Information report for AT3G50500
Gene Details
|
|
Functional Descriptions
- PO:0000005 — cultured plant cell — célula cultivada (Spanish, exact), 培養植物細胞 (Japanese, exact), cell suspension (related), cultured cell (broad)
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000003 — whole plant — planta entera (Spanish, exact), 植物体全体 (Japanese, exact), clonal colony (related), colony (related), bush (narrow), frutex (narrow), frutices (narrow), gametophyte (narrow), herb (narrow), liana (narrow), prothalli (narrow), prothallium (narrow), prothallus (narrow), seedling (narrow), shrub (narrow), sporophyte (narrow), suffrutex (narrow), suffrutices (narrow), tree (narrow), vine (narrow), woody clump (narrow), genet (broad), ramet (broad)
- GO:0006970 — acts upstream of or within — response to osmotic stress
- GO:0010029 — acts upstream of or within — regulation of seed germination
- GO:0005515 — enables — protein binding
- GO:0004674 — enables — protein serine/threonine kinase activity
- GO:0005634 — is active in — nucleus
- GO:0009739 — acts upstream of or within — response to gibberellin
- GO:0009737 — acts upstream of or within — response to abscisic acid
- GO:0006468 — involved in — protein phosphorylation
- GO:0009789 — acts upstream of or within — positive regulation of abscisic acid-activated signaling pathway
- GO:0009414 — acts upstream of or within — response to water deprivation
- GO:0005737 — located in — cytoplasm
- GO:0009651 — acts upstream of or within — response to salt stress
- GO:0006468 — has protein modification of type — protein phosphorylation
- GO:0005829 — located in — cytosol
- GO:0004672 — enables — protein kinase activity
- GO:0016301 — enables — kinase activity
- GO:0005634 — located in — nucleus
- GO:0035556 — involved in — intracellular signal transduction
- CS2109749 — no visible phenotype
- CS2109750 — no visible phenotype
- CS2109751 — no visible phenotype
- CS2109752 — no visible phenotype
- CS2109753 — no visible phenotype
- CS2109754 — no visible phenotype
- CS2109755 — no visible phenotype
- CS2109756 — no visible phenotype
- CS2109757 — no visible phenotype
- CS2109758 — no visible phenotype
- CS2109759 — no visible phenotype
- CS2109760 — no visible phenotype
- ear1-1/snrk2.2/snrk2.3 — Less sensitive to ABA during seed germination as compared to wild type.
- snrk2.2 snrk2.3 — snrk2.2 snrk2.3 was found to be ABA-insensitive in seed germination and early seedling growth snrk2.2 snrk2.3 seeds showed green cotyledons at 5 d after sowing (non of the wild-type seeds had germinated at this time) snrk2.2 snrk2.3 had decreased seed dormancy snrk2.2 snrk2.3 was insensitive to the stimulating effect of low ABA concentration (<1 uM)on root growth snrk2.2 snrk2.3 had a greatly reduced level of a 42-kD kinase activity capable of phosphorylating peptides from ABF (for ABA Response Element Binding Factor) transcription factors
