AT3G45760

Gene Details:

Gene ID: AT3G45760
Gene Symbol: NTP5
Gene Name:
Description: Nucleotidyltransferase family protein;(source:Araport11)
TAIR Accession: locus:2102714
Genome: Araport11_genome_release
Species: Arabidopsis thaliana

Transcripts:

AT3G45760.1 AT3G45760.2

Gene Ontology:

GO:0005737 — located in — cytoplasm
GO:0071051 — involved in — RNA 3-end processing GO:0031123 19783 P other metabolic processes IBA none PANTHER:PTN000263330|UniProtKB:Q5TAX3|UniProtKB:Q9NVV4|MGI:MGI:2387179|UniProtKB:Q5VYS8|UniProtKB:Q9H6E5|TAIR:locus:2063937|UniProtKB:Q57UM5|FB:FBgn0037470|PomBase:SPAC19D5.03|WB:WBGene00014124|MGI:MGI:2445126|FB:FBgn0260780|TAIR:locus:2043669|WB:WBGene00019629|UniProtKB:F1QDP4 Communication:501741973 2023-06-07 AT3G45760 locus:2102714 AT3G45760 enables nucleotidyltransferase activity GO:0016779 3397 F transferase activity IBA none PANTHER:PTN000263330|TAIR:locus:2043669|MGI:MGI:2445126|FB:FBgn0038934|PomBase:SPAC821.04c|UniProtKB:F1QDP4|FB:FBgn0037470|UniProtKB:Q6PIY7|UniProtKB:Q5VYS8|FB:FBgn0024360|MGI:MGI:2387179|FB:FBgn0260780|WB:WBGene00019629|UniProtKB:Q57UM5|TAIR:locus:2063937|WB:WBGene00014124|PomBase:SPAC19D5.03|PomBase:SPAC17H9.01|WB:WBGene00001596|UniProtKB:Q9H6E5|WB:WBGene00019628|UniProtKB:Q9NVV4|UniProtKB:Q5TAX3 Communication:501741973 2023-06-07 AT3G45770 locus:2102664 AT3G45770 involved in fatty acid biosynthetic process GO:0006633 5751 P other cellular processes IGI Functional complementation in heterologous system SGD:S000000230 Publication:501789055|PMID:32245791 TAIR 2021-08-06 AT3G45770 locus:2102664 AT3G45770 involved in fatty acid metabolic process GO:0006631 5754 P lipid metabolic process IBA none PANTHER:PTN000190628|UniProtKB:Q7YS70|TAIR:locus:2102664|SGD:S000000230|UniProtKB:Q9BV79 Communication:501741973 2023-06-07 AT3G45770 locus:2102664 AT3G45770 involved in fatty acid biosynthetic process GO:0006633 5751 P other metabolic processes IGI Functional complementation in heterologous system SGD:S000000230 Publication:501789055|PMID:32245791 TAIR 2021-08-06 AT3G45770 gene:3698249 AT3G45770.1 located in chloroplast GO:0009507 175 C chloroplast HDA none NONE Publication:501724486|PMID:18431481 kvanwijk 2021-04-07 AT3G45770 gene:3698249 AT3G45770.1 located in mitochondrion GO:0005739 486 C mitochondrion HDA none NONE Publication:501720283|PMID:17137349 kvanwijk 2021-05-12 AT3G45770 locus:2102664 AT3G45770 located in mitochondrion GO:0005739 486 C mitochondrion HDA none NONE Publication:501711651|PMID:14671022 hmillar 2021-04-15 AT3G45770 locus:2102664 AT3G45770 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501776792|PMID:28887381 dszymanski 2019-04-04 AT3G45770 locus:2102664 AT3G45770 enables trans-2-enoyl-CoA reductase (NADPH) activity GO:0019166 8434 F catalytic activity IBA none PANTHER:PTN000190628|UniProtKB:Q7YS70|UniProtKB:Q9BV79 Communication:501741973 2023-06-07 AT3G45770 locus:2102664 AT3G45770 enables copper ion binding GO:0005507 1990 F other binding HDA none NONE Publication:501735675|PMID:20018591 TAIR 2021-05-10 AT3G45770 gene:3698249 AT3G45770.1 located in nucleus GO:0005634 537 C nucleus HDA none NONE Publication:501711432|PMID:14617066 kvanwijk 2021-04-22 AT3G45770 gene:3698249 AT3G45770.1 enables ATP binding GO:0005524 894 F nucleotide binding HDA none NONE Publication:501720283|PMID:17137349 kvanwijk 2021-05-12 AT3G45770 locus:2102664 AT3G45770 involved in fatty acid metabolic process GO:0006631 5754 P other metabolic processes IBA none PANTHER:PTN000190628|UniProtKB:Q7YS70|TAIR:locus:2102664|SGD:S000000230|UniProtKB:Q9BV79 Communication:501741973 2023-06-07 AT3G45770 locus:2102664 AT3G45770 involved in fatty acid biosynthetic process GO:0006633 5751 P biosynthetic process IGI Functional complementation in heterologous system SGD:S000000230 Publication:501789055|PMID:32245791 TAIR 2021-08-06 AT3G45770 gene:1006228440 AT3G45770.2 enables ATP binding GO:0005524 894 F nucleotide binding HDA none NONE Publication:501720283|PMID:17137349 kvanwijk 2021-05-12 AT3G45770 gene:1006228440 AT3G45770.2 located in mitochondrion GO:0005739 486 C mitochondrion ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45770 gene:1006228440 AT3G45770.2 located in mitochondrion GO:0005739 486 C mitochondrion HDA none NONE Publication:501720283|PMID:17137349 kvanwijk 2021-05-12 AT3G45770 gene:1006228440 AT3G45770.2 located in chloroplast GO:0009507 175 C chloroplast HDA none NONE Publication:501724486|PMID:18431481 kvanwijk 2021-04-07 AT3G45770 gene:3698249 AT3G45770.1 located in chloroplast GO:0009507 175 C chloroplast ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45770 locus:2102664 AT3G45770 involved in fatty acid biosynthetic process GO:0006633 5751 P lipid metabolic process IGI Functional complementation in heterologous system SGD:S000000230 Publication:501789055|PMID:32245791 TAIR 2021-08-06 AT3G45770 locus:2102664 AT3G45770 enables enoyl-[acyl-carrier-protein] reductase activity GO:0016631 2257 F catalytic activity IGI Functional complementation in heterologous system SGD:S000000230 Publication:501789055|PMID:32245791 TAIR 2021-08-06 AT3G45770 locus:2102664 AT3G45770 enables oxidoreductase activity GO:0016491 3460 F catalytic activity IEA none InterPro:IPR020843 AnalysisReference:501756966 2023-06-11 AT3G45770 locus:2102664 AT3G45770 involved in fatty acid metabolic process GO:0006631 5754 P other cellular processes IBA none PANTHER:PTN000190628|UniProtKB:Q7YS70|TAIR:locus:2102664|SGD:S000000230|UniProtKB:Q9BV79 Communication:501741973 2023-06-07 AT3G45770 locus:2102664 AT3G45770 is active in mitochondrion GO:0005739 486 C mitochondrion IBA none PANTHER:PTN000190628|UniProtKB:Q9BV79|RGD:3208|SGD:S000000230|UniProtKB:Q57TX8 Communication:501741973 2023-06-07 AT3G45770 gene:3698249 AT3G45770.1 enables ATP binding GO:0005524 894 F other binding HDA none NONE Publication:501720283|PMID:17137349 kvanwijk 2021-05-12 AT3G45770 gene:1006228440 AT3G45770.2 enables ATP binding GO:0005524 894 F other binding HDA none NONE Publication:501720283|PMID:17137349 kvanwijk 2021-05-12 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within blue light signaling pathway GO:0009785 11759 P response to light stimulus IDA none Publication:1999|PMID:9831559 2021-04-01 AT3G45780 locus:2102674 AT3G45780 is active in plasma membrane GO:0005886 570 C plasma membrane IBA none PANTHER:PTN000682243|TAIR:locus:2008331|TAIR:locus:2178388|SGD:S000005330|TAIR:locus:2102674|TAIR:locus:2091443 Communication:501741973 2023-06-07 AT3G45780 locus:2102674 AT3G45780 enables FMN binding GO:0010181 17729 F other binding TAS original experiments are traceable through an article NONE Publication:501717658|PMID:16150710 TAIR 2006-10-04 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within protein autophosphorylation GO:0046777 13750 P other metabolic processes TAS original experiments are traceable through an article NONE Publication:501682623|PMID:12383086 TAIR 2005-11-01 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within blue light signaling pathway GO:0009785 11759 P response to abiotic stimulus IDA none Publication:1999|PMID:9831559 2021-04-01 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within regulation of stomatal movement GO:0010119 13863 P other cellular processes IMP analysis of physiological response NONE Publication:1546234|PMID:11740564 TAIR 2003-08-05 AT3G45780 locus:2102674 AT3G45780 is active in cytoplasm GO:0005737 231 C cytoplasm IBA none PANTHER:PTN000682243|TAIR:locus:2102674|TAIR:locus:2155821|TAIR:locus:2085191|SGD:S000005330|TAIR:locus:2008331 Communication:501741973 2023-06-07 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within regulation of proton transport GO:0010155 17246 P other cellular processes IGI double mutant analysis AGI_LocusCode:AT5G58140 Publication:501716548|PMID:15821287 TAIR 2008-05-24 AT3G45780 locus:2102674 AT3G45780 involved in blue light signaling pathway GO:0009785 11759 P signal transduction IMP biochemical/chemical analysis Publication:501720921|PMID:17319842 TAIR 2023-02-21 AT3G45780 gene:3698263 AT3G45780.1 located in plant-type vacuole GO:0000325 11545 C vacuole HDA none NONE Publication:501714874|PMID:15539469 kvanwijk 2021-05-12 AT3G45780 locus:2102674 AT3G45780 enables kinase activity GO:0016301 2953 F kinase activity ISS Recognized domains Publication:501710530|PMID:13678909 TAIR 2004-02-26 AT3G45780 locus:2102674 AT3G45780 located in cytoplasm GO:0005737 231 C cytoplasm IDA localization of GFP/YFP fusion protein Publication:501681826|PMID:12172018 TAIR 2003-08-05 AT3G45780 gene:1009021722 AT3G45780.2 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within circadian rhythm GO:0007623 5410 P circadian rhythm IMP analysis of physiological response NONE Publication:501765448|PMID:26215041 phototropin 2015-09-02 AT3G45780 locus:2102674 AT3G45780 enables FMN binding GO:0010181 17729 F nucleotide binding TAS original experiments are traceable through an article NONE Publication:501717658|PMID:16150710 TAIR 2006-10-04 AT3G45780 locus:2102674 AT3G45780 enables protein kinase activity GO:0004672 3889 F transferase activity IDA Enzyme assays Publication:501750464|PMID:22781128 TAIR 2012-08-06 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within regulation of proton transport GO:0010155 17246 P transport IGI double mutant analysis AGI_LocusCode:AT5G58140 Publication:501716548|PMID:15821287 TAIR 2008-05-24 AT3G45780 locus:2102674 AT3G45780 enables protein binding GO:0005515 3877 F protein binding IPI none UniProtKB:Q9FMF5 Publication:501719400|PMID:16777956 2023-05-23 AT3G45780 locus:2102674 AT3G45780 located in cytoplasmic side of plasma membrane GO:0009898 12030 C other membranes IDA localization of GFP/YFP fusion protein Publication:501681826|PMID:12172018 TAIR 2003-08-05 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within protein autophosphorylation GO:0046777 13750 P other cellular processes TAS original experiments are traceable through an article NONE Publication:501682623|PMID:12383086 TAIR 2005-11-01 AT3G45780 locus:2102674 AT3G45780 enables blue light photoreceptor activity GO:0009882 9792 F signaling receptor activity IDA Enzyme assays Publication:1999|PMID:9831559 TAIR 2003-03-29 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within blue light signaling pathway GO:0009785 11759 P signal transduction IDA none Publication:1999|PMID:9831559 2021-04-01 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within phototropism GO:0009638 6762 P response to light stimulus IMP Functional complementation NONE Publication:2818|PMID:9405347 TAIR 2006-10-02 AT3G45780 locus:2102674 AT3G45780 enables protein kinase activity GO:0004672 3889 F kinase activity IDA Enzyme assays Publication:501750464|PMID:22781128 TAIR 2012-08-06 AT3G45780 locus:2102674 AT3G45780 enables FMN binding GO:0010181 17729 F nucleotide binding IDA none Publication:501725066|PMID:18585389 2021-04-01 AT3G45780 locus:2102674 AT3G45780 involved in blue light signaling pathway GO:0009785 11759 P other cellular processes IMP biochemical/chemical analysis Publication:501720921|PMID:17319842 TAIR 2023-02-21 AT3G45780 locus:2102674 AT3G45780 located in cell surface GO:0009986 14229 C other cellular components IDA none Publication:501735847|PMID:20031918 TAIR 2011-10-07 AT3G45780 gene:1009021722 AT3G45780.2 located in plant-type vacuole GO:0000325 11545 C vacuole HDA none NONE Publication:501714874|PMID:15539469 kvanwijk 2021-05-12 AT3G45780 locus:2102674 AT3G45780 enables protein serine/threonine kinase activity GO:0004674 3907 F kinase activity IBA none PANTHER:PTN000682243|SGD:S000005330|TAIR:locus:2102674|UniProtKB:Q8LPD9|TAIR:locus:2062268|TAIR:locus:2032785|TAIR:locus:2155821 Communication:501741973 2023-06-07 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within chloroplast accumulation movement GO:0009904 11939 P cellular component organization IMP analysis of physiological response NONE Publication:501680704|PMID:11371609 TAIR 2003-08-05 AT3G45780 locus:2102674 AT3G45780 enables protein serine/threonine kinase activity GO:0004674 3907 F transferase activity IBA none PANTHER:PTN000682243|SGD:S000005330|TAIR:locus:2102674|UniProtKB:Q8LPD9|TAIR:locus:2062268|TAIR:locus:2032785|TAIR:locus:2155821 Communication:501741973 2023-06-07 AT3G45780 locus:2102674 AT3G45780 enables protein binding GO:0005515 3877 F protein binding IPI none UniProtKB:Q9SWI1 Publication:501719400|PMID:16777956 2023-05-23 AT3G45780 locus:2102674 AT3G45780 enables identical protein binding GO:0042802 15210 F protein binding IPI none UniProtKB:O48963 Publication:501725066|PMID:18585389 2021-04-01 AT3G45780 locus:2102674 AT3G45780 enables identical protein binding GO:0042802 15210 F protein binding IPI none UniProtKB:O48963 Publication:501745443|PMID:22001205 2023-05-23 AT3G45780 locus:2102674 AT3G45780 is active in nucleus GO:0005634 537 C nucleus IBA none PANTHER:PTN000682243|TAIR:locus:2085191|TAIR:locus:2008331 Communication:501741973 2023-04-13 AT3G45780 locus:2102674 AT3G45780 enables protein serine/threonine kinase activity GO:0004674 3907 F catalytic activity IDA Enzyme assays Publication:1999|PMID:9831559 TAIR 2003-03-29 AT3G45780 locus:2102674 AT3G45780 enables protein binding GO:0005515 3877 F protein binding IPI fusion protein pull-down assay AGI_LocusCode:AT2G02950 Publication:501719400|PMID:16777956 TAIR 2008-08-22 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within protein autophosphorylation GO:0046777 13750 P other metabolic processes IDA immunoprecipitation NONE Publication:501724637|PMID:18378899 TAIR 2008-05-24 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within chloroplast avoidance movement GO:0009903 11940 P other cellular processes IMP analysis of physiological response NONE Publication:501680704|PMID:11371609 TAIR 2003-08-05 AT3G45780 locus:2102674 AT3G45780 enables protein serine/threonine kinase activity GO:0004674 3907 F catalytic activity IBA none PANTHER:PTN000682243|SGD:S000005330|TAIR:locus:2102674|UniProtKB:Q8LPD9|TAIR:locus:2062268|TAIR:locus:2032785|TAIR:locus:2155821 Communication:501741973 2023-06-07 AT3G45780 locus:2102674 AT3G45780 enables protein binding GO:0005515 3877 F protein binding IPI none UniProtKB:Q9FMF5 Publication:1052|PMID:10542152 2023-05-23 AT3G45780 locus:2102674 AT3G45780 enables protein kinase activity GO:0004672 3889 F catalytic activity IDA Enzyme assays Publication:501750464|PMID:22781128 TAIR 2012-08-06 AT3G45780 gene:3698263 AT3G45780.