth and starch breakdown. DOI: 10.1007/s11103-006-9082-2 ; PMID: 17031512
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- The steady-state level of Mg-protoporphyrin IX is not a determinant of plastid-to-nucleus signaling in Arabidopsis. DOI: 10.1073/pnas.0803245105 ; PMID: 18818313
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Metabolic pathways involved in cold acclimation identified by integrated analysis of metabolites and transcripts regulated by DREB1A and DREB2A. DOI: 10.1104/pp.109.135327 ; PMID: 19502356
- Starch turnover in developing oilseed embryos. DOI: 10.1111/j.1469-8137.2010.03311.x ; PMID: 20546137
- A nuclear-localized protein, KOLD SENSITIV-1, affects the expression of cold-responsive genes during prolonged chilling in Arabidopsis. DOI: 10.1016/j.jplph.2010.07.001 ; PMID: 20674078
- Glucan, water dikinase phosphorylates crystalline maltodextrins and thereby initiates solubilization. DOI: 10.1111/j.1365-313x.2008.03513.x ; PMID: 18419779
- Comprehensive survey of redox sensitive starch metabolising enzymes in Arabidopsis thaliana. DOI: 10.1016/j.plaphy.2012.06.017 ; PMID: 22789914
- Inferring transcriptional gene regulation network of starch metabolism in Arabidopsis thaliana leaves using graphical Gaussian model. DOI: 10.1186/1752-0509-6-100 ; PMID: 22898356
- Starch metabolism in Arabidopsis. DOI: 10.1199/tab.0160 ; PMID: 23393426
- Starch metabolism and antiflorigenic signals modulate the juvenile-to-adult phase transition in Arabidopsis. DOI: 10.1111/pce.12088 ; PMID: 23452177
- Arabidopsis thaliana mutant lpsi reveals impairment in the root responses to local phosphate availability. DOI: 10.1016/j.plaphy.2013.12.009 ; PMID: 24561248
- β-Amylase1 and β-amylase3 are plastidic starch hydrolases in Arabidopsis That Seem to Be Adapted for Different Thermal, pH, and stress conditions. DOI: 10.1104/pp.114.246421 ; PMID: 25293962
- Environmental Regulation of Heterosis in the Allopolyploid Arabidopsis suecica. DOI: 10.1104/pp.16.00052 ; PMID: 26896394
- Regulation of Leaf Starch Degradation by Abscisic Acid Is Important for Osmotic Stress Tolerance in Plants. DOI: 10.1105/tpc.16.00143 ; PMID: 27436713
- Genetic and isotope ratio mass spectrometric evidence for the occurrence of starch degradation and cycling in illuminated Arabidopsis leaves. DOI: 10.1371/journal.pone.0171245 ; PMID: 28152100
- Comparative Proteomic Analysis of Coregulation of CIPK14 and WHIRLY1/3 Mediated Pale Yellowing of Leaves in Arabidopsis. DOI: 10.3390/ijms19082231 ; PMID: 30065159
- Review: The Arabidopsis β-amylase (BAM) gene family: Diversity of form and function. DOI: 10.1016/j.plantsci.2018.08.016 ; PMID: 30348315
- Young seedlings adapt to stress by retaining starch and retarding growth through ABA-Dependent and -independent pathways in Arabidopsis. DOI: 10.1016/j.bbrc.2019.06.023 ; PMID: 31186142
- Involvement of five catalytically active Arabidopsis β-amylases in leaf starch metabolism and plant growth. DOI: 10.1002/pld3.199 ; PMID: 32072133
- The CLE33 peptide represses phloem differentiation via autocrine and paracrine signaling in Arabidopsis. DOI: 10.1038/s42003-023-04972-2 ; PMID: 37280369
- Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. DOI: 10.1126/science.290.5499.2110 ; PMID: 11118138