Functional Keywords
Literature and News
- Arabidopsis OST1 protein kinase mediates the regulation of stomatal aperture by abscisic acid and acts upstream of reactive oxygen species production. DOI: 10.1105/tpc.007906 ; PMID: 12468729
- The Arabidopsis CDPK-SnRK superfamily of protein kinases. DOI: 10.1104/pp.102.011999 ; PMID: 12805596
- Isolation, sequence analysis, and expression studies of florally expressed cDNAs in Arabidopsis. DOI: 10.1023/B:PLAN.0000019063.18097.62 ; PMID: 15010618
- ABA activates ADPR cyclase and cADPR induces a subset of ABA-responsive genes in Arabidopsis. DOI: 10.1111/j.1365-313X.2004.02055.x ; PMID: 15086800
- Identification of nine sucrose nonfermenting 1-related protein kinases 2 activated by hyperosmotic and saline stresses in Arabidopsis thaliana. DOI: 10.1074/jbc.M405259200 ; PMID: 15292193
- SRK2C, a SNF1-related protein kinase 2, improves drought tolerance by controlling stress-responsive gene expression in Arabidopsis thaliana. DOI: 10.1073/pnas.0407758101 ; PMID: 15561775
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- The gibberellic acid signaling repressor RGL2 inhibits Arabidopsis seed germination by stimulating abscisic acid synthesis and ABI5 activity. DOI: 10.1105/tpc.108.061515 ; PMID: 18941053
- Three Arabidopsis SnRK2 protein kinases, SRK2D/SnRK2.2, SRK2E/SnRK2.6/OST1 and SRK2I/SnRK2.3, involved in ABA signaling are essential for the control of seed development and dormancy. DOI: 10.1093/pcp/pcp083 ; PMID: 19541597
- PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C-interacting proteins in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.04054.x ; PMID: 19874541
- Three SnRK2 protein kinases are the main positive regulators of abscisic acid signaling in response to water stress in Arabidopsis. DOI: 10.1093/pcp/pcp147 ; PMID: 19880399
- In planta changes in protein phosphorylation induced by the plant hormone abscisic acid. DOI: 10.1073/pnas.1007879107 ; PMID: 20733066
- AREB1, AREB2, and ABF3 are master transcription factors that cooperatively regulate ABRE-dependent ABA signaling involved in drought stress tolerance and require ABA for full activation. DOI: 10.1111/j.1365-313X.2009.04092.x ; PMID: 19947981
- Arabidopsis decuple mutant reveals the importance of SnRK2 kinases in osmotic stress responses in vivo. DOI: 10.1073/pnas.1018367108 ; PMID: 21220313
- Autophosphorylation profiling of Arabidopsis protein kinases using the cell-free system. DOI: 10.1016/j.phytochem.2011.02.029 ; PMID: 21477822
- Abscisic acid signal off the STARting block. DOI: 10.1093/mp/ssr055 ; PMID: 21746700