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45780 locus:2102674 AT3G45780 enables protein serine/threonine kinase activity GO:0004674 3907 F transferase activity IDA Enzyme assays Publication:1999|PMID:9831559 TAIR 2003-03-29 AT3G45780 locus:2102674 AT3G45780 involved in blue light signaling pathway GO:0009785 11759 P response to light stimulus IMP biochemical/chemical analysis Publication:501720921|PMID:17319842 TAIR 2023-02-21 AT3G45780 locus:2102674 AT3G45780 enables identical protein binding GO:0042802 15210 F protein binding IPI none UniProtKB:O48963 Publication:501732937|PMID:19166850 2023-05-23 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within chloroplast avoidance movement GO:0009903 11940 P cellular component organization IMP analysis of physiological response NONE Publication:501680704|PMID:11371609 TAIR 2003-08-05 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within phototropism GO:0009638 6762 P tropism IMP Functional complementation NONE Publication:2818|PMID:9405347 TAIR 2006-10-02 AT3G45780 locus:2102674 AT3G45780 involved in protein phosphorylation GO:0006468 6897 P other cellular processes IBA none PANTHER:PTN000682243|TAIR:locus:2178388|TAIR:locus:2008331|TAIR:locus:2090310|TAIR:locus:2102674|UniProtKB:Q8LPD9 Communication:501741973 2023-06-07 AT3G45780 locus:2102674 AT3G45780 enables mRNA binding GO:0003729 3091 F RNA binding HDA none NONE Publication:501771908|PMID:27729395 tmillar 2021-04-22 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within protein autophosphorylation GO:0046777 13750 P other cellular processes IDA immunoprecipitation NONE Publication:501724637|PMID:18378899 TAIR 2008-05-24 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within chloroplast accumulation movement GO:0009904 11939 P other cellular processes IMP analysis of physiological response NONE Publication:501680704|PMID:11371609 TAIR 2003-08-05 AT3G45780 locus:2102674 AT3G45780 located in cytoplasm GO:0005737 231 C cytoplasm IDA none Publication:501735847|PMID:20031918 TAIR 2011-10-07 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within blue light signaling pathway GO:0009785 11759 P other cellular processes IDA none Publication:1999|PMID:9831559 2021-04-01 AT3G45780 locus:2102674 AT3G45780 involved in blue light signaling pathway GO:0009785 11759 P response to abiotic stimulus IMP biochemical/chemical analysis Publication:501720921|PMID:17319842 TAIR 2023-02-21 AT3G45780 locus:2102674 AT3G45780 acts upstream of or within response to blue light GO:0009637 5255 P response to light stimulus IGI double mutant analysis AGI_LocusCode:AT5G58140 Publication:501714985|PMID:15749755 TAIR 2011-03-25 AT3G45780 locus:2102674 AT3G45780 involved in protein phosphorylation GO:0006468 6897 P other metabolic processes IBA none PANTHER:PTN000682243|TAIR:locus:2178388|TAIR:locus:2008331|TAIR:locus:2090310|TAIR:locus:2102674|UniProtKB:Q8LPD9 Communication:501741973 2023-06-07 AT3G45780 locus:2102674 AT3G45780 enables FMN binding GO:0010181 17729 F other binding IDA none Publication:501725066|PMID:18585389 2021-04-01 AT3G45780 locus:2102674 AT3G45780 located in cytoplasmic side of plasma membrane GO:0009898 12030 C plasma membrane IDA localization of GFP/YFP fusion protein Publication:501681826|PMID:12172018 TAIR 2003-08-05 AT3G45780 locus:2102674 AT3G45780 enables protein serine/threonine kinase activity GO:0004674 3907 F kinase activity IDA Enzyme assays Publication:1999|PMID:9831559 TAIR 2003-03-29 AT3G45780 locus:2102674 AT3G45780 enables protein binding GO:0005515 3877 F protein binding IPI none UniProtKB:P48349 Publication:501733339|PMID:19524572 2023-05-23 AT3G45790 locus:2102684 AT3G45790 enables protein kinase activity GO:0004672 3889 F catalytic activity IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2116417|TAIR:locus:2074835|TAIR:locus:2007337 Communication:501741973 2023-06-07 AT3G45790 locus:2102684 AT3G45790 enables protein kinase activity GO:0004672 3889 F kinase activity IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2116417|TAIR:locus:2074835|TAIR:locus:2007337 Communication:501741973 2023-06-07 AT3G45790 locus:2102684 AT3G45790 involved in protein phosphorylation GO:0006468 6897 P other metabolic processes IBA none PANTHER:PTN001969686|TAIR:locus:2007337|TAIR:locus:2205523|TAIR:locus:2074835|TAIR:locus:2116417 Communication:501741973 2023-06-07 AT3G45790 locus:2102684 AT3G45790 enables protein kinase activity GO:0004672 3889 F transferase activity IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2116417|TAIR:locus:2074835|TAIR:locus:2007337 Communication:501741973 2023-06-07 AT3G45790 locus:2102684 AT3G45790 involved in signal transduction GO:0007165 7243 P signal transduction IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2074835|TAIR:locus:2060246 Communication:501741973 2023-04-13 AT3G45790 locus:2102684 AT3G45790 involved in protein phosphorylation GO:0006468 6897 P other cellular processes IBA none PANTHER:PTN001969686|TAIR:locus:2007337|TAIR:locus:2205523|TAIR:locus:2074835|TAIR:locus:2116417 Communication:501741973 2023-06-07 AT3G45790 locus:2102684 AT3G45790 acts upstream of or within phosphorylation GO:0016310 6748 P other cellular processes ISS none Pfam:PF00069 Communication:501714663 2021-04-01 AT3G45790 gene:3698245 AT3G45790.1 located in cytoplasm GO:0005737 231 C cytoplasm ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45790 locus:2102684 AT3G45790 acts upstream of or within phosphorylation GO:0016310 6748 P other metabolic processes ISS none Pfam:PF00069 Communication:501714663 2021-04-01 AT3G45800 locus:2077187 AT3G45800 is active in cellular_component GO:0005575 163 C unknown cellular components ND none NONE Communication:1345790 TIGR 2022-02-01 AT3G45800 locus:2077187 AT3G45800 enables molecular_function GO:0003674 3226 F unknown molecular functions ND none NONE Communication:1345790 TIGR 2003-09-13 AT3G45800 locus:2077187 AT3G45800 involved in biological_process GO:0008150 5239 P unknown biological processes ND none NONE Communication:1345790 TIGR 2022-02-01 AT3G45810 locus:2077192 AT3G45810 enables calcium ion binding GO:0005509 1755 F other binding IEA none InterPro:IPR002048 AnalysisReference:501756966 2023-06-11 AT3G45810 gene:2077191 AT3G45810.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45810 locus:2077192 AT3G45810 is active in plasma membrane GO:0005886 570 C plasma membrane IBA none PANTHER:PTN001735877|TAIR:locus:2025351|UniProtKB:Q948U0|UniProtKB:P04839|MGI:MGI:2681162|UniProtKB:Q9NRD8|UniProtKB:Q948T9|UniProtKB:Q9Y5S8|TAIR:locus:2183309|RGD:620574|TAIR:locus:2157027|UniProtKB:Q9NRD9|WB:WBGene00000253|MGI:MGI:88574|MGI:MGI:2139422|RGD:620598|SGD:S000005512|RGD:620600 Communication:501741973 2023-06-07 AT3G45810 locus:2077192 AT3G45810 enables NAD(P)H oxidase H2O2-forming activity GO:0016174 1158 F catalytic activity IBA none PANTHER:PTN000944270|TAIR:locus:2036104|TAIR:locus:2160917|TAIR:locus:2024603|TAIR:locus:2157348 Communication:501741973 2023-06-07 AT3G45820 locus:2077202 AT3G45820 enables molecular_function GO:0003674 3226 F unknown molecular functions ND none NONE Communication:1345790 TIGR 2003-10-04 AT3G45820 gene:2077201 AT3G45820.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45820 locus:2077202 AT3G45820 involved in biological_process GO:0008150 5239 P unknown biological processes ND Unknown biological process NONE Communication:1345790 TAIR 2022-02-01 AT3G45830 locus:2077102 AT3G45830 part of Ino80 complex GO:0031011 19245 C nucleus IDA protein separation and fragment identification Publication:501795269|PMID:34270751 fengchao 2021-08-20 AT3G45830 locus:2077102 AT3G45830 part of Ino80 complex GO:0031011 19245 C other intracellular components IDA protein separation and fragment identification Publication:501795269|PMID:34270751 fengchao 2021-08-20 AT3G45830 locus:2077102 AT3G45830 enables molecular_function GO:0003674 3226 F unknown molecular functions ND Unknown molecular function Communication:1345790 TAIR 2021-10-28 AT3G45830 locus:2077102 AT3G45830 involved in biological_process GO:0008150 5239 P unknown biological processes ND Unknown biological process NONE Communication:1345790 TAIR 2022-02-01 AT3G45830 gene:2077101 AT3G45830.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45840 locus:2077117 AT3G45840 acts upstream of or within defense response to bacterium GO:0042742 14972 P response to external stimulus IEA traceable computational prediction AGI_LocusCode:AT5G67300 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45840 locus:2077117 AT3G45840 acts upstream of or within defense response to bacterium GO:0042742 14972 P response to biotic stimulus IEA traceable computational prediction AGI_LocusCode:AT5G67300 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45840 locus:2077117 AT3G45840 acts upstream of or within defense response to bacterium GO:0042742 14972 P response to stress IEA traceable computational prediction AGI_LocusCode:AT5G67300 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45840 locus:2077117 AT3G45840 enables molecular_function GO:0003674 3226 F unknown molecular functions ND Unknown molecular function Communication:1345790 TAIR 2021-10-28 AT3G45840 gene:2077116 AT3G45840.1 located in extracellular region GO:0005576 294 C extracellular region ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45850 locus:2077132 AT3G45850 is active in mitotic spindle GO:0072686 38521 C cytoskeleton IBA none PANTHER:PTN000649234|CGD:CAL0000181692|FB:FBgn0004378|UniProtKB:P52732|PomBase:SPAC25G10.07c Communication:501741973 2023-06-07 AT3G45850 locus:2077132 AT3G45850 involved in spindle elongation GO:0051231 19534 P cell cycle IBA none PANTHER:PTN000649234|SGD:S000000787|dictyBase:DDB_G0288361|PomBase:SPAC25G10.07c|SGD:S000000159|UniProtKB:P17120 Communication:501741973 2023-06-07 AT3G45850 locus:2077132 AT3G45850 involved in spindle elongation GO:0051231 19534 P cellular component organization IBA none PANTHER:PTN000649234|SGD:S000000787|dictyBase:DDB_G0288361|PomBase:SPAC25G10.07c|SGD:S000000159|UniProtKB:P17120 Communication:501741973 2023-06-07 AT3G45850 locus:2077132 AT3G45850 involved in mitotic spindle assembly GO:0090307 35141 P other cellular processes IBA none PANTHER:PTN000649234|SGD:S000000159|UniProtKB:P17120|PomBase:SPAC25G10.07c|UniProtKB:P52732|SGD:S000000787 Communication:501741973 2023-06-07 AT3G45850 locus:2077132 AT3G45850 involved in spindle elongation GO:0051231 19534 P other cellular processes IBA none PANTHER:PTN000649234|SGD:S000000787|dictyBase:DDB_G0288361|PomBase:SPAC25G10.07c|SGD:S000000159|UniProtKB:P17120 Communication:501741973 2023-06-07 AT3G45850 gene:2077131 AT3G45850.1 located in cytoplasm GO:0005737 231 C cytoplasm ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45850 locus:2077132 AT3G45850 involved in mitotic spindle assembly GO:0090307 35141 P cellular component organization IBA none PANTHER:PTN000649234|SGD:S000000159|UniProtKB:P17120|PomBase:SPAC25G10.07c|UniProtKB:P52732|SGD:S000000787 Communication:501741973 2023-06-07 AT3G45850 locus:2077132 AT3G45850 is active in mitotic spindle GO:0072686 38521 C other intracellular components IBA none PANTHER:PTN000649234|CGD:CAL0000181692|FB:FBgn0004378|UniProtKB:P52732|PomBase:SPAC25G10.07c Communication:501741973 2023-06-07 AT3G45850 locus:2077132 AT3G45850 involved in mitotic spindle assembly GO:0090307 35141 P cell cycle IBA none PANTHER:PTN000649234|SGD:S000000159|UniProtKB:P17120|PomBase:SPAC25G10.07c|UniProtKB:P52732|SGD:S000000787 Communication:501741973 2023-06-07 AT3G45850 locus:2077132 AT3G45850 is active in spindle microtubule GO:0005876 682 C cytoskeleton IBA none PANTHER:PTN000649234|SGD:S000000787|CGD:CAL0000181692|PomBase:SPAC25G10.07c|SGD:S000000159|FB:FBgn0004378 Communication:501741973 2023-06-07 AT3G45850 locus:2077132 AT3G45850 enables microtubule motor activity GO:0003777 3215 F motor activity IEA none InterPro:IPR001752|InterPro:IPR019821 AnalysisReference:501756966 2023-06-11 AT3G45850 locus:2077132 AT3G45850 enables microtubule binding GO:0008017 3214 F protein binding IEA none InterPro:IPR001752 AnalysisReference:501756966 2023-06-11 AT3G45850 locus:2077132 AT3G45850 is active in spindle microtubule GO:0005876 682 C other intracellular components IBA none PANTHER:PTN000649234|SGD:S000000787|CGD:CAL0000181692|PomBase:SPAC25G10.07c|SGD:S000000159|FB:FBgn0004378 Communication:501741973 2023-06-07 AT3G45850 locus:2077132 AT3G45850 involved in microtubule-based movement GO:0007018 6359 P other cellular processes IEA none InterPro:IPR001752|InterPro:IPR019821 AnalysisReference:501756966 2023-06-11 AT3G45850 gene:6530297160 AT3G45850.2 located in cytoplasm GO:0005737 231 C cytoplasm ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45851 gene:4515101604 AT3G45851.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45851 locus:4515103205 AT3G45851 involved in biological_process GO:0008150 5239 P unknown biological processes ND Unknown biological process NONE Communication:1345790 TAIR 2022-02-01 AT3G45851 locus:4515103205 AT3G45851 enables molecular_function GO:0003674 3226 F unknown molecular functions ND Unknown molecular function Communication:1345790 TAIR 2011-10-26 AT3G45860 locus:2077147 AT3G45860 acts upstream of or within response to salicylic acid GO:0009751 11421 P response to chemical IEP Transcript levels (e.g. Northerns) NONE Publication:501730911|PMID:15604743 TAIR 2010-03-01 AT3G45860 locus:2077147 AT3G45860 involved in defense response to bacterium GO:0042742 14972 P response to external stimulus IBA none PANTHER:PTN007811734|TAIR:locus:2121691|TAIR:locus:2077147|TAIR:locus:2121606|TAIR:locus:2121686|TAIR:locus:2121611|UniProtKB:O65479 Communication:501741973 2023-06-07 AT3G45860 locus:2077147 AT3G45860 acts upstream of or within programmed cell death GO:0012501 10841 P cell death IMP Analysis of overexpression/ectopic expression phenotype NONE Publication:501730911|PMID:15604743 TAIR 2010-03-01 AT3G45860 locus:2077147 AT3G45860 enables protein serine/threonine kinase activity GO:0004674 3907 F catalytic activity IBA none PANTHER:PTN002819812|TAIR:locus:2197729|TAIR:locus:2018546|TAIR:locus:2200151|UniProtKB:Q8GY82|TAIR:locus:2137134 Communication:501741973 2023-06-07 AT3G45860 locus:2077147 AT3G45860 is active in plasma membrane GO:0005886 570 C plasma membrane IBA none PANTHER:PTN002819812|TAIR:locus:2121621|TAIR:locus:2137134|TAIR:locus:2200151|TAIR:locus:2197729 Communication:501741973 2023-06-07 AT3G45860 locus:2077147 AT3G45860 acts upstream of or within defense response to bacterium GO:0042742 14972 P response to biotic stimulus IEP Transcript levels (e.g. Northerns) NONE Publication:501730911|PMID:15604743 TAIR 2010-03-01 AT3G45860 locus:2077147 AT3G45860 involved in defense response to bacterium GO:0042742 14972 P response to stress IBA none PANTHER:PTN007811734|TAIR:locus:2121691|TAIR:locus:2077147|TAIR:locus:2121606|TAIR:locus:2121686|TAIR:locus:2121611|UniProtKB:O65479 Communication:501741973 2023-06-07 AT3G45860 locus:2077147 AT3G45860 involved in protein phosphorylation GO:0006468 6897 P other metabolic processes IBA none PANTHER:PTN002819812|UniProtKB:Q8L710|TAIR:locus:2018546|TAIR:locus:2200151|TAIR:locus:2197729|TAIR:locus:2202054|TAIR:locus:2018506 Communication:501741973 2023-06-07 AT3G45860 locus:2077147 AT3G45860 acts upstream of or within defense response GO:0006952 5542 P response to stress TAS none NONE Publication:1345932|PMID:11135117 TIGR 2003-04-17 AT3G45860 locus:2077147 AT3G45860 acts upstream of or within defense response to bacterium GO:0042742 14972 P response to external stimulus IEP Transcript levels (e.g. Northerns) NONE Publication:501730911|PMID:15604743 TAIR 2010-03-01 AT3G45860 locus:2077147 AT3G45860 enables kinase activity GO:0016301 2953 F kinase activity ISS Sequence similarity (homologue of/most closely related to) Communication:1674994 TAIR 2003-03-29 AT3G45860 locus:2077147 AT3G45860 involved in protein phosphorylation GO:0006468 6897 P other cellular processes IBA none PANTHER:PTN002819812|UniProtKB:Q8L710|TAIR:locus:2018546|TAIR:locus:2200151|TAIR:locus:2197729|TAIR:locus:2202054|TAIR:locus:2018506 Communication:501741973 2023-06-07 AT3G45860 locus:2077147 AT3G45860 involved in defense response to bacterium GO:0042742 14972 P response to biotic stimulus IBA none PANTHER:PTN007811734|TAIR:locus:2121691|TAIR:locus:2077147|TAIR:locus:2121606|TAIR:locus:2121686|TAIR:locus:2121611|UniProtKB:O65479 Communication:501741973 2023-06-07 AT3G45860 locus:2077147 AT3G45860 enables protein serine/threonine kinase activity GO:0004674 3907 F kinase activity IBA none PANTHER:PTN002819812|TAIR:locus:2197729|TAIR:locus:2018546|TAIR:locus:2200151|UniProtKB:Q8GY82|TAIR:locus:2137134 Communication:501741973 2023-06-07 AT3G45860 locus:2077147 AT3G45860 enables protein serine/threonine kinase activity GO:0004674 3907 F transferase activity IBA none PANTHER:PTN002819812|TAIR:locus:2197729|TAIR:locus:2018546|TAIR:locus:2200151|UniProtKB:Q8GY82|TAIR:locus:2137134 Communication:501741973 2023-06-07 AT3G45860 locus:2077147 AT3G45860 acts upstream of or within defense response to bacterium GO:0042742 14972 P response to stress IEP Transcript levels (e.g. Northerns) NONE Publication:501730911|PMID:15604743 TAIR 2010-03-01 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within regulation of cellular biosynthetic process GO:0031326 20872 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT5G52240 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within plant-type cell wall organization GO:0009664 5349 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT3G26370 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within cell wall polysaccharide biosynthetic process GO:0070592 32030 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT3G26370 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within regulation of cellular biosynthetic process GO:0031326 20872 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT5G52240 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within lignin biosynthetic process GO:0009809 6181 P secondary metabolic process IEA traceable computational prediction AGI_LocusCode:AT5G52240 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within cell wall polysaccharide biosynthetic process GO:0070592 32030 P biosynthetic process IEA traceable computational prediction AGI_LocusCode:AT3G26370 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 gene:6532558527 AT3G45870.5 located in chloroplast GO:0009507 175 C chloroplast ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within cell wall polysaccharide biosynthetic process GO:0070592 32030 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT3G26370 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within lignin biosynthetic process GO:0009809 6181 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT5G52240 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within lignin biosynthetic process GO:0009809 