- Genes that are uniquely stress regulated in salt overly sensitive (sos) mutants. DOI: 10.1104/pp.126.1.363 ; PMID: 11351099
- The cold-induced early activation of phospholipase C and D pathways determines the response of two distinct clusters of genes in Arabidopsis cell suspensions. DOI: 10.1104/pp.105.068171 ; PMID: 16258011
- ABI4 mediates the effects of exogenous trehalose on Arabidopsis growth and starch breakdown. DOI: 10.1007/s11103-006-9082-2 ; PMID: 17031512
- Glucan, water dikinase activity stimulates breakdown of starch granules by plastidial beta-amylases. DOI: 10.1104/pp.107.104224 ; PMID: 17631522
Gene Resources
- UniProt: A0A178V4I8
- EMBL: CACSHJ010000095, LR881469, LUHQ01000004
- AlphaFoldDB: A0A178V4I8
- EnsemblPlants: AT4G17090.1
- Gramene: AT4G17090.1
- KEGG: ath:AT4G17090
- Orthologous matrix: YNWEGYF
- ExpressionAtlas: AT4G17090
- InterPro: IPR001371, IPR001554, IPR017853
- PANTHER: PTHR31352, PTHR31352:SF1
- SUPFAM: SSF51445
- PROSITE: PS00506
- Gene3D: 3.20.20.80
- OrthoDB: A0A178V4I8
- SWISS-MODEL: A0A178V4I8
Sequences
cDNA Sequence
- >AT4G17090.1
TGGGTCTCCAAACCACAGCCAATCAATATTCTTTATAAATACAAACACACAAACAGCATCTTTCTCTCAAACACAAACATATCTTCTATCAAACACCAACAGCTCTATTCTCTACCTCATTTCTCATCATAACAAAGAGAGAGAAAAAAACTATGGAATTGACACTGAATTCCTCGAGTTCTCTTATCAAACGTAAAGATGCCAAGAGTTCTAGAAACCAAGAAAGTTCCTCCAACAACATGACCTTTGCGAAGATGAAGCCGCCAACATATCAATTCCAAGCAAAGAACTCGGTTAAGGAAATGAAGTTCACTCACGAGAAGACCTTCACGCCAGAAGGTGAAACCCTTGAGAAATGGGAGAAGCTCCACGTTCTCTCATACCCACACTCCAAGAACGACGCTAGCGTTCCGGTGTTCGTCATGTTACCGCTCGACACAGTAACAATGTCAGGGCATTTGAACAAACCACGAGCCATGAACGCTAGTTTGATGGCCCTGAAAGGAGCTGGTGTGGAAGGTGTGATGGTGGATGCTTGGTGGGGATTGGTGGAGAAAGATGGACCTATGAATTATAACTGGGAAGGCTATGCCGAGCTTATACAGATGGTTCAAAAGCACGGTCTCAAACTCCAGGTCGTTATGTCATTCCATCAATGTGGAGGAAACGTAGGAGACTCTTGCAGTATCCCCTTGCCTCCATGGGTGCTTGAAGAGATCAGCAAGAACCCTGATCTTGTCTACACAGACAAATCTGGGAGAAGGAACCCTGAATATATCTCCTTGGGATGTGATTCTGTGCCTGTCCTAAGAGGAAGAACACCTATCCAGGTCTACTCAGATTTCATGAGGAGCTTCCGTGAACGATTTGAAGGCTACATAGGAGGAGTTATTGCGGAAATTCAAGTAGGAATGGGACCTTGTGGAGAATTGAGATACCCATCATACCCTGAGAGCAACGGGACCTGGAGATTCCCCGGAATTGGAGAGTTCCAGTGCTACGACAAGTATATGAAATCGTCACTTCAAGCATATGCTGAGTCAATCGGGAAAACTAACTGGGGAACAAGTGGACCTCATGATGCCGGCGAGTACAAGAACCTCCCAGAAGATACTGAATTTTTCAGGAGAGACGGAACATGGAATAGCGAGTATGGAAAGTTTTTCATGGAATGGTACTCCGGGAAGCTGCTAGAACATGGAGACCAACTCCTATCTTCAGCGAAAGGTATCTTTCAAGGAAGCGGAGCAAAGCTATCAGGAAAGGTAGCTGGAATTCACTGGCACTACAACACCAGGTCACACGCAGCTGAGCTAACCGCTGGATACTACAACACAAGAAACCATGACGGGTATCTGCCAATAGCTAAGATGTTCAACAAACATGGAGTTGTGCTCAACTTCACCTGCATGGAGATGAAAGACGGGGAGCAACCTGAGCACGCGAATTGCTCACCAGAAGGTCTGGTCAAGCAAGTACAGAACGCGACAAGGCAGGCCGGAACCGAACTAGCAGGGGAGAACGCGCTAGAACGATATGACTCAAGCGCATTCGGACAAGTGGTAGCAACAAATAGGTCAGATTCTGGAAATGGGTTAACCGCATTTACTTACCTAAGAATGAACAAGCGGTTATTTGAGGGTCAAAATTGGCAGCAGTTAGTGGAGTTTGTTAAGAACATGAAGGAAGGTGGTCATGGGAGGAGACTCTCAAAAGAAGACACAACTGGAAGTGACCTTTATGTTGGATTTGTCAAAGGCAAGATCGCTGAGAATGTGGAGGAGGCTGCTTTAGTGTAATTTCCCACATAGGTACATACATATAGTGTGGTGTTTATTGTATTCCTGTCTGATAAATAACTAGAGAGATCAAACCAGTAAGAGTGTTAAAGCTATAGATTTGCACAATTCTGGGTCAGAGTCAGAGCAAAGAGAAGCAAAATCAAGATGATGTACACTTAGATGTTTCCTATGAGTTTTCCTTGTACATCATCTTCATACTCTTAATCTCAAATACTATGCATTTTTCTCCTACAGTTTTATATTATCTCAATCAATGTGAGTTTCTCTTATCATCAATCAATATGCATCTCTCGTTCAAACG
CDS Sequence
Protein Sequence