- Over-expression of GsZFP1, an ABA-responsive C2H2-type zinc finger protein lacking a QALGGH motif, reduces ABA sensitivity and decreases stomata size. DOI: 10.1016/j.jplph.2012.03.019 ; PMID: 22705253
- The inhibitory effect of ABA on floral transition is mediated by ABI5 in Arabidopsis. DOI: 10.1093/jxb/ers361 ; PMID: 23307919
- Osmotic stress responses and plant growth controlled by potassium transporters in Arabidopsis. DOI: 10.1105/tpc.112.105700 ; PMID: 23396830
- Direct interactions of ABA-insensitive(ABI)-clade protein phosphatase(PP)2Cs with calcium-dependent protein kinases and ABA response element-binding bZIPs may contribute to turning off ABA response. DOI: 10.1007/s11103-012-9973-3 ; PMID: 23007729
- Four Arabidopsis AREB/ABF transcription factors function predominantly in gene expression downstream of SnRK2 kinases in abscisic acid signalling in response to osmotic stress. DOI: 10.1111/pce.12351 ; PMID: 24738645
- Arabidopsis RAV1 transcription factor, phosphorylated by SnRK2 kinases, regulates the expression of ABI3, ABI4, and ABI5 during seed germination and early seedling development. DOI: 10.1111/tpj.12670 ; PMID: 25231920
- Physiological and transcriptional memory in guard cells during repetitive dehydration stress. DOI: 10.1111/nph.13080 ; PMID: 25345749
- A mechanism of growth inhibition by abscisic acid in germinating seeds of Arabidopsis thaliana based on inhibition of plasma membrane H+-ATPase and decreased cytosolic pH, K+, and anions. DOI: 10.1093/jxb/eru442 ; PMID: 25371509
- Two distinct families of protein kinases are required for plant growth under high external Mg2+ concentrations in Arabidopsis. DOI: 10.1104/pp.114.249870 ; PMID: 25614064
- Sucrose Transporter AtSUC9 Mediated by a Low Sucrose Level is Involved in Arabidopsis Abiotic Stress Resistance by Regulating Sucrose Distribution and ABA Accumulation. DOI: 10.1093/pcp/pcv082 ; PMID: 26063392
- Identification of Open Stomata1-Interacting Proteins Reveals Interactions with Sucrose Non-fermenting1-Related Protein Kinases2 and with Type 2A Protein Phosphatases That Function in Abscisic Acid Responses. DOI: 10.1104/pp.15.00575 ; PMID: 26175513
- A Direct Link between Abscisic Acid Sensing and the Chromatin-Remodeling ATPase BRAHMA via Core ABA Signaling Pathway Components. DOI: 10.1016/j.molp.2015.10.003 ; PMID: 26499068
- An ABA down-regulated bHLH transcription repressor gene, bHLH129 regulates root elongation and ABA response when overexpressed in Arabidopsis. DOI: 10.1038/srep17587 ; PMID: 26625868
- ABA receptor PYL9 promotes drought resistance and leaf senescence. DOI: 10.1073/pnas.1522840113 ; PMID: 26831097
- ABF2, ABF3, and ABF4 Promote ABA-Mediated Chlorophyll Degradation and Leaf Senescence by Transcriptional Activation of Chlorophyll Catabolic Genes and Senescence-Associated Genes in Arabidopsis. DOI: 10.1016/j.molp.2016.06.006 ; PMID: 27373216