6181 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT5G52240 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within lignin biosynthetic process GO:0009809 6181 P biosynthetic process IEA traceable computational prediction AGI_LocusCode:AT5G52240 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 gene:6532550539 AT3G45870.7 located in mitochondrion GO:0005739 486 C mitochondrion ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45870 gene:6532550538 AT3G45870.6 located in mitochondrion GO:0005739 486 C mitochondrion ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45870 locus:2077162 AT3G45870 is active in plasma membrane GO:0005886 570 C plasma membrane IBA none PANTHER:PTN001261134|TAIR:locus:2200990|TAIR:locus:2058460|TAIR:locus:2125167|TAIR:locus:2194864|TAIR:locus:2039792 Communication:501741973 2023-06-07 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within regulation of cellular biosynthetic process GO:0031326 20872 P biosynthetic process IEA traceable computational prediction AGI_LocusCode:AT5G52240 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within plant-type cell wall biogenesis GO:0009832 10265 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT3G26370 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 gene:6532558552 AT3G45870.3 located in mitochondrion GO:0005739 486 C mitochondrion ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45870 locus:2077162 AT3G45870 enables transmembrane transporter activity GO:0022857 27431 F transporter activity IEA none InterPro:IPR030184 AnalysisReference:501756966 2023-05-23 AT3G45870 gene:6532550533 AT3G45870.8 located in mitochondrion GO:0005739 486 C mitochondrion ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within cell wall polysaccharide biosynthetic process GO:0070592 32030 P carbohydrate metabolic process IEA traceable computational prediction AGI_LocusCode:AT3G26370 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45870 locus:2077162 AT3G45870 acts upstream of or within plant-type cell wall organization GO:0009664 5349 P cellular component organization IEA traceable computational prediction AGI_LocusCode:AT3G26370 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45880 gene:6532550440 AT3G45880.2 located in cytoplasm GO:0005737 231 C cytoplasm ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45880 locus:2077172 AT3G45880 enables histone H3K27me2/H3K27me3 demethylase activity GO:0071558 34020 F catalytic activity IMP none Publication:501784396|PMID:30859592 2022-05-04 AT3G45880 locus:2077172 AT3G45880 acts upstream of or within primary root development GO:0080022 30849 P anatomical structure development IMP none Publication:501784811|PMID:30983495 2022-03-30 AT3G45880 locus:2077172 AT3G45880 involved in regulation of photoperiodism, flowering GO:2000028 35576 P response to light stimulus IMP none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 acts upstream of or within regulation of seedling development GO:1900140 40337 P multicellular organism development IMP none Publication:501784396|PMID:30859592 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in regulation of abscisic acid-activated signaling pathway GO:0009787 11755 P response to chemical IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in regulation of photoperiodism, flowering GO:2000028 35576 P multicellular organism development IMP none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 located in cytoplasm GO:0005737 231 C cytoplasm IDA none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 acts upstream of or within response to abscisic acid GO:0009737 11395 P response to chemical IMP none Publication:501784396|PMID:30859592 2022-05-04 AT3G45880 locus:2077172 AT3G45880 located in nucleus GO:0005634 537 C nucleus IDA none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 enables histone H3K27me2/H3K27me3 demethylase activity GO:0071558 34020 F catalytic activity IDA none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 enables histone H3K27me2/H3K27me3 demethylase activity GO:0071558 34020 F catalytic activity IMP none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 involved in regulation of brassinosteroid mediated signaling pathway GO:1900457 41205 P signal transduction IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in negative regulation of gene expression, epigenetic GO:0045814 12764 P regulation of gene expression, epigenetic IDA none Publication:501761846|PMID:25267112 2022-09-19 AT3G45880 locus:2077172 AT3G45880 involved in regulation of brassinosteroid mediated signaling pathway GO:1900457 41205 P cell communication IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in regulation of photoperiodism, flowering GO:2000028 35576 P post-embryonic development IMP none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 involved in regulation of abscisic acid-activated signaling pathway GO:0009787 11755 P signal transduction IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in response to temperature stimulus GO:0009266 7411 P response to abiotic stimulus IMP none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 involved in regulation of abscisic acid-activated signaling pathway GO:0009787 11755 P other cellular processes IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45880 locus:2077172 AT3G45880 acts upstream of or within primary root development GO:0080022 30849 P multicellular organism development IMP none Publication:501784811|PMID:30983495 2022-03-30 AT3G45880 locus:2077172 AT3G45880 acts upstream of or within regulation of seedling development GO:1900140 40337 P post-embryonic development IMP none Publication:501784396|PMID:30859592 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in response to abscisic acid GO:0009737 11395 P response to endogenous stimulus IMP none Publication:501784811|PMID:30983495 2022-03-30 AT3G45880 locus:2077172 AT3G45880 located in endoplasmic reticulum GO:0005783 268 C endoplasmic reticulum IDA none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 involved in regulation of brassinosteroid mediated signaling pathway GO:1900457 41205 P other cellular processes IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in regulation of brassinosteroid mediated signaling pathway GO:1900457 41205 P response to endogenous stimulus IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45880 locus:2077172 AT3G45880 acts upstream of or within response to abscisic acid GO:0009737 11395 P response to endogenous stimulus IMP none Publication:501784396|PMID:30859592 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in regulation of brassinosteroid mediated signaling pathway GO:1900457 41205 P response to chemical IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in regulation of photoperiodism, flowering GO:2000028 35576 P anatomical structure development IMP none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 involved in regulation of abscisic acid-activated signaling pathway GO:0009787 11755 P cell communication IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45880 locus:2077172 AT3G45880 involved in response to abscisic acid GO:0009737 11395 P response to chemical IMP none Publication:501784811|PMID:30983495 2022-03-30 AT3G45880 locus:2077172 AT3G45880 involved in regulation of photoperiodism, flowering GO:2000028 35576 P reproduction IMP none Publication:501761846|PMID:25267112 2022-03-30 AT3G45880 locus:2077172 AT3G45880 involved in negative regulation of gene expression, epigenetic GO:0045814 12764 P other metabolic processes IDA none Publication:501761846|PMID:25267112 2022-09-19 AT3G45880 gene:2077171 AT3G45880.1 located in cytoplasm GO:0005737 231 C cytoplasm ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45880 locus:2077172 AT3G45880 enables 2-oxoglutarate-dependent dioxygenase activity GO:0016706 3496 F catalytic activity IBA none PANTHER:PTN004362614|UniProtKB:Q8N371|UniProtKB:Q9NWT6|TAIR:locus:2077172|UniProtKB:P0C870|UniProtKB:Q8IIE4|UniProtKB:A2RUC4|TAIR:locus:2091861 Communication:501741973 2023-06-07 AT3G45880 locus:2077172 AT3G45880 involved in regulation of abscisic acid-activated signaling pathway GO:0009787 11755 P response to endogenous stimulus IMP none Publication:501792377|PMID:33324437 2022-05-04 AT3G45890 locus:2077197 AT3G45890 acts upstream of or within response to UV-B GO:0010224 18529 P response to light stimulus IMP analysis of physiological response NONE Publication:501729351|PMID:19075229 TAIR 2009-01-20 AT3G45890 gene:2077196 AT3G45890.1 located in chloroplast envelope GO:0009941 12482 C other intracellular components HDA none NONE Publication:501735990|PMID:20061580 nrolland 2021-04-07 AT3G45890 locus:2077197 AT3G45890 acts upstream of or within developmental process GO:0032502 25755 P other biological processes IMP analysis of visible trait NONE Publication:501729351|PMID:19075229 TAIR 2009-01-20 AT3G45890 locus:2077197 AT3G45890 involved in response to UV-B GO:0010224 18529 P response to light stimulus IBA none PANTHER:PTN000979455|TAIR:locus:2077197 Communication:501741973 2021-03-31 AT3G45890 gene:2077196 AT3G45890.1 located in chloroplast envelope GO:0009941 12482 C chloroplast HDA none NONE Publication:501735990|PMID:20061580 nrolland 2021-04-07 AT3G45890 locus:2077197 AT3G45890 located in plastid GO:0009536 576 C plastid HDA none NONE Publication:501750648|PMID:22923678 dupree 2021-04-07 AT3G45890 locus:2077197 AT3G45890 involved in developmental process GO:0032502 25755 P other biological processes IBA none PANTHER:PTN000979455|TAIR:locus:2077197 Communication:501741973 2021-03-31 AT3G45890 gene:2077196 AT3G45890.1 located in chloroplast envelope GO:0009941 12482 C plastid HDA none NONE Publication:501735990|PMID:20061580 nrolland 2021-04-07 AT3G45900 locus:2077207 AT3G45900 involved in biological_process GO:0008150 5239 P unknown biological processes ND Unknown biological process NONE Communication:1345790 TAIR 2022-02-01 AT3G45900 gene:2077206 AT3G45900.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45900 locus:2077207 AT3G45900 enables molecular_function GO:0003674 3226 F unknown molecular functions ND Unknown molecular function Communication:1345790 TAIR 2021-10-28 AT3G45910 locus:2077097 AT3G45910 enables molecular_function GO:0003674 3226 F unknown molecular functions ND none NONE Communication:1345790 TIGR 2003-10-04 AT3G45910 gene:2077096 AT3G45910.1 located in mitochondrion GO:0005739 486 C mitochondrion ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45910 locus:2077097 AT3G45910 involved in biological_process GO:0008150 5239 P unknown biological processes ND Unknown biological process NONE Communication:1345790 TAIR 2022-02-01 AT3G45920 locus:2077112 AT3G45920 enables protein kinase activity GO:0004672 3889 F catalytic activity IEA none InterPro:IPR000719|InterPro:IPR008271 AnalysisReference:501756966 2023-05-23 AT3G45920 locus:2077112 AT3G45920 involved in protein phosphorylation GO:0006468 6897 P other metabolic processes IEA none InterPro:IPR000719|InterPro:IPR008271 AnalysisReference:501756966 2023-05-23 AT3G45920 gene:2077111 AT3G45920.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45920 locus:2077112 AT3G45920 involved in protein phosphorylation GO:0006468 6897 P other cellular processes IEA none InterPro:IPR000719|InterPro:IPR008271 AnalysisReference:501756966 2023-05-23 AT3G45920 locus:2077112 AT3G45920 enables protein kinase activity GO:0004672 3889 F kinase activity IEA none InterPro:IPR000719|InterPro:IPR008271 AnalysisReference:501756966 2023-05-23 AT3G45920 locus:2077112 AT3G45920 enables ATP binding GO:0005524 894 F nucleotide binding IEA none InterPro:IPR000719 AnalysisReference:501756966 2023-05-23 AT3G45920 locus:2077112 AT3G45920 enables ATP binding GO:0005524 894 F other binding IEA none InterPro:IPR000719 AnalysisReference:501756966 2023-05-23 AT3G45920 locus:2077112 AT3G45920 enables protein kinase activity GO:0004672 3889 F transferase activity IEA none InterPro:IPR000719|InterPro:IPR008271 AnalysisReference:501756966 2023-05-23 AT3G45930 gene:2077126 AT3G45930.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45930 locus:2077127 AT3G45930 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501776792|PMID:28887381 dszymanski 2019-04-04 AT3G45930 locus:2077127 AT3G45930 acts upstream of or within regulation of nucleobase-containing compound metabolic process GO:0019219 10748 P nucleobase-containing compound metabolic process IEA traceable computational prediction AGI_LocusCode:AT2G36270 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45930 locus:2077127 AT3G45930 acts upstream of or within regulation of nitrogen compound metabolic process GO:0051171 19379 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT3G11100|AGI_LocusCode:AT2G36270 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45930 locus:2077127 AT3G45930 acts upstream of or within regulation of nucleobase-containing compound metabolic process GO:0019219 10748 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT2G36270 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45930 locus:2077127 AT3G45930 acts upstream of or within regulation of nucleobase-containing compound metabolic process GO:0019219 10748 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT2G36270 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45930 locus:2077127 AT3G45930 acts upstream of or within regulation of primary metabolic process GO:0080090 31866 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT3G11100|AGI_LocusCode:AT2G36270 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45930 locus:2077127 AT3G45930 acts upstream of or within macromolecule modification GO:0043412 21458 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT3G11100 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45935 locus:1005716593 AT3G45935 acts upstream of or within translational elongation GO:0006414 6905 P other metabolic processes TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45935 locus:1005716593 AT3G45935 acts upstream of or within translation GO:0006412 6869 P translation TAS none Publication:501710108|PMID:8980477 2021-04-01 AT3G45935 locus:1005716593 AT3G45935 acts upstream of or within translational elongation GO:0006414 6905 P other cellular processes TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45935 locus:1005716593 AT3G45935 is active in cellular_component GO:0005575 163 C unknown cellular components ND Unknown cellular component NONE Communication:1345790 TAIR 2022-02-01 AT3G45935 locus:1005716593 AT3G45935 acts upstream of or within translational elongation GO:0006414 6905 P biosynthetic process TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45935 locus:1005716593 AT3G45935 enables triplet codon-amino acid adaptor activity GO:0030533 9889 F RNA binding TAS text book or dictionary; -material has become common knowledge Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45935 locus:1005716593 AT3G45935 acts upstream of or within translational elongation GO:0006414 6905 P translation TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45940 gene:2077141 AT3G45940.1 located in plasma membrane GO:0005886 570 C plasma membrane ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45940 locus:2077142 AT3G45940 enables hydrolase activity, hydrolyzing O-glycosyl compounds GO:0004553 2781 F hydrolase activity IBA none PANTHER:PTN000509739|PomBase:SPAPB24D3.10c|MGI:MGI:1097667|UniProtKB:Q5AWI5|WB:WBGene00009583|dictyBase:DDB_G0269154|MGI:MGI:95609|RGD:3675|UniProtKB:P14410|MGI:MGI:1923301|TAIR:locus:2163976|TAIR:locus:2026895|WB:WBGene00019895|PomBase:SPAC1002.03c|MGI:MGI:1203495|UniProtKB:O43451|SGD:S000000433|RGD:735227|UniProtKB:Q14697|WB:WBGene00017071|UniProtKB:P10253|UniProtKB:Q5BET9 Communication:501741973 2023-06-07 AT3G45940 locus:2077142 AT3G45940 enables carbohydrate binding GO:0030246 8584 F carbohydrate binding IEA none InterPro:IPR011013 AnalysisReference:501756966 2023-06-11 AT3G45940 locus:2077142 AT3G45940 enables alpha-D-xyloside xylohydrolase GO:0061634 46270 F hydrolase activity IEA none EC:3.2.1.177 AnalysisReference:501756967 2023-06-11 AT3G45940 gene:2077141 AT3G45940.1 located in plasmodesma GO:0009506 571 C other cellular components HDA none NONE Publication:501742898|PMID:21533090 maule 2021-04-07 AT3G45940 locus:2077142 AT3G45940 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501776792|PMID:28887381 dszymanski 2019-04-04 AT3G45950 locus:2077157 AT3G45950 involved in RNA splicing GO:0008380 4903 P other metabolic processes IBA none PANTHER:PTN000310059|UniProtKB:O95391|PomBase:SPBC365.05c Communication:501741973 2023-06-07 AT3G45950 gene:2077156 AT3G45950.