Gene Details:
- Gene ID: AT4G16720
- Gene Symbol: eL15z
- Gene Name: Ribosomal Protein eL15z
- Description: Ribosomal protein L23/L15e family protein;(source:Araport11)
- TAIR Accession: locus:2129081
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
Gene Ontology:
- GO:0022626 — located in — cytosolic ribosome
- GO:0022625 — located in — cytosolic large ribosomal subunit
- GO:0005829 — located in — cytosol
- GO:0022625 — part of — cytosolic large ribosomal subunit
- GO:0003723 — enables — RNA binding
- GO:0003735 — enables — structural constituent of ribosome
- GO:0003729 — enables — mRNA binding
- GO:0000325 — located in — plant-type vacuole
- GO:0002181 — involved in — cytoplasmic translation
- GO:0005737 — located in — cytoplasm
Function-related keywords:
Literature:
- The organization of cytoplasmic ribosomal protein genes in the Arabidopsis genome. DOI: 6834 ; PMID: 11598216
- Transcriptional profiling of Arabidopsis tissues reveals the unique characteristics of the pollen transcriptome. DOI: 10.1104/pp.103.028241 ; PMID: 14500793
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- Expression profiling of auxin-treated Arabidopsis roots: toward a molecular analysis of lateral root emergence. DOI: 10.1093/pcp/pcj043 ; PMID: 16621846
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Differential phosphorylation of ribosomal proteins in Arabidopsis thaliana plants during day and night. DOI: 10.1371/journal.pone.0029307 ; PMID: 22195043
- Discovering the RNA-Binding Proteome of Plant Leaves with an Improved RNA Interactome Capture Method. DOI: 10.3390/biom10040661 ; PMID: 32344669
- Plant cytoplasmic ribosomal proteins: an update on classification, nomenclature, evolution and resources. DOI: 10.1111/tpj.15667 ; PMID: 35000252
- An updated nomenclature for plant ribosomal protein genes. DOI: 10.1093/plcell/koac333 ; PMID: 36423343
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- High heterogeneity within the ribosomal proteins of the Arabidopsis thaliana 80S ribosome. DOI: 10.1007/s11103-005-0699-3 ; PMID: 15821981
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- Analysis of the Arabidopsis cytosolic ribosome proteome provides detailed insights into its components and their post-translational modification. DOI: 10.1074/mcp.M700052-MCP200 ; PMID: 17934214
Sequences:
cDNA Sequence
- >AT4G16720.1
GGTCCATTGGAGATAAAACCCTAATCTTCCACTTTAAATCAGGAACAAACCCTTCACTGCGCCAGTGTTGTGCGGCTCTGCGAATCTTCGAAAATGGGTGCGTACAAGTATGTATCTGAGCTATGGAGGAAGAAACAGTCCGATGTGATGAGATTCCTCCAGAGGGTTAGGTGCTGGGAGTACAGACAGCAACCTTCGATTGTTCGTCTCGTCAGGCCTACTCGTCCTGATAAGGCTCGTCGTTTGGGTTACAAGGCCAAGCAGGGCTTTGTTGTGTACCGTGTACGTGTGAGACGTGGTGGACGCAAGAGGCCAGTGCCTAAGGGTATTGTGTATGGTAAGCCAACAAACCAGGGAGTGACACAACTCAAGTTCCAGCGTAGCAAGCGTTCTGTTGCTGAGGAGCGTGCTGGCAGGAAATTGGGTGGTCTCAGAGTTGTCAACTCTTACTGGCTCAATGAGGATTCGACCTACAAGTACTACGAGATCATCTTGGTTGACCCAGCACACAATGCTGTGCGTAATGACCCGAGAATCAACTGGATCTGCAACCCAGTTCACAAGCACCGTGAGCTCAGAGGACTTACCTCAGAGGGAAAGAAGAACAGAGGTCTCCGCGGAAAGGGTCACAACAACCACAAGAACCGTCCATCTCGCAGGGCTACATGGAAGAAAAACAACTCTCTCAGCCTTCGTCGTTACCGTTGATTGCCTTTTGCTTTTATTATTACTGTTATCATCTTCTAGGTTCCATGTTGTTGCACTTTTATCTCTCTCAGGATGACTTGTTTTTGCAAATTTTGGAGACTATACAATTATGCTTTGAACCTAAATTTTATATTTGCTTTGCTTTTTTGTTGATCTCAGTCTGGTTTTGGAATATATCGAGGCCCCTTTGCAATCCAAATCCCAGTAACAATAAAAAATAGCATTTATTTCTAACTTAAATACAAAACATAAATGTCCAGTTCTAAGAGATTATTAGTAGTTATTTTCTGC
CDS Sequence
Protein Sequence