- GSK3-like kinases positively modulate abscisic acid signaling through phosphorylating subgroup III SnRK2s in Arabidopsis. DOI: 10.1073/pnas.1316717111 ; PMID: 24928519
- Type One Protein Phosphatase 1 and Its Regulatory Protein Inhibitor 2 Negatively Regulate ABA Signaling. DOI: 10.1371/journal.pgen.1005835 ; PMID: 26943172
- Reconstitution of Abscisic Acid Signaling from the Receptor to DNA via bHLH Transcription Factors. DOI: 10.1104/pp.16.01825 ; PMID: 28438792
- Abscisic acid signaling is involved in regulating the mitogen-activated protein kinase cascade module, AIK1-MKK5-MPK6. DOI: 10.1080/15592324.2017.1321188 ; PMID: 28494202
- Arabidopsis PCaP2 Plays an Important Role in Chilling Tolerance and ABA Response and SnRK2-Mediated Transcriptional Regulatory Network. DOI: 10.3389/fpls.2018.00215 ; PMID: 29568301
- EAR1 Negatively Regulates ABA Signaling by Enhancing 2C Protein Phosphatase Activity. DOI: 10.1105/tpc.17.00875 ; PMID: 29618630
- The Antagonistic Action of Abscisic Acid and Cytokinin Signaling Mediates Drought Stress Response in Arabidopsis. DOI: 10.1016/j.molp.2018.05.001 ; PMID: 29753021
- Arabidopsis PCaP2 Functions as a Linker Between ABA and SA Signals in Plant Water Deficit Tolerance. DOI: 10.3389/fpls.2018.00578 ; PMID: 29868051
- Corrigendum: Arabidopsis PCaP2 Functions as a Linker Between ABA and SA Signals in Plant Water Deficit Tolerance. DOI: 10.3389/fpls.2018.01062 ; PMID: 30083177
- Arabidopsis Raf-Like Kinase Raf10 Is a Regulatory Component of Core ABA Signaling. DOI: 10.14348/molcells.2019.0173 ; PMID: 31480825
- SnRK2 Protein Kinases and mRNA Decapping Machinery Control Root Development and Response to Salt. DOI: 10.1104/pp.19.00818 ; PMID: 31570508
- Two SnRK2-Interacting Calcium Sensor Isoforms Negatively Regulate SnRK2 Activity by Different Mechanisms. DOI: 10.1104/pp.19.00900 ; PMID: 31699848
- Inoculation with abscisic acid (ABA)-catabolizing bacteria can improve phytoextraction of heavy metal in contaminated soil. DOI: 10.1016/j.envpol.2019.113497 ; PMID: 31733960
- Phytochrome-interacting factors regulate seedling growth through ABA signaling. DOI: 10.1016/j.bbrc.2020.04.011 ; PMID: 32307082
- Genetic Interaction Among Phytochrome, Ethylene and Abscisic Acid Signaling During Dark-Induced Senescence in Arabidopsis thaliana. DOI: 10.3389/fpls.2020.00564 ; PMID: 32508856
- Abscisic acid signaling negatively regulates nitrate uptake via phosphorylation of NRT1.1 by SnRK2s in Arabidopsis. DOI: 10.1111/jipb.13057 ; PMID: 33331676
- Abscisic acid regulates secondary cell-wall formation and lignin deposition in Arabidopsis thaliana through phosphorylation of NST1. DOI: 10.1073/pnas.2010911118 ; PMID: 33495344