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45950 locus:2077157 AT3G45950 involved in RNA splicing GO:0008380 4903 P nucleobase-containing compound metabolic process IBA none PANTHER:PTN000310059|UniProtKB:O95391|PomBase:SPBC365.05c Communication:501741973 2023-06-07 AT3G45950 locus:2077157 AT3G45950 part of spliceosomal complex GO:0005681 684 C nucleus IBA none PANTHER:PTN000310059|PomBase:SPBC365.05c|UniProtKB:O95391 Communication:501741973 2022-11-23 AT3G45950 locus:2077157 AT3G45950 enables molecular_function GO:0003674 3226 F unknown molecular functions ND Unknown molecular function Communication:1345790 TAIR 2021-10-28 AT3G45955 locus:1005716591 AT3G45955 acts upstream of or within translation GO:0006412 6869 P translation TAS none Publication:501710108|PMID:8980477 2021-04-01 AT3G45955 locus:1005716591 AT3G45955 enables triplet codon-amino acid adaptor activity GO:0030533 9889 F RNA binding TAS text book or dictionary; -material has become common knowledge Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45955 locus:1005716591 AT3G45955 acts upstream of or within translational elongation GO:0006414 6905 P other metabolic processes TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45955 locus:1005716591 AT3G45955 acts upstream of or within translational elongation GO:0006414 6905 P translation TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45955 locus:1005716591 AT3G45955 acts upstream of or within translational elongation GO:0006414 6905 P other cellular processes TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45955 locus:1005716591 AT3G45955 is active in cellular_component GO:0005575 163 C unknown cellular components ND Unknown cellular component NONE Communication:1345790 TAIR 2022-02-01 AT3G45955 locus:1005716591 AT3G45955 acts upstream of or within translational elongation GO:0006414 6905 P biosynthetic process TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45960 gene:1009021765 AT3G45960.2 located in plasmodesma GO:0009506 571 C other cellular components HDA none NONE Publication:501742898|PMID:21533090 maule 2021-04-07 AT3G45960 locus:2077167 AT3G45960 acts upstream of or within unidimensional cell growth GO:0009826 10252 P cell growth NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45960 gene:1009021765 AT3G45960.2 located in extracellular region GO:0005576 294 C extracellular region ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45960 locus:2077167 AT3G45960 acts upstream of or within plant-type cell wall loosening GO:0009828 10268 P other cellular processes NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45960 locus:2077167 AT3G45960 acts upstream of or within unidimensional cell growth GO:0009826 10252 P anatomical structure development NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45960 locus:2077167 AT3G45960 acts upstream of or within plant-type cell wall loosening GO:0009828 10268 P cellular component organization NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45960 locus:2077167 AT3G45960 acts upstream of or within unidimensional cell growth GO:0009826 10252 P growth NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45960 locus:2077167 AT3G45960 located in plant-type cell wall GO:0009505 156 C cell wall HDA none NONE Publication:501718077|PMID:16287169 TAIR 2021-05-12 AT3G45965 locus:1005716592 AT3G45965 acts upstream of or within translation GO:0006412 6869 P translation TAS none Publication:501710108|PMID:8980477 2021-04-01 AT3G45965 locus:1005716592 AT3G45965 acts upstream of or within translational elongation GO:0006414 6905 P other cellular processes TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45965 locus:1005716592 AT3G45965 acts upstream of or within translational elongation GO:0006414 6905 P other metabolic processes TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45965 locus:1005716592 AT3G45965 acts upstream of or within translational elongation GO:0006414 6905 P biosynthetic process TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45965 locus:1005716592 AT3G45965 acts upstream of or within translational elongation GO:0006414 6905 P translation TAS text book or dictionary; -material has become common knowledge NONE Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45965 locus:1005716592 AT3G45965 enables triplet codon-amino acid adaptor activity GO:0030533 9889 F RNA binding TAS text book or dictionary; -material has become common knowledge Publication:501710108|PMID:8980477 TAIR 2005-08-31 AT3G45965 locus:1005716592 AT3G45965 is active in cellular_component GO:0005575 163 C unknown cellular components ND Unknown cellular component NONE Communication:1345790 TAIR 2022-02-01 AT3G45970 gene:6532554812 AT3G45970.2 located in extracellular region GO:0005576 294 C extracellular region ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45970 locus:2077177 AT3G45970 acts upstream of or within unidimensional cell growth GO:0009826 10252 P growth NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45970 locus:2077177 AT3G45970 located in secretory vesicle GO:0099503 51212 C cytoplasm HDA none Publication:501761766|PMID:25293756 dszymanski 2019-04-04 AT3G45970 locus:2077177 AT3G45970 acts upstream of or within plant-type cell wall loosening GO:0009828 10268 P other cellular processes NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45970 locus:2077177 AT3G45970 located in plant-type cell wall GO:0009505 156 C cell wall HDA none NONE Publication:501718077|PMID:16287169 TAIR 2021-05-12 AT3G45970 locus:2077177 AT3G45970 located in secretory vesicle GO:0099503 51212 C other intracellular components HDA none Publication:501761766|PMID:25293756 dszymanski 2019-04-04 AT3G45970 gene:2077176 AT3G45970.1 located in Golgi apparatus GO:0005794 48 C Golgi apparatus HDA none NONE Publication:501747810|PMID:22430844 jheazlewoo 2021-05-12 AT3G45970 locus:2077177 AT3G45970 located in extracellular region GO:0005576 294 C extracellular region IEA none InterPro:IPR007118 AnalysisReference:501756966 2023-05-23 AT3G45970 locus:2077177 AT3G45970 acts upstream of or within plant-type cell wall loosening GO:0009828 10268 P cellular component organization NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45970 gene:2077176 AT3G45970.1 located in plasmodesma GO:0009506 571 C other cellular components HDA none NONE Publication:501742898|PMID:21533090 maule 2021-04-07 AT3G45970 gene:2077176 AT3G45970.1 located in extracellular region GO:0005576 294 C extracellular region ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45970 locus:2077177 AT3G45970 acts upstream of or within unidimensional cell growth GO:0009826 10252 P anatomical structure development NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45970 locus:2077177 AT3G45970 acts upstream of or within unidimensional cell growth GO:0009826 10252 P cell growth NAS none NONE Publication:1546271|PMID:11641069 TIGR 2003-04-17 AT3G45970 gene:2077176 AT3G45970.1 located in plant-type cell wall GO:0009505 156 C cell wall HDA none NONE Publication:501711493|PMID:14595688 kvanwijk 2022-02-08 AT3G45980 gene:2077181 AT3G45980.1 located in chloroplast thylakoid GO:0009534 704 C plastid HDA none NONE Publication:501735990|PMID:20061580 nrolland 2021-04-07 AT3G45980 gene:2077181 AT3G45980.1 located in nucleolus GO:0005730 527 C nucleolus HDA none NONE Publication:501714224|PMID:15496452 kvanwijk 2021-05-10 AT3G45980 locus:2077182 AT3G45980 acts upstream of or within regulation of nucleobase-containing compound metabolic process GO:0019219 10748 P nucleobase-containing compound metabolic process IEA traceable computational prediction AGI_LocusCode:AT1G21970|AGI_LocusCode:AT1G56170|AGI_LocusCode:AT3G19290|AGI_LocusCode:AT4G34000 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45980 gene:2077181 AT3G45980.1 located in chloroplast thylakoid GO:0009534 704 C thylakoid HDA none NONE Publication:501735990|PMID:20061580 nrolland 2021-04-07 AT3G45980 locus:2077182 AT3G45980 acts upstream of or within RNA metabolic process GO:0016070 4899 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT1G21970|AGI_LocusCode:AT1G56170|AGI_LocusCode:AT3G19290|AGI_LocusCode:AT4G34000 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45980 gene:2077181 AT3G45980.1 located in chloroplast thylakoid GO:0009534 704 C chloroplast HDA none NONE Publication:501735990|PMID:20061580 nrolland 2021-04-07 AT3G45980 locus:2077182 AT3G45980 enables DNA binding GO:0003677 961 F DNA binding IBA none PANTHER:PTN000603808|CGD:CAL0000199081|SGD:S000002632 Communication:501741973 2022-11-23 AT3G45980 locus:2077182 AT3G45980 acts upstream of or within regulation of nucleobase-containing compound metabolic process GO:0019219 10748 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT1G21970|AGI_LocusCode:AT1G56170|AGI_LocusCode:AT3G19290|AGI_LocusCode:AT4G34000 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45980 locus:2077182 AT3G45980 acts upstream of or within regulation of gene expression GO:0010468 28541 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT1G21970|AGI_LocusCode:AT1G56170|AGI_LocusCode:AT3G11100|AGI_LocusCode:AT3G19290|AGI_LocusCode:AT4G34000 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45980 gene:2077181 AT3G45980.1 located in chloroplast stroma GO:0009570 178 C plastid HDA none NONE Publication:501735990|PMID:20061580 nrolland 2021-04-07 AT3G45980 locus:2077182 AT3G45980 acts upstream of or within regulation of nucleobase-containing compound metabolic process GO:0019219 10748 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT1G21970|AGI_LocusCode:AT1G56170|AGI_LocusCode:AT3G19290|AGI_LocusCode:AT4G34000 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45980 locus:2077182 AT3G45980 enables protein heterodimerization activity GO:0046982 15254 F protein binding IEA none InterPro:IPR009072 AnalysisReference:501756966 2023-05-23 AT3G45980 locus:2077182 AT3G45980 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501776792|PMID:28887381 dszymanski 2019-04-04 AT3G45980 gene:2077181 AT3G45980.1 located in chloroplast thylakoid GO:0009534 704 C other intracellular components HDA none NONE Publication:501735990|PMID:20061580 nrolland 2021-04-07 AT3G45980 gene:2077181 AT3G45980.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G45980 locus:2077182 AT3G45980 enables structural constituent of chromatin GO:0030527 9869 F structural molecule activity IEA none InterPro:IPR000558 AnalysisReference:501756966 2023-05-23 AT3G45980 locus:2077182 AT3G45980 acts upstream of or within RNA metabolic process GO:0016070 4899 P nucleobase-containing compound metabolic process IEA traceable computational prediction AGI_LocusCode:AT1G21970|AGI_LocusCode:AT1G56170|AGI_LocusCode:AT3G19290|AGI_LocusCode:AT4G34000 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G45980 gene:2077181 AT3G45980.1 located in chloroplast stroma GO:0009570 178 C chloroplast HDA none NONE Publication:501735990|PMID:20061580 nrolland 2021-04-07 AT3G45990 locus:2077092 AT3G45990 is active in cytoplasm GO:0005737 231 C cytoplasm IBA none PANTHER:PTN000227258|PomBase:SPAC20G4.06c|SGD:S000003973|WB:WBGene00006794|UniProtKB:P23528|UniProtKB:Q8I467|UniProtKB:C4LVG4|UniProtKB:Q9Y281|UniProtKB:Q580V7|dictyBase:DDB_G0277833|RGD:69285|MGI:MGI:101757|MGI:MGI:1929270 Communication:501741973 2023-06-07 AT3G45990 locus:2077092 AT3G45990 involved in actin filament depolymerization GO:0030042 8888 P cellular component organization IBA none PANTHER:PTN000227258|TAIR:locus:2127073|TAIR:locus:2077107|dictyBase:DDB_G0272568|TAIR:locus:2042546|UniProtKB:P60981|FB:FBgn0011726|SGD:S000003973|WB:WBGene00006794|UniProtKB:P23528|TAIR:locus:2168063|TAIR:locus:2168052|MGI:MGI:101763|dictyBase:DDB_G0277833|UniProtKB:Q39250|TAIR:locus:2156727|MGI:MGI:1929270|MGI:MGI:101757|UniProtKB:Q9Y281|TAIR:locus:2131879|TAIR:locus:2198175 Communication:501741973 2023-06-07 AT3G45990 locus:2077092 AT3G45990 is active in actin cytoskeleton GO:0015629 99 C cytoskeleton IBA none PANTHER:PTN000227258|UniProtKB:Q8I467|UniProtKB:Q8ID92|dictyBase:DDB_G0272568|PomBase:SPAC20G4.06c|SGD:S000003973|WB:WBGene00006794|dictyBase:DDB_G0277833|MGI:MGI:101757|MGI:MGI:1929270|TAIR:locus:2156727|RGD:69285|TAIR:locus:2131879 Communication:501741973 2023-06-07 AT3G45990 locus:2077092 AT3G45990 enables actin filament binding GO:0051015 18617 F protein binding IBA none PANTHER:PTN000227258|PomBase:SPAC20G4.06c|TAIR:locus:2059861|UniProtKB:P23528|SGD:S000003973|WB:WBGene00006794|UniProtKB:P60981|MGI:MGI:101763|UniProtKB:P10668|MGI:MGI:1929270|MGI:MGI:101757|RGD:69285 Communication:501741973 2023-06-07 AT3G45990 locus:2077092 AT3G45990 involved in actin filament depolymerization GO:0030042 8888 P other cellular processes IBA none PANTHER:PTN000227258|TAIR:locus:2127073|TAIR:locus:2077107|dictyBase:DDB_G0272568|TAIR:locus:2042546|UniProtKB:P60981|FB:FBgn0011726|SGD:S000003973|WB:WBGene00006794|UniProtKB:P23528|TAIR:locus:2168063|TAIR:locus:2168052|MGI:MGI:101763|dictyBase:DDB_G0277833|UniProtKB:Q39250|TAIR:locus:2156727|MGI:MGI:1929270|MGI:MGI:101757|UniProtKB:Q9Y281|TAIR:locus:2131879|TAIR:locus:2198175 Communication:501741973 2023-06-07 AT3G45990 locus:2077092 AT3G45990 enables actin filament binding GO:0051015 18617 F other binding IBA none PANTHER:PTN000227258|PomBase:SPAC20G4.06c|TAIR:locus:2059861|UniProtKB:P23528|SGD:S000003973|WB:WBGene00006794|UniProtKB:P60981|MGI:MGI:101763|UniProtKB:P10668|MGI:MGI:1929270|MGI:MGI:101757|RGD:69285 Communication:501741973 2023-06-07 AT3G45990 locus:2077092 AT3G45990 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501761766|PMID:25293756 dszymanski 2019-04-04 AT3G46000 gene:2077106 AT3G46000.1 located in cytoplasm GO:0005737 231 C cytoplasm ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46000 locus:2077107 AT3G46000 involved in actin filament depolymerization GO:0030042 8888 P cellular component organization IEA none InterPro:IPR017904 AnalysisReference:501756966 2023-06-11 AT3G46000 locus:2077107 AT3G46000 acts upstream of or within actin filament depolymerization GO:0030042 8888 P cellular component organization IDA in vitro assay NONE Publication:501774113|PMID:28123105 xiangyun 2017-04-17 AT3G46000 gene:6532545377 AT3G46000.2 located in cytoplasm GO:0005737 231 C cytoplasm ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46000 locus:2077107 AT3G46000 enables actin filament binding GO:0051015 18617 F protein binding IBA none PANTHER:PTN000227258|PomBase:SPAC20G4.06c|TAIR:locus:2059861|UniProtKB:P23528|SGD:S000003973|WB:WBGene00006794|UniProtKB:P60981|MGI:MGI:101763|UniProtKB:P10668|MGI:MGI:1929270|MGI:MGI:101757|RGD:69285 Communication:501741973 2023-06-07 AT3G46000 locus:2077107 AT3G46000 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501761766|PMID:25293756 dszymanski 2019-04-04 AT3G46000 locus:2077107 AT3G46000 is active in cytoplasm GO:0005737 231 C cytoplasm IBA none PANTHER:PTN000227258|PomBase:SPAC20G4.06c|SGD:S000003973|WB:WBGene00006794|UniProtKB:P23528|UniProtKB:Q8I467|UniProtKB:C4LVG4|UniProtKB:Q9Y281|UniProtKB:Q580V7|dictyBase:DDB_G0277833|RGD:69285|MGI:MGI:101757|MGI:MGI:1929270 Communication:501741973 2023-06-07 AT3G46000 locus:2077107 AT3G46000 located in cytoplasm GO:0005737 231 C cytoplasm HDA none NONE Publication:501714452|PMID:15610358 TAIR 2021-04-07 AT3G46000 locus:2077107 AT3G46000 enables protein binding GO:0005515 3877 F protein binding IPI none UniProtKB:Q9ZU34 Publication:501715803|PMID:12417710 2021-04-01 AT3G46000 gene:6532545378 AT3G46000.3 located in cytoplasm GO:0005737 231 C cytoplasm ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46000 locus:2077107 AT3G46000 located in nucleus GO:0005634 537 C nucleus HDA none NONE Publication:501714452|PMID:15610358 TAIR 2021-04-07 AT3G46000 locus:2077107 AT3G46000 located in actin cytoskeleton GO:0015629 99 C cytoskeleton IEA none InterPro:IPR017904 AnalysisReference:501756966 2023-06-11 AT3G46000 locus:2077107 AT3G46000 enables actin filament binding GO:0051015 18617 F other binding IBA none PANTHER:PTN000227258|PomBase:SPAC20G4.06c|TAIR:locus:2059861|UniProtKB:P23528|SGD:S000003973|WB:WBGene00006794|UniProtKB:P60981|MGI:MGI:101763|UniProtKB:P10668|MGI:MGI:1929270|MGI:MGI:101757|RGD:69285 Communication:501741973 2023-06-07 AT3G46000 locus:2077107 AT3G46000 involved in actin filament depolymerization GO:0030042 8888 P other cellular processes IBA none PANTHER:PTN000227258|TAIR:locus:2127073|TAIR:locus:2077107|dictyBase:DDB_G0272568|TAIR:locus:2042546|UniProtKB:P60981|FB:FBgn0011726|SGD:S000003973|WB:WBGene00006794|UniProtKB:P23528|TAIR:locus:2168063|TAIR:locus:2168052|MGI:MGI:101763|dictyBase:DDB_G0277833|UniProtKB:Q39250|TAIR:locus:2156727|MGI:MGI:1929270|MGI:MGI:101757|UniProtKB:Q9Y281|TAIR:locus:2131879|TAIR:locus:2198175 Communication:501741973 2023-06-07 AT3G46000 locus:2077107 AT3G46000 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501776792|PMID:28887381 dszymanski 2019-04-04 AT3G46000 locus:2077107 AT3G46000 involved in actin filament depolymerization GO:0030042 8888 P cellular component organization IBA none PANTHER:PTN000227258|TAIR:locus:2127073|TAIR:locus:2077107|dictyBase:DDB_G0272568|TAIR:locus:2042546|UniProtKB:P60981|FB:FBgn0011726|SGD:S000003973|WB:WBGene00006794|UniProtKB:P23528|TAIR:locus:2168063|TAIR:locus:2168052|MGI:MGI:101763|dictyBase:DDB_G0277833|UniProtKB:Q39250|TAIR:locus:2156727|MGI:MGI:1929270|MGI:MGI:101757|UniProtKB:Q9Y281|TAIR:locus:2131879|TAIR:locus:2198175 Communication:501741973 2023-06-07 AT3G46000 locus:2077107 AT3G46000 is active in actin cytoskeleton GO:0015629 99 C cytoskeleton IBA none PANTHER:PTN000227258|UniProtKB:Q8I467|UniProtKB:Q8ID92|dictyBase:DDB_G0272568|PomBase:SPAC20G4.06c|SGD:S000003973|WB:WBGene00006794|dictyBase:DDB_G0277833|MGI:MGI:101757|MGI:MGI:1929270|TAIR:locus:2156727|RGD:69285|TAIR:locus:2131879 Communication:501741973 2023-06-07 AT3G46000 locus:2077107 AT3G46000 involved in actin filament depolymerization GO:0030042 8888 P other cellular processes IEA none InterPro:IPR017904 AnalysisReference:501756966 2023-06-11 AT3G46000 locus:2077107 AT3G46000 acts upstream of or within actin filament depolymerization GO:0030042 8888 P other cellular processes IDA in vitro assay NONE Publication:501774113|PMID:28123105 xiangyun 2017-04-17 AT3G46010 locus:2077122 AT3G46010 acts upstream of or within actin filament depolymerization GO:0030042 8888 P other cellular processes IDA in vitro assay NONE Publication:501742755|PMID:21570971 TAIR 2011-06-30 AT3G46010 locus:2077122 AT3G46010 acts upstream of or within actin filament depolymerization GO:0030042 8888 P cellular component organization IDA in vitro assay NONE Publication:501774113|PMID:28123105 xiangyun 2017-04-17 AT3G46010 locus:2077122 AT3G46010 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501776792|PMID:28887381 dszymanski 2019-04-04 AT3G46010 locus:2077122 AT3G46010 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501761766|PMID:25293756 dszymanski 2019-04-04 AT3G46010 locus:2077122 AT3G46010 acts upstream of or within actin filament organization GO:0007015 4992 P cellular component organization IMP analysis of visible trait NONE Publication:501680725|PMID:11402164 TAIR 2003-09-29 AT3G46010 gene:2077121 AT3G46010.1 located in cytoplasm GO:0005737 231 C cytoplasm ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46010 locus:2077122 AT3G46010 is active in actin cytoskeleton GO:0015629 99 C cytoskeleton IBA none PANTHER:PTN000227258|UniProtKB:Q8I467|UniProtKB:Q8ID92|dictyBase:DDB_G0272568|PomBase:SPAC20G4.06c|SGD:S000003973|WB:WBGene00006794|dictyBase:DDB_G0277833|MGI:MGI:101757|MGI:MGI:1929270|TAIR:locus:2156727|RGD:69285|TAIR:locus:2131879 Communication:501741973 2023-06-07 AT3G46010 locus:2077122 AT3G46010 acts upstream of or within actin filament organization GO:0007015 4992 P other cellular processes IMP analysis of visible trait NONE Publication:501680725|PMID:11402164 TAIR 2003-09-29 AT3G46010 gene:4010712685 AT3G46010.2 located in chloroplast GO:0009507 175 C chloroplast ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46010 locus:2077122 AT3G46010 enables actin filament binding GO:0051015 18617 F protein binding IBA none PANTHER:PTN000227258|PomBase:SPAC20G4.06c|TAIR:locus:2059861|UniProtKB:P23528|SGD:S000003973|WB:WBGene00006794|UniProtKB:P60981|MGI:MGI:101763|UniProtKB:P10668|MGI:MGI:1929270|MGI:MGI:101757|RGD:69285 Communication:501741973 2023-06-07 AT3G46010 locus:2077122 AT3G46010 involved in actin filament depolymerization GO:0030042 8888 P cellular component organization IBA none PANTHER:PTN000227258|TAIR:locus:2127073|TAIR:locus:2077107|dictyBase:DDB_G0272568|TAIR:locus:2042546|UniProtKB:P60981|FB:FBgn0011726|SGD:S000003973|WB:WBGene00006794|UniProtKB:P23528|TAIR:locus:2168063|TAIR:locus:2168052|MGI:MGI:101763|dictyBase:DDB_G0277833|UniProtKB:Q39250|TAIR:locus:2156727|MGI:MGI:1929270|MGI:MGI:101757|UniProtKB:Q9Y281|TAIR:locus:2131879|TAIR:locus:2198175 Communication:501741973 2023-06-07 AT3G46010 locus:2077122 AT3G46010 acts upstream of or within actin filament depolymerization GO:0030042 8888 P other cellular processes IDA in vitro assay NONE Publication:501774113|PMID:28123105 xiangyun 2017-04-17 AT3G46010 locus:2077122 AT3G46010 enables protein binding GO:0005515 3877 F protein binding IPI yeast two-hybrid assay AGI_LocusCode:At3G53310 Publication:501789671|PMID:32391591 TAIR 2020-08-04 AT3G46010 locus:2077122 AT3G46010 acts upstream of or within actin filament depolymerization GO:0030042 8888 P cellular component organization IDA in vitro assay NONE Publication:501742755|PMID:21570971 TAIR 2011-06-30 AT3G46010 locus:2077122 AT3G46010 enables actin filament binding GO:0051015 18617 F other binding IBA none PANTHER:PTN000227258|PomBase:SPAC20G4.06c|TAIR:locus:2059861|UniProtKB:P23528|SGD:S000003973|WB:WBGene00006794|UniProtKB:P60981|MGI:MGI:101763|UniProtKB:P10668|MGI:MGI:1929270|MGI:MGI:101757|RGD:69285 Communication:501741973 2023-06-07 AT3G46010 locus:2077122 AT3G46010 involved in actin filament depolymerization GO:0030042 8888 P other cellular processes IBA none PANTHER:PTN000227258|TAIR:locus:2127073|TAIR:locus:2077107|dictyBase:DDB_G0272568|TAIR:locus:2042546|UniProtKB:P60981|FB:FBgn0011726|SGD:S000003973|WB:WBGene00006794|UniProtKB:P23528|TAIR:locus:2168063|TAIR:locus:2168052|MGI:MGI:101763|dictyBase:DDB_G0277833|UniProtKB:Q39250|TAIR:locus:2156727|MGI:MGI:1929270|MGI:MGI:101757|UniProtKB:Q9Y281|TAIR:locus:2131879|TAIR:locus:2198175 Communication:501741973 2023-06-07 AT3G46010 locus:2077122 AT3G46010 is active in cytoplasm GO:0005737 231 C cytoplasm IBA none PANTHER:PTN000227258|PomBase:SPAC20G4.06c|SGD:S000003973|WB:WBGene00006794|UniProtKB:P23528|UniProtKB:Q8I467|UniProtKB:C4LVG4|UniProtKB:Q9Y281|UniProtKB:Q580V7|dictyBase:DDB_G0277833|RGD:69285|MGI:MGI:101757|MGI:MGI:1929270 Communication:501741973 2023-06-07 AT3G46010 locus:2077122 AT3G46010 enables actin binding GO:0003779 1353 F protein binding TAS inferred by author, from structural similarity NONE Publication:5924|PMID:11025548 TAIR 2003-09-29 AT3G46010 locus:2077122 AT3G46010 located in actin cytoskeleton GO:0015629 99 C cytoskeleton IEA none InterPro:IPR017904 AnalysisReference:501756966 2023-06-11 AT3G46020 locus:2077137 AT3G46020 involved in positive regulation of mRNA splicing, via spliceosome GO:0048026 14130 P nucleobase-containing compound metabolic process IBA none PANTHER:PTN000391532|UniProtKB:P62995|MGI:MGI:1933972|RGD:1306751|MGI:MGI:106016 Communication:501741973 2023-06-07 AT3G46020 locus:2077137 AT3G46020 involved in positive regulation of mRNA splicing, via spliceosome GO:0048026 14130 P other metabolic processes IBA none PANTHER:PTN000391532|UniProtKB:P62995|MGI:MGI:1933972|RGD:1306751|MGI:MGI:106016 Communication:501741973 2023-06-07 AT3G46020 locus:2077137 AT3G46020 part of spliceosomal complex GO:0005681 684 C nucleus IBA none PANTHER:PTN000391532|RGD:1306751|UniProtKB:P62995|UniProtKB:P38159 Communication:501741973 2023-06-07 AT3G46020 locus:2077137 AT3G46020 enables RNA binding GO:0003723 1217 F RNA binding IBA none PANTHER:PTN000391532|FB:FBgn0003742|MGI:MGI:97286|UniProtKB:P19338|MGI:MGI:893588|UniProtKB:Q494N5|RGD:1565256|UniProtKB:P0DJD3|RGD:3153|RGD:1306751|UniProtKB:Q14011|UniProtKB:P0DJD4|UniProtKB:P62995|UniProtKB:P38159 Communication:501741973 2023-06-07 AT3G46020 locus:2077137 AT3G46020 involved in positive regulation of mRNA splicing, via spliceosome GO:0048026 14130 P other cellular processes IBA none PANTHER:PTN000391532|UniProtKB:P62995|MGI:MGI:1933972|RGD:1306751|MGI:MGI:106016 Communication:501741973 2023-06-07 AT3G46030 gene:2077151 AT3G46030.1 located in plasmodesma GO:0009506 571 C other cellular components HDA none NONE Publication:501742898|PMID:21533090 maule 2021-04-07 AT3G46030 locus:2077152 AT3G46030 enables DNA binding GO:0003677 961 F DNA binding IBA none PANTHER:PTN000603808|CGD:CAL0000199081|SGD:S000002632 Communication:501741973 2022-11-23 AT3G46030 locus:2077152 AT3G46030 enables structural constituent of chromatin GO:0030527 9869 F structural molecule activity IEA none InterPro:IPR000558 AnalysisReference:501756966 2023-05-23 AT3G46030 locus:2077152 AT3G46030 enables protein heterodimerization activity GO:0046982 15254 F protein binding IEA none InterPro:IPR009072 AnalysisReference:501756966 2023-05-23 AT3G46030 gene:2077151 AT3G46030.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46030 locus:2077152 AT3G46030 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501776792|PMID:28887381 dszymanski 2019-04-04 AT3G46040 locus:2075231 AT3G46040 enables structural constituent of ribosome GO:0003735 4271 F structural molecule activity IBA none PANTHER:PTN000204723|MGI:MGI:2389091|SGD:S000003726|SGD:S000004359|FB:FBgn0010198|SGD:S000004767|UniProtKB:P0A7W7|UniProtKB:P62244 Communication:501741973 2023-06-07 AT3G46040 gene:2075230 AT3G46040.1 located in cytosolic ribosome GO:0022626 29018 C ribosome HDA none NONE Publication:501714926|PMID:15734919 kvanwijk 2021-04-12 AT3G46040 locus:2075231 AT3G46040 involved in translation GO:0006412 6869 P translation IEA none InterPro:IPR000630|InterPro:IPR035987 AnalysisReference:501756966 2023-05-23 AT3G46040 gene:2075230 AT3G46040.1 located in cytosolic ribosome GO:0022626 29018 C cytosol HDA none NONE Publication:501714926|PMID:15734919 kvanwijk 2021-04-12 AT3G46040 locus:2075231 AT3G46040 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501776792|PMID:28887381 dszymanski 2019-04-04 AT3G46040 locus:2075231 AT3G46040 located in cytosolic small ribosomal subunit GO:0022627 29019 C cytosol HDA none NONE Publication:501723363|PMID:17934214 TAIR 2021-04-12 AT3G46040 locus:2075231 AT3G46040 part of cytosolic small ribosomal subunit GO:0022627 29019 C ribosome IBA none PANTHER:PTN000204723|UniProtKB:P62244|RGD:619939|UniProtKB:P0A7W7|SGD:S000003726|MGI:MGI:2389091|SGD:S000004359 Communication:501741973 2023-06-07 AT3G46040 locus:2075231 AT3G46040 part of cytosolic small ribosomal subunit GO:0022627 29019 C cytosol IBA none PANTHER:PTN000204723|UniProtKB:P62244|RGD:619939|UniProtKB:P0A7W7|SGD:S000003726|MGI:MGI:2389091|SGD:S000004359 Communication:501741973 2023-06-07 AT3G46040 gene:2075230 AT3G46040.1 located in chloroplast GO:0009507 175 C chloroplast ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46040 locus:2075231 AT3G46040 acts upstream of or within macromolecule modification GO:0043412 21458 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT3G11100 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46040 locus:2075231 AT3G46040 located in cytosolic small ribosomal subunit GO:0022627 29019 C ribosome HDA none NONE Publication:501723363|PMID:17934214 TAIR 2021-04-12 AT3G46050 locus:2075241 AT3G46050 enables molecular_function GO:0003674 3226 F unknown molecular functions ND none NONE Communication:1345790 TIGR 2004-02-06 AT3G46050 gene:2075240 AT3G46050.1 located in chloroplast GO:0009507 175 C chloroplast ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46050 locus:2075241 AT3G46050 involved in biological_process GO:0008150 5239 P unknown biological processes ND none NONE Communication:1345790 TIGR 2022-02-01 AT3G46060 locus:2075251 AT3G46060 acts upstream of or within abscisic acid-activated signaling pathway involved in stomatal movement GO:1901527 44084 P other cellular processes IMP analysis of visible trait Publication:501793839|PMID:33775364 TAIR 2021-05-06 AT3G46060 locus:2075251 AT3G46060 acts upstream of or within abscisic acid-activated signaling pathway involved in stomatal movement GO:1901527 44084 P signal transduction IMP analysis of visible trait Publication:501793839|PMID:33775364 TAIR 2021-05-06 AT3G46060 locus:2075251 AT3G46060 involved in protein secretion GO:0009306 6901 P other cellular processes IBA none PANTHER:PTN000635132|CGD:CAL0000186445|WB:WBGene00004272|MGI:MGI:97843|FB:FBgn0052670 Communication:501741973 2023-06-07 AT3G46060 locus:2075251 AT3G46060 involved in protein secretion GO:0009306 6901 P transport IBA none PANTHER:PTN000635132|CGD:CAL0000186445|WB:WBGene00004272|MGI:MGI:97843|FB:FBgn0052670 Communication:501741973 2023-06-07 AT3G46060 locus:2075251 AT3G46060 enables protein binding GO:0005515 3877 F protein binding IPI none UniProtKB:Q8LA96 Publication:501743366|PMID:21798944 2023-05-23 AT3G46060 locus:2075251 AT3G46060 involved in vesicle docking involved in exocytosis GO:0006904 6502 P other cellular processes IBA none PANTHER:PTN000635132|UniProtKB:P61006 Communication:501741973 2021-03-31 AT3G46060 gene:2075250 AT3G46060.1 located in plasma membrane GO:0005886 570 C plasma membrane HDA none NONE Publication:501712339|PMID:15060130 kvanwijk 2021-05-10 AT3G46060 locus:2075251 AT3G46060 enables protein binding GO:0005515 3877 F protein binding IPI Bimolecular fluorescence complementation (BiFC) AGI_LocusCode:AT2G38310 Publication:501793839|PMID:33775364 TAIR 2021-08-27 AT3G46060 gene:2075250 AT3G46060.1 located in plant-type vacuole GO:0000325 11545 C vacuole HDA none NONE Publication:501720626|PMID:17151019 kvanwijk 2021-05-12 AT3G46060 locus:2075251 AT3G46060 involved in vesicle docking involved in exocytosis GO:0006904 6502 P transport IBA none PANTHER:PTN000635132|UniProtKB:P61006 Communication:501741973 2021-03-31 AT3G46060 locus:2075251 AT3G46060 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501776792|PMID:28887381 dszymanski 2019-04-04 AT3G46060 locus:2075251 AT3G46060 involved in regulation of exocytosis GO:0017157 9390 P other cellular processes IBA none PANTHER:PTN000635132|MGI:MGI:1914545|MGI:MGI:97844|UniProtKB:O95716|MGI:MGI:97843|MGI:MGI:1917158|RGD:3528|UniProtKB:P20336 Communication:501741973 2023-06-07 AT3G46060 locus:2075251 AT3G46060 enables GTPase activity GO:0003924 1041 F hydrolase activity IBA none PANTHER:PTN000635132|CGD:CAL0000186445|UniProtKB:P61006|SGD:S000001889|UniProtKB:P20336|UniProtKB:Q96E17|FB:FBgn0030391|UniProtKB:P20337 Communication:501741973 2023-06-07 AT3G46060 locus:2075251 AT3G46060 acts upstream of or within ethylene-activated signaling pathway GO:0009873 8852 P signal transduction IEP Correlation of expression with a physiological assay NONE Publication:501705855|PMID:12692329 TAIR 2003-10-30 AT3G46060 locus:2075251 AT3G46060 acts upstream of or within ethylene-activated signaling pathway GO:0009873 8852 P response to chemical IEP Correlation of expression with a physiological assay NONE Publication:501705855|PMID:12692329 TAIR 2003-10-30 AT3G46060 gene:2075250 AT3G46060.1 located in plasma membrane GO:0005886 570 C plasma membrane HDA none NONE Publication:501722708|PMID:17644812 kvanwijk 2021-04-07 AT3G46060 locus:2075251 AT3G46060 is active in intracellular membrane-bounded organelle GO:0043231 19388 C other intracellular components IBA none PANTHER:PTN000635132|RGD:620880|FB:FBgn0005586|UniProtKB:D6XLJ6|UniProtKB:O95716|MGI:MGI:1927232|MGI:MGI:96960|UniProtKB:P20337|UniProtKB:Q92930|SGD:S000001889|FB:FBgn0030391|FB:FBgn0052670|TAIR:locus:2142684|MGI:MGI:1917158|MGI:MGI:97843|dictyBase:DDB_G0280043|UniProtKB:P0C0E4|UniProtKB:Q8WXH6|RGD:620922|WB:WBGene00004272|RGD:620923|MGI:MGI:894284|MGI:MGI:97844|UniProtKB:Q96S21|UniProtKB:P61007|WB:WBGene00004267|UniProtKB:P61006|UniProtKB:Q12829|UniProtKB:P51153|UniProtKB:F1PTE3|RGD:3528|MGI:MGI:1914545|RGD:621144|FB:FBgn0262518|RGD:3527 Communication:501741973 2023-06-07 AT3G46060 gene:4010712686 AT3G46060.2 located in plant-type vacuole GO:0000325 11545 C vacuole HDA none NONE Publication:501720626|PMID:17151019 kvanwijk 2021-05-12 AT3G46060 gene:4515101605 AT3G46060.3 located in plasma membrane GO:0005886 570 C plasma membrane HDA none NONE Publication:501722708|PMID:17644812 kvanwijk 2021-04-07 AT3G46060 locus:2075251 AT3G46060 acts upstream of or within ethylene-activated signaling pathway GO:0009873 8852 P response to endogenous stimulus IEP Correlation of expression with a physiological assay NONE Publication:501705855|PMID:12692329 TAIR 2003-10-30 AT3G46060 locus:2075251 AT3G46060 acts upstream of or within abscisic acid-activated signaling pathway involved in stomatal movement GO:1901527 44084 P response to endogenous stimulus IMP analysis of visible trait Publication:501793839|PMID:33775364 TAIR 2021-05-06 AT3G46060 gene:4515101605 AT3G46060.3 located in plant-type vacuole GO:0000325 11545 C vacuole HDA none NONE Publication:501720626|PMID:17151019 kvanwijk 2021-05-12 AT3G46060 locus:2075251 AT3G46060 involved in regulation of exocytosis GO:0017157 9390 P transport IBA none