- ALKBH10B, an mRNA m(6)A Demethylase, Modulates ABA Response During Seed Germination in Arabidopsis. DOI: 10.3389/fpls.2021.712713 ; PMID: 34386031
- ABA represses TOR and root meristem activity through nuclear exit of the SnRK1 kinase. DOI: 10.1073/pnas.2204862119 ; PMID: 35787039
- NUCLEAR PORE ANCHOR and EARLY IN SHORT DAYS 4 negatively regulate abscisic acid signaling by inhibiting Snf1-related protein kinase2 activity and stability in Arabidopsis. DOI: 10.1111/jipb.13349 ; PMID: 35984097
- Disruption of the ABA1 encoding zeaxanthin epoxidase caused defective suberin layers in Arabidopsis seed coats. DOI: 10.3389/fpls.2023.1156356 ; PMID: 37008500
- Tyrosylprotein sulfotransferase suppresses ABA signaling via sulfation of SnRK2.2/2.3/2.6. DOI: 10.1111/jipb.13493 ; PMID: 37052306
- Cell type-specific proteomics uncovers a RAF15-SnRK2.6/OST1 kinase cascade in guard cells. DOI: 10.1111/jipb.13536 ; PMID: 37226855
- The Arabidopsis CDPK-SnRK superfamily of protein kinases. DOI: 10.1104/pp.102.011999 ; PMID: 12805596
- Site-specific phosphorylation profiling of Arabidopsis proteins by mass spectrometry and peptide chip analysis. DOI: 10.1021/pr8000173 ; PMID: 18433157
- MASCP Gator: an aggregation portal for the visualization of Arabidopsis proteomics data. DOI: 10.1104/pp.110.168195 ; PMID: 21075962
Gene Resources
- UniProt: A0A178VHA9
- EMBL: CACRSJ010000106, CACSHJ010000089, LUHQ01000003
- AlphaFoldDB: A0A178VHA9
- EnsemblPlants: AT3G50500.1
- Gramene: AT3G50500.1
- KEGG: ath:AT3G50500
- ExpressionAtlas: AT3G50500
- InterPro: IPR000719, IPR008271, IPR011009
- PANTHER: PTHR24343, PTHR24343:SF485
- SUPFAM: SSF56112
- PROSITE: PS00107, PS00108, PS50011
- Gene3D: 1.10.510.10, 3.30.200.20
- OrthoDB: A0A178VHA9
- SWISS-MODEL: A0A178VHA9
- Conserved Domain Database: cd14665
Homologs
- Brassica napus GSBRNA2T00021453001, GSBRNA2T00113458001
- Brassica rapa Brara.C04319
Sequences
cDNA Sequence
- >AT3G50500.1
CGGCCTTTGTCGTATCAAATCAGATAACTAAAACAAAGAAAACGGTGTCGTTGCAAACATCTCTCTCCTCTTATCTAACTTAGAGAGCGACCAATAATTGCCTTTGTCTTTCTCATTCGTCGTTGATCCATCTTTTTCCCCCAAATTCATATCCTTCCTTAGATATTTTTCTCCTTCTTCTTCTTCTAGATTCCAGCTACTCCAGAAGATTCTTCGACTTAATCTGATGTGATTAGGAAGAGCAATAGAGGAAGAGAAGAATCAGAAAAAATGGATCCGGCGACTAATTCACCGATTATGCCGATTGATTTACCGATTATGCACGACAGTGATCGTTACGACTTCGTTAAAGATATTGGCTCTGGTAATTTCGGCGTTGCTCGTCTCATGACCGATAGAGTCACCAAGGAGCTTGTTGCTGTTAAATACATCGAGAGAGGAGAAAAGATTGATGAAAATGTTCAGAGGGAGATTATCAATCATAGATCATTGAGACATCCTAATATTGTTAGGTTTAAAGAGGTGATTTTGACGCCTTCCCATTTGGCTATTGTTATGGAATATGCTGCTGGTGGAGAACTTTATGAGCGGATTTGTAATGCCGGACGGTTTAGTGAAGATGAGGCTCGGTTCTTCTTTCAGCAGCTTATATCTGGAGTTAGCTATTGTCATGCAATGCAAATATGCCATCGGGATCTGAAGCTGGAAAATACATTGTTAGATGGAAGTCCGGCACCTCGTTTGAAAATATGTGATTTTGGTTATTCCAAGTCTTCTGTTCTTCATTCCCAACCAAAGTCAACTGTTGGTACTCCTGCATACATTGCACCAGAGATTCTTCTTCGACAGGAATATGATGGCAAGCTTGCAGATGTATGGTCTTGCGGTGTAACATTATATGTAATGTTGGTTGGAGCTTATCCATTCGAGGATCCACAGGAGCCACGAGATTATCGAAAGACAATACAAAGAATCCTTAGTGTCACATACTCGATCCCAGAGGACTTACACCTCTCACCAGAATGTCGCCATCTAATATCGAGGATCTTCGTGGCTGATCCGGCAACAAGAATCACTATTCCGGAGATCACATCCGATAAATGGTTCTTGAAGAATCTACCAGGTGATTTGATGGATGAGAACCGAATGGGAAGTCAGTTTCAAGAGCCTGAGCAGCCAATGCAGAGCCTTGACACGATTATGCAGATAATATCGGAGGCTACGATTCCGACTGTTCGTAATCGTTGCCTCGATGATTTCATGGCGGATAATCTTGATCTAGACGATGACATGGATGACTTTGATTCCGAATCTGAGATTGATGTTGACAGTAGTGGAGAGATAGTTTATGCTCTCTGAGATTCCTGAGGACAAAGTCTGTTTTGTCCGTACTGTTGAGACACACCACTGGAGTTTTGTCTTAGCTCCACGCACTCCATCGTTCATTTTTGGATCGTTTGTTGTTTTTTACTCTACAAGCTTTGGATTCACATACATATATATGTATTGTAATGTAATATGTAATATATTCTATGTATTTCTCTTTGTTTAATAACTATTGGCACATTTTATACAAATGATATGGTACTAGAAAAAGAAATGTAACTAACCCACAAGGTTCTGAGATGGAGCTTAGCTTGAGTCTTGGTTAAGAATGTTATGATCTATGTTTCACACGACACACGATTTCATGTATAGTGTTATTCGACATCGTGATGGA - >AT3G50500.2
CGGCCTTTGTCGTATCAAATCAGATAACTAAAACAAAGAAAACGGTGTCGTTGCAAACATCTCTCTCCTCTTATCTAACTTAGAGAGCGACCAATAATTGCCTTTGTCTTTCTCATTCGTCGTTGATCCATCTTTTTCCCCCAAATTCATATCCTTCCTTAGATATTTTTCTCCTTCTTCTTCTTCTAGATTCCAGCTACTCCAGAAGATTCTTCGACTTAATCTGATGTGATTAGGAAGAGCAATAGAGGAAGAGAAGAATCAGAAAAAATGGATCCGGCGACTAATTCACCGATTATGCCGATTGATTTACCGATTATGCACGACAGTGATCGTTACGACTTCGTTAAAGATATTGGCTCTGGTAATTTCGGCGTTGCTCGTCTCATGACCGATAGAGTCACCAAGGAGCTTGTTGCTGTTAAATACATCGAGAGAGGAGAAAAGATTGATGAAAATGTTCAGAGGGAGATTATCAATCATAGATCATTGAGACATCCTAATATTGTTAGGTTTAAAGAGGTGATTTTGACGCCTTCCCATTTGGCTATTGTTATGGAATATGCTGCTGGTGGAGAACTTTATGAGCGGATTTGTAATGCCGGACGGTTTAGTGAAGATGAGGCTCGGTTCTTCTTTCAGCAGCTTATATCTGGAGTTAGCTATTGTCATGCAATGCAAATATGCCATCGGGATCTGAAGCTGGAAAATACATTGTTAGATGGAAGTCCGGCACCTCGTTTGAAAATATGTGATTTTGGTTATTCCAAGTCTTCTGTTCTTCATTCCCAACCAAAGTCAACTGTTGGTACTCCTGCATACATTGCACCAGAGATTCTTCTTCGACAGGAATATGATGGCAAGCTTGCAGATGTATGGTCTTGCGGTGTAACATTATATGTAATGTTGGTTGGAGCTTATCCATTCGAGGATCCACAGGAGCCACGAGATTATCGAAAGACAATACAAAGAATCCTTAGTGTCACATACTCGATCCCAGAGGACTTACACCTCTCACCAGAATGTCGCCATCTAATATCGAGGATCTTCGTGGCTGATCCGGCAACAAGAATCACTATTCCGGAGATCACATCCGATAAATGGTTCTTGAAGAATCTACCAGGTGATTTGATGGATGAGAACCGAATGGGAAGTCAGTTTCAAGAGCCTGAGCAGCCAATGCAGAGCCTTGACACGATTATGCAGATAATATCGGAGGCTACGATTCCGACTGTTCGTAATCGTTGCCTCGATGATTTCATGGCGGATAATCTTGATCTAGACGATGACATGGATGACTTTGATTCCGAATCTGAGATTGATGTTGACAGTAGTGGAGAGATAGTTTATGCTCTCTGAGATTCCTGAGGACAAAGTCTGTTTTGTCCGTACTGTTGAGACACACCACTGGAGTTTTGTCTTAGCTCCACGCACTCCATCGTTCATTTTTGGATCGTTTGTTGTTTTTTACTCTACAAGCTTTGGATTCACATACATATATATGTATTGTAATGTAATATGTAATATATTCTATGTATTTCTCTTTGTTTAATAACTATTGGCACATTTTATACAAATGATATGGTACTAGAAAAAGAAATGTAACTAACCCACAAGGTTCTGAGATGGAGCTTAGCTTGAGTCTTGGTTAAGAATGTTATGATCTATGTTTCACACGACACACGATTTCATGTATAGTGTTATTCGACATCGTGATGGA
CDS Sequence
- >AT3G50500.1