PANTHER:PTN000635132|MGI:MGI:1914545|MGI:MGI:97844|UniProtKB:O95716|MGI:MGI:97843|MGI:MGI:1917158|RGD:3528|UniProtKB:P20336 Communication:501741973 2023-06-07 AT3G46060 gene:2075250 AT3G46060.1 located in plant-type vacuole GO:0000325 11545 C vacuole HDA none NONE Publication:501714874|PMID:15539469 kvanwijk 2021-05-12 AT3G46060 locus:2075251 AT3G46060 enables protein binding GO:0005515 3877 F protein binding IPI none UniProtKB:Q8L796 Publication:501735470|PMID:19903693 2021-04-01 AT3G46060 locus:2075251 AT3G46060 acts upstream of or within ethylene-activated signaling pathway GO:0009873 8852 P other cellular processes IEP Correlation of expression with a physiological assay NONE Publication:501705855|PMID:12692329 TAIR 2003-10-30 AT3G46060 locus:2075251 AT3G46060 enables GTP binding GO:0005525 1035 F nucleotide binding ISS Sequence similarity (homologue of/most closely related to) NONE Publication:5473|PMID:1748311 TAIR 2006-10-04 AT3G46060 gene:4010712686 AT3G46060.2 located in plasma membrane GO:0005886 570 C plasma membrane HDA none NONE Publication:501722708|PMID:17644812 kvanwijk 2021-04-07 AT3G46060 locus:2075251 AT3G46060 acts upstream of or within abscisic acid-activated signaling pathway involved in stomatal movement GO:1901527 44084 P response to chemical IMP analysis of visible trait Publication:501793839|PMID:33775364 TAIR 2021-05-06 AT3G46060 locus:2075251 AT3G46060 enables GTP binding GO:0005525 1035 F other binding ISS Sequence similarity (homologue of/most closely related to) NONE Publication:5473|PMID:1748311 TAIR 2006-10-04 AT3G46060 locus:2075251 AT3G46060 enables protein binding GO:0005515 3877 F protein binding IPI none UniProtKB:Q8LA96 Publication:501790246|PMID:32612234 2023-05-23 AT3G46070 locus:2075261 AT3G46070 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P other cellular processes TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46070 locus:2075261 AT3G46070 involved in response to chitin GO:0010200 17780 P response to chemical IBA none PANTHER:PTN001980936|TAIR:locus:2168073 Communication:501741973 2021-09-10 AT3G46070 locus:2075261 AT3G46070 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P other metabolic processes TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46070 locus:2075261 AT3G46070 involved in response to stress GO:0006950 7330 P response to stress IBA none PANTHER:PTN001980941|TAIR:locus:2168073|TAIR:locus:2084046|TAIR:locus:2075291 Communication:501741973 2023-06-07 AT3G46070 locus:2075261 AT3G46070 enables DNA-binding transcription factor activity GO:0003700 4449 F DNA-binding transcription factor activity ISS Recognized domains Publication:1345963|PMID:11118137 TAIR 2003-06-06 AT3G46070 locus:2075261 AT3G46070 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P biosynthetic process TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46070 locus:2075261 AT3G46070 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P nucleobase-containing compound metabolic process TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46080 locus:2075276 AT3G46080 acts upstream of or within cellular response to hypoxia GO:0071456 33992 P response to abiotic stimulus HEP none NONE Publication:501786480|PMID:31519798 baileyserr 2019-09-19 AT3G46080 locus:2075276 AT3G46080 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P other cellular processes TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46080 locus:2075276 AT3G46080 involved in response to chitin GO:0010200 17780 P response to chemical IBA none PANTHER:PTN001980936|TAIR:locus:2168073 Communication:501741973 2021-09-10 AT3G46080 locus:2075276 AT3G46080 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P other metabolic processes TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46080 locus:2075276 AT3G46080 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P nucleobase-containing compound metabolic process TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46080 gene:2075275 AT3G46080.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46080 locus:2075276 AT3G46080 acts upstream of or within cellular response to hypoxia GO:0071456 33992 P response to chemical HEP none NONE Publication:501786480|PMID:31519798 baileyserr 2019-09-19 AT3G46080 locus:2075276 AT3G46080 enables DNA-binding transcription factor activity GO:0003700 4449 F DNA-binding transcription factor activity ISS Recognized domains Publication:1345963|PMID:11118137 TAIR 2003-06-06 AT3G46080 locus:2075276 AT3G46080 acts upstream of or within cellular response to hypoxia GO:0071456 33992 P response to stress HEP none NONE Publication:501786480|PMID:31519798 baileyserr 2019-09-19 AT3G46080 locus:2075276 AT3G46080 involved in response to stress GO:0006950 7330 P response to stress IBA none PANTHER:PTN001980941|TAIR:locus:2168073|TAIR:locus:2084046|TAIR:locus:2075291 Communication:501741973 2023-06-07 AT3G46080 locus:2075276 AT3G46080 acts upstream of or within cellular response to hypoxia GO:0071456 33992 P other cellular processes HEP none NONE Publication:501786480|PMID:31519798 baileyserr 2019-09-19 AT3G46080 locus:2075276 AT3G46080 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P biosynthetic process TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46086 locus:4515103206 AT3G46086 enables molecular_function GO:0003674 3226 F unknown molecular functions ND Unknown molecular function Communication:1345790 TAIR 2011-10-26 AT3G46086 locus:4515103206 AT3G46086 involved in biological_process GO:0008150 5239 P unknown biological processes ND Unknown biological process NONE Communication:1345790 TAIR 2022-02-01 AT3G46086 locus:4515103206 AT3G46086 is active in cellular_component GO:0005575 163 C unknown cellular components ND Unknown cellular component NONE Communication:1345790 TAIR 2022-02-01 AT3G46090 gene:2075290 AT3G46090.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46090 locus:2075291 AT3G46090 acts upstream of or within cellular response to hypoxia GO:0071456 33992 P response to abiotic stimulus HEP none NONE Publication:501786480|PMID:31519798 baileyserr 2019-09-19 AT3G46090 locus:2075291 AT3G46090 acts upstream of or within cellular response to hypoxia GO:0071456 33992 P response to chemical HEP none NONE Publication:501786480|PMID:31519798 baileyserr 2019-09-19 AT3G46090 locus:2075291 AT3G46090 involved in negative regulation of growth GO:0045926 12749 P growth IMP none Publication:501711809|PMID:14722088 2021-03-31 AT3G46090 locus:2075291 AT3G46090 acts upstream of or within cellular response to hypoxia GO:0071456 33992 P other cellular processes HEP none NONE Publication:501786480|PMID:31519798 baileyserr 2019-09-19 AT3G46090 locus:2075291 AT3G46090 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P other metabolic processes TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46090 locus:2075291 AT3G46090 involved in response to stress GO:0006950 7330 P response to stress IBA none PANTHER:PTN001980941|TAIR:locus:2168073|TAIR:locus:2084046|TAIR:locus:2075291 Communication:501741973 2023-06-07 AT3G46090 locus:2075291 AT3G46090 enables DNA-binding transcription factor activity GO:0003700 4449 F DNA-binding transcription factor activity ISS Recognized domains Publication:1345963|PMID:11118137 TAIR 2003-06-06 AT3G46090 locus:2075291 AT3G46090 acts upstream of or within cellular response to hypoxia GO:0071456 33992 P response to stress HEP none NONE Publication:501786480|PMID:31519798 baileyserr 2019-09-19 AT3G46090 locus:2075291 AT3G46090 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P other cellular processes TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46090 locus:2075291 AT3G46090 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P biosynthetic process TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46090 locus:2075291 AT3G46090 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P nucleobase-containing compound metabolic process TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46090 locus:2075291 AT3G46090 involved in response to oxidative stress GO:0006979 6625 P response to stress IMP none Publication:501711809|PMID:14722088 2021-03-31 AT3G46090 locus:2075291 AT3G46090 involved in response to chitin GO:0010200 17780 P response to chemical IBA none PANTHER:PTN001980936|TAIR:locus:2168073 Communication:501741973 2021-09-10 AT3G46100 locus:2075306 AT3G46100 acts upstream of or within DNA-templated transcription GO:0006351 7470 P biosynthetic process IEA traceable computational prediction AGI_LocusCode:AT5G03150 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46100 locus:2075306 AT3G46100 acts upstream of or within regulation of gene expression GO:0010468 28541 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT5G03150 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46100 locus:2075306 AT3G46100 acts upstream of or within histidyl-tRNA aminoacylation GO:0006427 6000 P nucleobase-containing compound metabolic process ISS Sequence similarity (homologue of/most closely related to) NONE Publication:2300|PMID:9684861 TAIR 2004-05-12 AT3G46100 locus:2075306 AT3G46100 involved in histidyl-tRNA aminoacylation GO:0006427 6000 P other metabolic processes IBA none PANTHER:PTN000159104|UniProtKB:P60906 Communication:501741973 2021-03-31 AT3G46100 locus:2075306 AT3G46100 enables histidine-tRNA ligase activity GO:0004821 2718 F catalytic activity ISS Sequence similarity (homologue of/most closely related to) Publication:2300|PMID:9684861 TAIR 2004-05-12 AT3G46100 locus:2075306 AT3G46100 involved in histidyl-tRNA aminoacylation GO:0006427 6000 P nucleobase-containing compound metabolic process IBA none PANTHER:PTN000159104|UniProtKB:P60906 Communication:501741973 2021-03-31 AT3G46100 locus:2075306 AT3G46100 acts upstream of or within histidyl-tRNA aminoacylation GO:0006427 6000 P other metabolic processes ISS Sequence similarity (homologue of/most closely related to) NONE Publication:2300|PMID:9684861 TAIR 2004-05-12 AT3G46100 locus:2075306 AT3G46100 acts upstream of or within DNA-templated transcription GO:0006351 7470 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT5G03150 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46100 gene:2075305 AT3G46100.1 located in chloroplast GO:0009507 175 C chloroplast ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46100 locus:2075306 AT3G46100 located in mitochondrion GO:0005739 486 C mitochondrion IDA localization of GFP/YFP fusion protein Publication:501717830|PMID:16251277 TAIR 2005-11-17 AT3G46100 locus:2075306 AT3G46100 acts upstream of or within histidyl-tRNA aminoacylation GO:0006427 6000 P other cellular processes ISS Sequence similarity (homologue of/most closely related to) NONE Publication:2300|PMID:9684861 TAIR 2004-05-12 AT3G46100 locus:2075306 AT3G46100 acts upstream of or within DNA-templated transcription GO:0006351 7470 P nucleobase-containing compound metabolic process IEA traceable computational prediction AGI_LocusCode:AT5G03150 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46100 locus:2075306 AT3G46100 located in chloroplast GO:0009507 175 C chloroplast IDA localization of GFP/YFP fusion protein Publication:501717830|PMID:16251277 TAIR 2005-11-17 AT3G46100 locus:2075306 AT3G46100 located in mitochondrion GO:0005739 486 C mitochondrion IDA localization of GFP/YFP fusion protein Publication:2300|PMID:9684861 TAIR 2004-05-12 AT3G46100 locus:2075306 AT3G46100 acts upstream of or within histidyl-tRNA aminoacylation GO:0006427 6000 P translation ISS Sequence similarity (homologue of/most closely related to) NONE Publication:2300|PMID:9684861 TAIR 2004-05-12 AT3G46100 gene:2075305 AT3G46100.1 located in chloroplast GO:0009507 175 C chloroplast HDA none NONE Publication:501724486|PMID:18431481 kvanwijk 2021-04-07 AT3G46100 locus:2075306 AT3G46100 enables histidine-tRNA ligase activity GO:0004821 2718 F catalytic activity IBA none PANTHER:PTN000159104|UniProtKB:P60906 Communication:501741973 2021-04-01 AT3G46100 locus:2075306 AT3G46100 located in chloroplast GO:0009507 175 C chloroplast IDA localization of GFP/YFP fusion protein Publication:2300|PMID:9684861 TAIR 2004-05-12 AT3G46100 locus:2075306 AT3G46100 involved in histidyl-tRNA aminoacylation GO:0006427 6000 P other cellular processes IBA none PANTHER:PTN000159104|UniProtKB:P60906 Communication:501741973 2021-03-31 AT3G46100 locus:2075306 AT3G46100 acts upstream of or within DNA-templated transcription GO:0006351 7470 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT5G03150 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46100 locus:2075306 AT3G46100 involved in histidyl-tRNA aminoacylation GO:0006427 6000 P translation IBA none PANTHER:PTN000159104|UniProtKB:P60906 Communication:501741973 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in response to osmotic stress GO:0006970 6618 P response to abiotic stimulus IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of auxin biosynthetic process GO:0010600 29507 P other cellular processes IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in inflorescence development GO:0010229 19795 P multicellular organism development IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of auxin mediated signaling pathway GO:0010928 31699 P response to endogenous stimulus IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of cell division GO:0051302 20665 P other cellular processes IMP none Publication:501783868|PMID:30737509 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of auxin mediated signaling pathway GO:0010928 31699 P other cellular processes IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of root morphogenesis GO:2000067 35736 P multicellular organism development IMP none Publication:501783868|PMID:30737509 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in specification of plant organ axis polarity GO:0090708 52939 P anatomical structure development IMP none Publication:501783868|PMID:30737509 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of auxin mediated signaling pathway GO:0010928 31699 P cell communication IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of auxin biosynthetic process GO:0010600 29507 P other metabolic processes IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 gene:2075330 AT3G46110.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of leaf development GO:2000024 35572 P anatomical structure development IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in plant organ morphogenesis GO:1905392 52613 P anatomical structure development IMP none Publication:501783868|PMID:30737509 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in response to osmotic stress GO:0006970 6618 P response to stress IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in inflorescence development GO:0010229 19795 P anatomical structure development IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 enables protein binding GO:0005515 3877 F protein binding IPI none UniProtKB:O23702 Publication:501788223|PMID:32004461 2021-04-01 AT3G46110 locus:2075331 AT3G46110 involved in plant organ morphogenesis GO:1905392 52613 P multicellular organism development IMP none Publication:501783868|PMID:30737509 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in response to salt GO:1902074 45327 P response to chemical IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of auxin mediated signaling pathway GO:0010928 31699 P response to chemical IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 gene:6532557607 AT3G46110.3 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of leaf development GO:2000024 35572 P multicellular organism development IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 gene:1006228427 AT3G46110.2 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of root morphogenesis GO:2000067 35736 P anatomical structure development IMP none Publication:501783868|PMID:30737509 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of auxin biosynthetic process GO:0010600 29507 P biosynthetic process IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in inflorescence development GO:0010229 19795 P reproduction IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in regulation of auxin mediated signaling pathway GO:0010928 31699 P signal transduction IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in inflorescence development GO:0010229 19795 P post-embryonic development IMP none Publication:501785578|PMID:31207460 2021-03-31 AT3G46110 locus:2075331 AT3G46110 involved in specification of plant organ axis polarity GO:0090708 52939 P multicellular organism development IMP none Publication:501783868|PMID:30737509 2021-03-31 AT3G46110 locus:2075331 AT3G46110 enables protein homodimerization activity GO:0042803 15211 F protein binding ISS