ATGGATCCGGCGACTAATTCACCGATTATGCCGATTGATTTACCGATTATGCACGACAGTGATCGTTACGACTTCGTTAAAGATATTGGCTCTGGTAATTTCGGCGTTGCTCGTCTCATGACCGATAGAGTCACCAAGGAGCTTGTTGCTGTTAAATACATCGAGAGAGGAGAAAAGATTGATGAAAATGTTCAGAGGGAGATTATCAATCATAGATCATTGAGACATCCTAATATTGTTAGGTTTAAAGAGGTGATTTTGACGCCTTCCCATTTGGCTATTGTTATGGAATATGCTGCTGGTGGAGAACTTTATGAGCGGATTTGTAATGCCGGACGGTTTAGTGAAGATGAGGCTCGGTTCTTCTTTCAGCAGCTTATATCTGGAGTTAGCTATTGTCATGCAATGCAAATATGCCATCGGGATCTGAAGCTGGAAAATACATTGTTAGATGGAAGTCCGGCACCTCGTTTGAAAATATGTGATTTTGGTTATTCCAAGTCTTCTGTTCTTCATTCCCAACCAAAGTCAACTGTTGGTACTCCTGCATACATTGCACCAGAGATTCTTCTTCGACAGGAATATGATGGCAAGCTTGCAGATGTATGGTCTTGCGGTGTAACATTATATGTAATGTTGGTTGGAGCTTATCCATTCGAGGATCCACAGGAGCCACGAGATTATCGAAAGACAATACAAAGAATCCTTAGTGTCACATACTCGATCCCAGAGGACTTACACCTCTCACCAGAATGTCGCCATCTAATATCGAGGATCTTCGTGGCTGATCCGGCAACAAGAATCACTATTCCGGAGATCACATCCGATAAATGGTTCTTGAAGAATCTACCAGGTGATTTGATGGATGAGAACCGAATGGGAAGTCAGTTTCAAGAGCCTGAGCAGCCAATGCAGAGCCTTGACACGATTATGCAGATAATATCGGAGGCTACGATTCCGACTGTTCGTAATCGTTGCCTCGATGATTTCATGGCGGATAATCTTGATCTAGACGATGACATGGATGACTTTGATTCCGAATCTGAGATTGATGTTGACAGTAGTGGAGAGATAGTTTATGCTCTCTGA - >AT3G50500.2
ATGGATCCGGCGACTAATTCACCGATTATGCCGATTGATTTACCGATTATGCACGACAGTGATCGTTACGACTTCGTTAAAGATATTGGCTCTGGTAATTTCGGCGTTGCTCGTCTCATGACCGATAGAGTCACCAAGGAGCTTGTTGCTGTTAAATACATCGAGAGAGGAGAAAAGATTGATGAAAATGTTCAGAGGGAGATTATCAATCATAGATCATTGAGACATCCTAATATTGTTAGGTTTAAAGAGGTGATTTTGACGCCTTCCCATTTGGCTATTGTTATGGAATATGCTGCTGGTGGAGAACTTTATGAGCGGATTTGTAATGCCGGACGGTTTAGTGAAGATGAGGCTCGGTTCTTCTTTCAGCAGCTTATATCTGGAGTTAGCTATTGTCATGCAATGCAAATATGCCATCGGGATCTGAAGCTGGAAAATACATTGTTAGATGGAAGTCCGGCACCTCGTTTGAAAATATGTGATTTTGGTTATTCCAAGTCTTCTGTTCTTCATTCCCAACCAAAGTCAACTGTTGGTACTCCTGCATACATTGCACCAGAGATTCTTCTTCGACAGGAATATGATGGCAAGCTTGCAGATGTATGGTCTTGCGGTGTAACATTATATGTAATGTTGGTTGGAGCTTATCCATTCGAGGATCCACAGGAGCCACGAGATTATCGAAAGACAATACAAAGAATCCTTAGTGTCACATACTCGATCCCAGAGGACTTACACCTCTCACCAGAATGTCGCCATCTAATATCGAGGATCTTCGTGGCTGATCCGGCAACAAGAATCACTATTCCGGAGATCACATCCGATAAATGGTTCTTGAAGAATCTACCAGGTGATTTGATGGATGAGAACCGAATGGGAAGTCAGTTTCAAGAGCCTGAGCAGCCAATGCAGAGCCTTGACACGATTATGCAGATAATATCGGAGGCTACGATTCCGACTGTTCGTAATCGTTGCCTCGATGATTTCATGGCGGATAATCTTGATCTAGACGATGACATGGATGACTTTGATTCCGAATCTGAGATTGATGTTGACAGTAGTGGAGAGATAGTTTATGCTCTCTGA
Protein Sequence
- >AT3G50500.1
MDPATNSPIMPIDLPIMHDSDRYDFVKDIGSGNFGVARLMTDRVTKELVAVKYIERGEKIDENVQREIINHRSLRHPNIVRFKEVILTPSHLAIVMEYAAGGELYERICNAGRFSEDEARFFFQQLISGVSYCHAMQICHRDLKLENTLLDGSPAPRLKICDFGYSKSSVLHSQPKSTVGTPAYIAPEILLRQEYDGKLADVWSCGVTLYVMLVGAYPFEDPQEPRDYRKTIQRILSVTYSIPEDLHLSPECRHLISRIFVADPATRITIPEITSDKWFLKNLPGDLMDENRMGSQFQEPEQPMQSLDTIMQIISEATIPTVRNRCLDDFMADNLDLDDDMDDFDSESEIDVDSSGEIVYAL - >AT3G50500.2
MDPATNSPIMPIDLPIMHDSDRYDFVKDIGSGNFGVARLMTDRVTKELVAVKYIERGEKIDENVQREIINHRSLRHPNIVRFKEVILTPSHLAIVMEYAAGGELYERICNAGRFSEDEARFFFQQLISGVSYCHAMQICHRDLKLENTLLDGSPAPRLKICDFGYSKSSVLHSQPKSTVGTPAYIAPEILLRQEYDGKLADVWSCGVTLYVMLVGAYPFEDPQEPRDYRKTIQRILSVTYSIPEDLHLSPECRHLISRIFVADPATRITIPEITSDKWFLKNLPGDLMDENRMGSQFQEPEQPMQSLDTIMQIISEATIPTVRNRCLDDFMADNLDLDDDMDDFDSESEIDVDSSGEIVYAL