none UniProtKB:Q9LX14 Communication:501789215 2021-04-01 AT3G46120 locus:2075341 AT3G46120 acts upstream of or within dephosphorylation GO:0016311 5574 P other cellular processes ISS none Publication:501717843|PMID:16244908 2021-04-01 AT3G46120 locus:2075341 AT3G46120 acts upstream of or within dephosphorylation GO:0016311 5574 P other metabolic processes ISS none Publication:501717843|PMID:16244908 2021-04-01 AT3G46120 gene:2075340 AT3G46120.1 located in extracellular region GO:0005576 294 C extracellular region ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46120 locus:2075341 AT3G46120 enables acid phosphatase activity GO:0003993 1343 F hydrolase activity ISS Sequence similarity (homologue of/most closely related to) Publication:501717843|PMID:16244908 TAIR 2005-12-07 AT3G46130 locus:2075236 AT3G46130 enables transcription cis-regulatory region binding GO:0000976 35767 F DNA binding IPI yeast one-hybrid assay AGI_LocusCode:AT2G39840 Publication:501786139|PMID:30356219 sibrady 2020-12-18 AT3G46130 locus:2075236 AT3G46130 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P other cellular processes TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46130 locus:2075236 AT3G46130 enables sequence-specific DNA binding GO:0043565 22416 F DNA binding IEA none InterPro:IPR044676 AnalysisReference:501756966 2023-06-11 AT3G46130 locus:2075236 AT3G46130 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P nucleobase-containing compound metabolic process TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46130 locus:2075236 AT3G46130 involved in regulation of DNA-templated transcription GO:0006355 7461 P nucleobase-containing compound metabolic process IBA none PANTHER:PTN002903678|TAIR:locus:2065226|TAIR:locus:2199357|TAIR:locus:2089812|TAIR:locus:2140847|TAIR:locus:2087183|UniProtKB:Q10MB4 Communication:501741973 2023-06-07 AT3G46130 locus:2075236 AT3G46130 enables sequence-specific DNA binding GO:0043565 22416 F DNA binding IBA none PANTHER:PTN002903678|TAIR:locus:2065226|TAIR:locus:2075236|TAIR:locus:2157844|TAIR:locus:2202633|TAIR:locus:2084168|TAIR:locus:2174324|TAIR:locus:2087183|TAIR:locus:2084269 Communication:501741973 2023-06-07 AT3G46130 locus:2075236 AT3G46130 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P other metabolic processes TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46130 locus:2075236 AT3G46130 involved in regulation of DNA-templated transcription GO:0006355 7461 P other metabolic processes IEA none InterPro:IPR044676 AnalysisReference:501756966 2023-06-11 AT3G46130 locus:2075236 AT3G46130 involved in regulation of DNA-templated transcription GO:0006355 7461 P other cellular processes IBA none PANTHER:PTN002903678|TAIR:locus:2065226|TAIR:locus:2199357|TAIR:locus:2089812|TAIR:locus:2140847|TAIR:locus:2087183|UniProtKB:Q10MB4 Communication:501741973 2023-06-07 AT3G46130 locus:2075236 AT3G46130 acts upstream of or within regulation of DNA-templated transcription GO:0006355 7461 P biosynthetic process TAS inferred by author, from sequence similarity NONE Publication:1345963|PMID:11118137 TAIR 2011-03-18 AT3G46130 locus:2075236 AT3G46130 involved in regulation of DNA-templated transcription GO:0006355 7461 P other cellular processes IEA none InterPro:IPR044676 AnalysisReference:501756966 2023-06-11 AT3G46130 locus:2075236 AT3G46130 involved in regulation of DNA-templated transcription GO:0006355 7461 P other metabolic processes IBA none PANTHER:PTN002903678|TAIR:locus:2065226|TAIR:locus:2199357|TAIR:locus:2089812|TAIR:locus:2140847|TAIR:locus:2087183|UniProtKB:Q10MB4 Communication:501741973 2023-06-07 AT3G46130 locus:2075236 AT3G46130 involved in regulation of DNA-templated transcription GO:0006355 7461 P biosynthetic process IEA none InterPro:IPR044676 AnalysisReference:501756966 2023-06-11 AT3G46130 locus:2075236 AT3G46130 located in cytosol GO:0005829 241 C cytosol HDA none Publication:501761766|PMID:25293756 dszymanski 2019-04-04 AT3G46130 gene:2075235 AT3G46130.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46130 locus:2075236 AT3G46130 is active in nucleus GO:0005634 537 C nucleus IBA none PANTHER:PTN002903678|TAIR:locus:2174324|TAIR:locus:2199357|TAIR:locus:2075236|UniProtKB:Q10MB4|TAIR:locus:2084269|TAIR:locus:2087183 Communication:501741973 2023-06-07 AT3G46130 locus:2075236 AT3G46130 involved in regulation of DNA-templated transcription GO:0006355 7461 P nucleobase-containing compound metabolic process IEA none InterPro:IPR044676 AnalysisReference:501756966 2023-06-11 AT3G46130 locus:2075236 AT3G46130 located in nucleus GO:0005634 537 C nucleus IDA localization of GFP/YFP fusion protein Publication:501718746|PMID:16531467 TAIR 2009-03-18 AT3G46130 locus:2075236 AT3G46130 enables transcription cis-regulatory region binding GO:0000976 35767 F nucleic acid binding IPI yeast one-hybrid assay AGI_LocusCode:AT2G39840 Publication:501786139|PMID:30356219 sibrady 2020-12-18 AT3G46130 gene:6530297161 AT3G46130.4 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46130 gene:4010712687 AT3G46130.3 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46130 locus:2075236 AT3G46130 enables DNA-binding transcription factor activity GO:0003700 4449 F DNA-binding transcription factor activity IEA none InterPro:IPR044676 AnalysisReference:501756966 2023-06-11 AT3G46130 locus:2075236 AT3G46130 enables DNA-binding transcription factor activity GO:0003700 4449 F DNA-binding transcription factor activity ISS Recognized domains Publication:1345963|PMID:11118137 TAIR 2003-06-06 AT3G46130 locus:2075236 AT3G46130 involved in regulation of DNA-templated transcription GO:0006355 7461 P biosynthetic process IBA none PANTHER:PTN002903678|TAIR:locus:2065226|TAIR:locus:2199357|TAIR:locus:2089812|TAIR:locus:2140847|TAIR:locus:2087183|UniProtKB:Q10MB4 Communication:501741973 2023-06-07 AT3G46130 gene:1009021761 AT3G46130.2 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46140 locus:2075246 AT3G46140 acts upstream of or within phosphorylation GO:0016310 6748 P other cellular processes ISS none Pfam:PF00069 Communication:501714663 2021-04-01 AT3G46140 gene:2075245 AT3G46140.1 located in mitochondrion GO:0005739 486 C mitochondrion ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46140 locus:2075246 AT3G46140 enables protein kinase activity GO:0004672 3889 F transferase activity IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2116417|TAIR:locus:2074835|TAIR:locus:2007337 Communication:501741973 2023-06-07 AT3G46140 locus:2075246 AT3G46140 enables protein kinase activity GO:0004672 3889 F kinase activity IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2116417|TAIR:locus:2074835|TAIR:locus:2007337 Communication:501741973 2023-06-07 AT3G46140 locus:2075246 AT3G46140 enables protein kinase activity GO:0004672 3889 F catalytic activity IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2116417|TAIR:locus:2074835|TAIR:locus:2007337 Communication:501741973 2023-06-07 AT3G46140 locus:2075246 AT3G46140 involved in signal transduction GO:0007165 7243 P signal transduction IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2074835|TAIR:locus:2060246 Communication:501741973 2023-04-13 AT3G46140 locus:2075246 AT3G46140 involved in protein phosphorylation GO:0006468 6897 P other cellular processes IBA none PANTHER:PTN001969686|TAIR:locus:2007337|TAIR:locus:2205523|TAIR:locus:2074835|TAIR:locus:2116417 Communication:501741973 2023-06-07 AT3G46140 locus:2075246 AT3G46140 involved in protein phosphorylation GO:0006468 6897 P other metabolic processes IBA none PANTHER:PTN001969686|TAIR:locus:2007337|TAIR:locus:2205523|TAIR:locus:2074835|TAIR:locus:2116417 Communication:501741973 2023-06-07 AT3G46140 locus:2075246 AT3G46140 acts upstream of or within phosphorylation GO:0016310 6748 P other metabolic processes ISS none Pfam:PF00069 Communication:501714663 2021-04-01 AT3G46150 locus:2075266 AT3G46150 enables molecular_function GO:0003674 3226 F unknown molecular functions ND none NONE Communication:1345790 TIGR 2004-02-06 AT3G46150 locus:2075266 AT3G46150 involved in biological_process GO:0008150 5239 P unknown biological processes ND Unknown biological process NONE Communication:1345790 TAIR 2022-02-01 AT3G46150 locus:2075266 AT3G46150 is active in cellular_component GO:0005575 163 C unknown cellular components ND Unknown cellular component NONE Communication:1345790 TAIR 2022-02-01 AT3G46160 locus:2075281 AT3G46160 enables protein kinase activity GO:0004672 3889 F transferase activity IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2116417|TAIR:locus:2074835|TAIR:locus:2007337 Communication:501741973 2023-06-07 AT3G46160 locus:2075281 AT3G46160 enables protein kinase activity GO:0004672 3889 F kinase activity IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2116417|TAIR:locus:2074835|TAIR:locus:2007337 Communication:501741973 2023-06-07 AT3G46160 locus:2075281 AT3G46160 enables ATP binding GO:0005524 894 F other binding IEA none InterPro:IPR000719 AnalysisReference:501756966 2023-06-11 AT3G46160 locus:2075281 AT3G46160 involved in signal transduction GO:0007165 7243 P signal transduction IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2074835|TAIR:locus:2060246 Communication:501741973 2023-04-13 AT3G46160 locus:2075281 AT3G46160 enables protein kinase activity GO:0004672 3889 F catalytic activity IBA none PANTHER:PTN001969686|TAIR:locus:2205523|TAIR:locus:2116417|TAIR:locus:2074835|TAIR:locus:2007337 Communication:501741973 2023-06-07 AT3G46160 locus:2075281 AT3G46160 acts upstream of or within phosphorylation GO:0016310 6748 P other metabolic processes ISS none Pfam:PF00069 Communication:501714663 2021-04-01 AT3G46160 locus:2075281 AT3G46160 involved in protein phosphorylation GO:0006468 6897 P other cellular processes IBA none PANTHER:PTN001969686|TAIR:locus:2007337|TAIR:locus:2205523|TAIR:locus:2074835|TAIR:locus:2116417 Communication:501741973 2023-06-07 AT3G46160 locus:2075281 AT3G46160 involved in protein phosphorylation GO:0006468 6897 P other metabolic processes IBA none PANTHER:PTN001969686|TAIR:locus:2007337|TAIR:locus:2205523|TAIR:locus:2074835|TAIR:locus:2116417 Communication:501741973 2023-06-07 AT3G46160 locus:2075281 AT3G46160 acts upstream of or within phosphorylation GO:0016310 6748 P other cellular processes ISS none Pfam:PF00069 Communication:501714663 2021-04-01 AT3G46160 locus:2075281 AT3G46160 enables ATP binding GO:0005524 894 F nucleotide binding IEA none InterPro:IPR000719 AnalysisReference:501756966 2023-06-11 AT3G46160 gene:2075280 AT3G46160.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46170 locus:2075296 AT3G46170 is active in cellular_component GO:0005575 163 C unknown cellular components ND Unknown cellular component NONE Communication:1345790 TAIR 2022-02-01 AT3G46170 locus:2075296 AT3G46170 enables oxidoreductase activity GO:0016491 3460 F catalytic activity IEA none InterPro:IPR020904 AnalysisReference:501756966 2023-05-23 AT3G46170 locus:2075296 AT3G46170 acts upstream of or within defense response to other organism GO:0098542 46569 P response to external stimulus IEA traceable computational prediction AGI_LocusCode:AT1G32640 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46170 locus:2075296 AT3G46170 acts upstream of or within defense response to other organism GO:0098542 46569 P response to biotic stimulus IEA traceable computational prediction AGI_LocusCode:AT1G32640 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46170 locus:2075296 AT3G46170 acts upstream of or within defense response to other organism GO:0098542 46569 P response to stress IEA traceable computational prediction AGI_LocusCode:AT1G32640 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46180 locus:2075311 AT3G46180 enables 3-phosphoadenosine 5-phosphosulfate transmembrane transporter activity GO:0046964 15191 F transporter activity IBA none PANTHER:PTN000081360|UniProtKB:Q9VEI3|UniProtKB:Q8TB61|WB:WBGene00004206|MGI:MGI:1921086 Communication:501741973 2023-06-07 AT3G46180 locus:2075311 AT3G46180 involved in transmembrane transport GO:0055085 28452 P transport IEA none InterPro:IPR013657 AnalysisReference:501756966 2023-05-23 AT3G46180 locus:2075311 AT3G46180 involved in transmembrane transport GO:0055085 28452 P other cellular processes IEA none InterPro:IPR013657 AnalysisReference:501756966 2023-05-23 AT3G46180 gene:6532554905 AT3G46180.2 located in plasma membrane GO:0005886 570 C plasma membrane ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46180 locus:2075311 AT3G46180 enables galactose transmembrane transporter activity GO:0005354 2417 F transporter activity ISS Sequence similarity (homologue of/most closely related to) Communication:1674994 TAIR 2003-03-29 AT3G46190 locus:2075321 AT3G46190 acts upstream of or within organic cyclic compound biosynthetic process GO:1901362 43684 P biosynthetic process IEA traceable computational prediction AGI_LocusCode:AT4G27410 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46190 locus:2075321 AT3G46190 acts upstream of or within organic cyclic compound biosynthetic process GO:1901362 43684 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT4G27410 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46190 locus:2075321 AT3G46190 acts upstream of or within aromatic compound biosynthetic process GO:0019438 10128 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT4G27410 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46190 locus:2075321 AT3G46190 acts upstream of or within response to lipid GO:0033993 28865 P response to chemical IEA traceable computational prediction AGI_LocusCode:AT4G27410 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46190 gene:6532551618 AT3G46190.2 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46190 locus:2075321 AT3G46190 acts upstream of or within aromatic compound biosynthetic process GO:0019438 10128 P biosynthetic process IEA traceable computational prediction AGI_LocusCode:AT4G27410 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46190 locus:2075321 AT3G46190 acts upstream of or within secondary metabolic process GO:0019748 10327 P secondary metabolic process IEA traceable computational prediction AGI_LocusCode:AT5G63790 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46190 gene:2075320 AT3G46190.1 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46190 locus:2075321 AT3G46190 enables molecular_function GO:0003674 3226 F unknown molecular functions ND none NONE Communication:1345790 TIGR 2003-09-06 AT3G46190 locus:2075321 AT3G46190 acts upstream of or within oxoacid metabolic process GO:0043436 21524 P other metabolic processes IEA traceable computational prediction AGI_LocusCode:AT5G63790 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46190 locus:2075321 AT3G46190 acts upstream of or within oxoacid metabolic process GO:0043436 21524 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT5G63790 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46190 locus:2075321 AT3G46190 acts upstream of or within aromatic compound biosynthetic process GO:0019438 10128 P other cellular processes IEA traceable computational prediction AGI_LocusCode:AT4G27410 Publication:501796011|PMID:34562334 klaasvdp 2022-11-14 AT3G46200 gene:6532552774 AT3G46200.6 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46200 gene:6532552776 AT3G46200.5 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46200 gene:6532552775 AT3G46200.4 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46200 locus:2075336 AT3G46200 acts upstream of or within cellular response to ammonium ion GO:0071242 33670 P response to chemical IMP biochemical/chemical analysis NONE Publication:501764619|PMID:26049160 TAIR 2015-07-17 AT3G46200 locus:2075336 AT3G46200 enables GDP-mannose hydrolase activity GO:0052751 39013 F hydrolase activity IBA none PANTHER:PTN001274688|TAIR:locus:2075336 Communication:501741973 2021-04-02 AT3G46200 locus:2075336 AT3G46200 acts upstream of or within cellular response to ammonium ion GO:0071242 33670 P other cellular processes IMP biochemical/chemical analysis NONE Publication:501764619|PMID:26049160 TAIR 2015-07-17 AT3G46200 gene:6532552771 AT3G46200.2 located in nucleus GO:0005634 537 C nucleus ISM predicted protein features AnalysisReference:501780126 rkaundal 2018-08-31 AT3G46200 locus:2075336 AT3G46200 enables GDP-mannose hydrolase activity GO:0052751 39013 F hydrolase activity IDA Enzyme assays Publication:501764619|PMID:26049160 TAIR 2015-07-17 AT3G46200 gene:2075335 AT3G46200.1 located in cytosol GO:0005829 241 C cytosol ISM predicted protein features Publication:501716296|PMID:15878881 TAIR 2018-03-22 AT3G46210 locus:2075351 AT3G46210 involved in polyadenylation-dependent snoRNA 3-end processing

Literature:

Prevalent cytidylation and uridylation of precursor miRNAs in Arabidopsis. DOI: 10.1038/s41477-019-0562-1 ; PMID: 31792392

Sequences:

cDNA Sequence

>AT3G45760.2
CTCGGTTCTCCATATCCCAATATTGTTTGATCTCATCCTAAGTACTCTATAACTCCCTTAGATCTTAGTTTGATAAAAAAAAAAAATAGGTTTAATAGCTCTGCTTGAGAGGTACTATGGACTTTCGAAAAAATCAAGCTGGGGAAAAGAATGTTTCGAGTAAAGGGATTCAAAAGAAAGTGAAGAACACTATGTCCATAGCATCTAAGAGATATAACATTGATAGTTATATCTTACTAGACCTTGATAAGGTATTAGATGATGCCTACAGCTCTTTTCGACCGGTTTCTGCTGATTACAATACTAGGAAGGAATTGGTCAAAAACCTCAATGCTATGGCTATAGATATTTTTGGTAAATCAGAAGAGAGCAGCCCGGTCCTTGAGGCGTATGGCTCTTTTGCGATGAATACGTTTTCCTCACAAAAGGATTTGGATGTATCTATTAACTTTAGTAGCGGAACATCTGAATTTTATCGTGAAAAGAAGCTAGAAATTCTTACAAGATTTGCAACGAAGCTCCGCTCTTTGGAGGGGCAAGGGTTTGTCAGGAATGTTGTACCTATCTTAAGTGCTAGGGTTCCAATTGTCAGATTCTGTGATCAAGGGACTGGTATCGAATGTGATTTGACAGTTGAAAGCAAAGACGGCATTTTAACTTCACAGATCATTCGGATTATATCTCAAATTGATGATAGGTTTCAGAAACTTTGTTTGTTGCACTGTCAATTGTTTAGTACTAATGTGAATATTGTCATATGTCAGATTAAGCATTGGGCCAGAGCACATGGGGTTAACAATGCGTCACACAATACCCTGAATTCGATATCTATAACAATGCTAGTCGCTCATCATTTACAGACTCAAAGTCCTCCAATTTTACCTCCATTCTCTACACTATTTAAAGATGGAATCGATCCTCCTATCGTGGAGAAAAGAACACAAAAGTTCTTAAACTGGGGACAACGTAATCAAGAATCTCTTGGTAGACTGTTTGCAACTTTTTTTATTAAGGTTGAGGATTTTACAGACGTGGCTAGAAATTTTGCAAGGGTTTTTAGTGACTACGGAGCCGAAAAGATATACAGCTCCATAAACAGAACAGTAGATGATATATTGGAGTTCCTCAATGGCAAGGTTGCTGGAGAACATCTCACACAAAAGTTGTTTAGCCAACAAACTGTTGTGGAGCCTATTCCTCCTGTGTCGCCACAACAACCTCATAAGAAAAGAGTCTGCTTGGAAAAGGGATACAGAGCTGTAGGAGGGATCAGTCACGGAAGAGAGGAGACTCATGAAACTTCTAGAGGAAAACGAAAAAGGTCTGGTGGAAACTGGGGCTGTAGGTTTAGTGGTGGTGAAGAACCAATGCCTGTGGGTCTGTGGAATGAGTACAGTCGAAGTCTTGATATGCCAACACCACCACCACATTATGATAAACTTCTTTATAAGAAGTATTAGAGGTCAGATGTTAATGATTCGATTAATACAAAAGATTGATTTTGAGTTTTGACTATCAAAGTAACAGAAAAGATGCTTGAGTGAGAAATTTACCTTGGAGATTTTTCGTAGGGAGAGAGGGCAGAGTTCCTCTCAAGACTGTTGAACTCATGTGTGGACATTGTAGTGGTGCAAACCGGCACCATCCTCACATTGGTTTAACCAGTCAGAAACCAGAACCACCTTTGATGACTCGCGGTCTACATTCTCAGGTTT
>AT3G45760.1
CTCGGTTCTCCATATCCCAATATTGTTTGATCTCATCCTAAGTACTCTATAACTCCCTTAGATCTTAGTTTGATAAAAAAAAAAAATAGGTTTAATAGCTCTGCTTGAGAGGTACTATGGACTTTCGAAAAAATCAAGCTGGGGAAAAGAATGTTTCGAGTAAAGGGATTCAAAAGAAAGTGAAGAACACTATGTCCATAGCATCTAAGAGATATAACATTGATAGTTATATCTTACTAGACCTTGATAAGGTATTAGATGATGCCTACAGCTCTTTTCGACCGGTTTCTGCTGATTACAATACTAGGAAGGAATTGGTCAAAAACCTCAATGCTATGGCTATAGATATTTTTGGTAAATCAGAAGAGAGCAGCCCGGTCCTTGAGGCGTATGGCTCTTTTGCGATGAATACGTTTTCCTCACAAAAGGATTTGGATGTATCTATTAACTTTAGTAGCGGAACATCTGAATTTTATCGTGAAAAGAAGCTAGAAATTCTTACAAGATTTGCAACGAAGCTCCGCTCTTTGGAGGGGCAAGGGTTTGTCAGGAATGTTGTACCTATCTTAAGTGCTAGGGTTCCAATTGTCAGATTCTGTGATCAAGGGACTGGTATCGAATGTGATTTGACAGTTGAAAGCAAAGACGGCATTTTAACTTCACAGATCATTCGGATTATATCTCAAATTGATGATAGGTTTCAGAAACTTTGTTTGTTGCACTGTCAATTGTTTAGTACTAATGTGAATATTGTCATATGTCAGATTAAGCATTGGGCCAGAGCACATGGGGTTAACAATGCGTCACACAATACCCTGAATTCGATATCTATAACAATGCTAGTCGCTCATCATTTACAGACTCAAAGTCCTCCAATTTTACCTCCATTCTCTACACTATTTAAAGATGGAATCGATCCTCCTATCGTGGAGAAAAGAACACAAAAGTTCTTAAACTGGGGACAACGTAATCAAGAATCTCTTGGTAGACTGTTTGCAACTTTTTTTATTAAGGTTGAGGATTTTACAGACGTGGCTAGAAATTTTGCAAGGGTTTTTAGTGACTACGGAGCCGAAAAGATATACAGCTCCATAAACAGAACAGTAGATGATATATTGGAGTTCCTCAATGGCAAGGTTGCTGGAGAACATCTCACACAAAAGTTGTTTAGCCAACAAACTGTTGTGGAGCCTATTCCTCCTGTGTCGCCACAACAACCTCATAAGAAAAGAGTCTGCTTGGAAAAGGGATACAGAGCTGTAGGAGGGATCAGTCACGGAAGAGAGGAGACTCATGAAACTTCTAGAGGAAAACGAAAAAGGTCTGGTGGAAACTGGGGCTGTAGGTTTAGTGGTGGTGAAGAACCAATGCCTGTGGGTCTGTGGAATGAGTACAGTCGAAGTCTTGATATGCCAACACCACCACCACATTATGATAAACTTCTTTATAAGAAGTATTAGAGGTCAGATGTTAATGATTCGATTAATACAAAAGATTGATTTTGAGTTTTGACTATCAAAGTAACAGAAAAGATGCTTGAGTGAGAAATTTACCTTGGAGATTTTTCGTAGGGAGAGAGGGCAGAGTTCCTCTCAAGACTGTTGAACTCATGTGTGGACATTGTAGTGGTGCAAACCGGCACCATCCTCACATTGGTTTAACCAGTCAGAAACCAGAACCACCTTTGATGACTCGCGGTCTACATTCTCAGGTTT

CDS Sequence

>AT3G45760.2
ATGGACTTTCGAAAAAATCAAGCTGGGGAAAAGAATGTTTCGAGTAAAGGGATTCAAAAGAAAGTGAAGAACACTATGTCCATAGCATCTAAGAGATATAACATTGATAGTTATATCTTACTAGACCTTGATAAGGTATTAGATGATGCCTACAGCTCTTTTCGACCGGTTTCTGCTGATTACAATACTAGGAAGGAATTGGTCAAAAACCTCAATGCTATGGCTATAGATATTTTTGGTAAATCAGAAGAGAGCAGCCCGGTCCTTGAGGCGTATGGCTCTTTTGCGATGAATACGTTTTCCTCACAAAAGGATTTGGATGTATCTATTAACTTTAGTAGCGGAACATCTGAATTTTATCGTGAAAAGAAGCTAGAAATTCTTACAAGATTTGCAACGAAGCTCCGCTCTTTGGAGGGGCAAGGGTTTGTCAGGAATGTTGTACCTATCTTAAGTGCTAGGGTTCCAATTGTCAGATTCTGTGATCAAGGGACTGGTATCGAATGTGATTTGACAGTTGAAAGCAAAGACGGCATTTTAACTTCACAGATCATTCGGATTATATCTCAAATTGATGATAGGTTTCAGAAACTTTGTTTGTTGCACTGTCAATTGTTTAGTACTAATGTGAATATTGTCATATGTCAGATTAAGCATTGGGCCAGAGCACATGGGGTTAACAATGCGTCACACAATACCCTGAATTCGATATCTATAACAATGCTAGTCGCTCATCATTTACAGACTCAAAGTCCTCCAATTTTACCTCCATTCTCTACACTATTTAAAGATGGAATCGATCCTCCTATCGTGGAGAAAAGAACACAAAAGTTCTTAAACTGGGGACAACGTAATCAAGAATCTCTTGGTAGACTGTTTGCAACTTTTTTTATTAAGGTTGAGGATTTTACAGACGTGGCTAGAAATTTTGCAAGGGTTTTTAGTGACTACGGAGCCGAAAAGATATACAGCTCCATAAACAGAACAGTAGATGATATATTGGAGTTCCTCAATGGCAAGGTTGCTGGAGAACATCTCACACAAAAGTTGTTTAGCCAACAAACTGTTGTGGAGCCTATTCCTCCTGTGTCGCCACAACAACCTCATAAGAAAAGAGTCTGCTTGGAAAAGGGATACAGAGCTGTAGGAGGGATCAGTCACGGAAGAGAGGAGACTCATGAAACTTCTAGAGGAAAACGAAAAAGGTCTGGTGGAAACTGGGGCTGTAGGTTTAGTGGTGGTGAAGAACCAATGCCTGTGGGTCTGTGGAATGAGTACAGTCGAAGTCTTGATATGCCAACACCACCACCACATTATGATAAACTTCTTTATAAGAAGTATTAG
>AT3G45760.1
ATGGACTTTCGAAAAAATCAAGCTGGGGAAAAGAATGTTTCGAGTAAAGGGATTCAAAAGAAAGTGAAGAACACTATGTCCATAGCATCTAAGAGATATAACATTGATAGTTATATCTTACTAGACCTTGATAAGGTATTAGATGATGCCTACAGCTCTTTTCGACCGGTTTCTGCTGATTACAATACTAGGAAGGAATTGGTCAAAAACCTCAATGCTATGGCTATAGATATTTTTGGTAAATCAGAAGAGAGCAGCCCGGTCCTTGAGGCGTATGGCTCTTTTGCGATGAATACGTTTTCCTCACAAAAGGATTTGGATGTATCTATTAACTTTAGTAGCGGAACATCTGAATTTTATCGTGAAAAGAAGCTAGAAATTCTTACAAGATTTGCAACGAAGCTCCGCTCTTTGGAGGGGCAAGGGTTTGTCAGGAATGTTGTACCTATCTTAAGTGCTAGGGTTCCAATTGTCAGATTCTGTGATCAAGGGACTGGTATCGAATGTGATTTGACAGTTGAAAGCAAAGACGGCATTTTAACTTCACAGATCATTCGGATTATATCTCAAATTGATGATAGGTTTCAGAAACTTTGTTTGTTGCACTGTCAATTGTTTAGTACTAATGTGAATATTGTCATATGTCAGATTAAGCATTGGGCCAGAGCACATGGGGTTAACAATGCGTCACACAATACCCTGAATTCGATATCTATAACAATGCTAGTCGCTCATCATTTACAGACTCAAAGTCCTCCAATTTTACCTCCATTCTCTACACTATTTAAAGATGGAATCGATCCTCCTATCGTGGAGAAAAGAACACAAAAGTTCTTAAACTGGGGACAACGTAATCAAGAATCTCTTGGTAGACTGTTTGCAACTTTTTTTATTAAGGTTGAGGATTTTACAGACGTGGCTAGAAATTTTGCAAGGGTTTTTAGTGACTACGGAGCCGAAAAGATATACAGCTCCATAAACAGAACAGTAGATGATATATTGGAGTTCCTCAATGGCAAGGTTGCTGGAGAACATCTCACACAAAAGTTGTTTAGCCAACAAACTGTTGTGGAGCCTATTCCTCCTGTGTCGCCACAACAACCTCATAAGAAAAGAGTCTGCTTGGAAAAGGGATACAGAGCTGTAGGAGGGATCAGTCACGGAAGAGAGGAGACTCATGAAACTTCTAGAGGAAAACGAAAAAGGTCTGGTGGAAACTGGGGCTGTAGGTTTAGTGGTGGTGAAGAACCAATGCCTGTGGGTCTGTGGAATGAGTACAGTCGAAGTCTTGATATGCCAACACCACCACCACATTATGATAAACTTCTTTATAAGAAGTATTAG

Protein Sequence

>AT3G45760.2
MDFRKNQAGEKNVSSKGIQKKVKNTMSIASKRYNIDSYILLDLDKVLDDAYSSFRPVSADYNTRKELVKNLNAMAIDIFGKSEESSPVLEAYGSFAMNTFSSQKDLDVSINFSSGTSEFYREKKLEILTRFATKLRSLEGQGFVRNVVPILSARVPIVRFCDQGTGIECDLTVESKDGILTSQIIRIISQIDDRFQKLCLLHCQLFSTNVNIVICQIKHWARAHGVNNASHNTLNSISITMLVAHHLQTQSPPILPPFSTLFKDGIDPPIVEKRTQKFLNWGQRNQESLGRLFATFFIKVEDFTDVARNFARVFSDYGAEKIYSSINRTVDDILEFLNGKVAGEHLTQKLFSQQTVVEPIPPVSPQQPHKKRVCLEKGYRAVGGISHGREETHETSRGKRKRSGGNWGCRFSGGEEPMPVGLWNEYSRSLDMPTPPPHYDKLLYKKY
>AT3G45760.1
MDFRKNQAGEKNVSSKGIQKKVKNTMSIASKRYNIDSYILLDLDKVLDDAYSSFRPVSADYNTRKELVKNLNAMAIDIFGKSEESSPVLEAYGSFAMNTFSSQKDLDVSINFSSGTSEFYREKKLEILTRFATKLRSLEGQGFVRNVVPILSARVPIVRFCDQGTGIECDLTVESKDGILTSQIIRIISQIDDRFQKLCLLHCQLFSTNVNIVICQIKHWARAHGVNNASHNTLNSISITMLVAHHLQTQSPPILPPFSTLFKDGIDPPIVEKRTQKFLNWGQRNQESLGRLFATFFIKVEDFTDVARNFARVFSDYGAEKIYSSINRTVDDILEFLNGKVAGEHLTQKLFSQQTVVEPIPPVSPQQPHKKRVCLEKGYRAVGGISHGREETHETSRGKRKRSGGNWGCRFSGGEEPMPVGLWNEYSRSLDMPTPPPHYDKLLYKKY