Information report for AT3G45640
Gene Details
|
|
Functional Descriptions
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- CS71691 — No visible phenotype
- mpk3 — Seedlings slightly oversensitive to l-Glu-induced root growth inhibition.
- mpk6-3/mpk3-1 — Female sterile. Integuments undergo early cell division arrest, as a result, the embryo sac becomes constricted and protrudes from the micropyle.
Functional Keywords
Literature and News
- Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants. DOI: 10.1073/pnas.97.6.2940 ; PMID: 10717008
- MAP kinase signalling cascade in Arabidopsis innate immunity. DOI: 10.1038/415977a ; PMID: 11875555
- Characterization of early, chitin-induced gene expression in Arabidopsis. DOI: 10.1094/MPMI.2002.15.9.963 ; PMID: 12236603
- Different protein kinase families are activated by osmotic stresses in Arabidopsis thaliana cell suspensions. Involvement of the MAP kinases AtMPK3 and AtMPK6. DOI: 10.1016/s0014-5793(02)03162-9 ; PMID: 12220631
- Mitogen-activated protein kinase signaling in postgermination arrest of development by abscisic acid. DOI: 10.1073/pnas.242607499 ; PMID: 12434021
- NDP kinase 2 interacts with two oxidative stress-activated MAPKs to regulate cellular redox state and enhances multiple stress tolerance in transgenic plants. DOI: 10.1073/pnas.252641899 ; PMID: 12506203
- Distinct regulation of salinity and genotoxic stress responses by Arabidopsis MAP kinase phosphatase 1. DOI: 10.1093/emboj/cdf646 ; PMID: 12456655
- Mitogen-activated protein kinase cascades in plants: a new nomenclature. DOI: 10.1016/s1360-1385(02)02302-6 ; PMID: 12119167
- Loss-of-function mutations in chitin responsive genes show increased susceptibility to the powdery mildew pathogen Erysiphe cichoracearum. DOI: 10.1104/pp.105.060947 ; PMID: 15923325
- RNA interference-based (RNAi) suppression of AtMPK6, an Arabidopsis mitogen-activated protein kinase, results in hypersensitivity to ozone and misregulation of AtMPK3. DOI: 10.1016/j.envpol.2005.04.017 ; PMID: 15964670
- High throughput identification of potential Arabidopsis mitogen-activated protein kinases substrates. DOI: 10.1074/mcp.M500007-MCP200 ; PMID: 16009969
- The Arabidopsis MAP kinase kinase MKK1 participates in defence responses to the bacterial elicitor flagellin. DOI: 10.1111/j.1365-313X.2006.02888.x ; PMID: 17059410
- A Mitogen-activated protein kinase kinase kinase mediates reactive oxygen species homeostasis in Arabidopsis. DOI: 10.1074/jbc.M605293200 ; PMID: 17043356
- MEKK1 is required for MPK4 activation and regulates tissue-specific and temperature-dependent cell death in Arabidopsis. DOI: 10.1074/jbc.M605319200 ; PMID: 17023433
- MEKK1 is required for flg22-induced MPK4 activation in Arabidopsis plants. DOI: 10.1104/pp.106.091389 ; PMID: 17142480
- Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. DOI: 10.1105/tpc.106.048298 ; PMID: 17259259
- Arabidopsis MAPK phosphatase 2 (MKP2) positively regulates oxidative stress tolerance and inactivates the MPK3 and MPK6 MAPKs. DOI: 10.1074/jbc.M701888200 ; PMID: 17586809
- An Arabidopsis protein phosphorylated in response to microbial elicitation, AtPHOS32, is a substrate of MAP kinases 3 and 6. DOI: 10.1074/jbc.M800735200 ; PMID: 18285339
- Haplo-insufficiency of MPK3 in MPK6 mutant background uncovers a novel function of these two MAPKs in Arabidopsis ovule development. DOI: 10.1105/tpc.108.058032 ; PMID: 18364464
- The wheat mitogen-activated protein kinases TaMPK3 and TaMPK6 are differentially regulated at multiple levels during compatible disease interactions with Mycosphaerella graminicola. DOI: 10.1104/pp.108.119511 ; PMID: 18441220
- A fungal-responsive MAPK cascade regulates phytoalexin biosynthesis in Arabidopsis. DOI: 10.1073/pnas.0711301105 ; PMID: 18378893
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Activation of MAPK kinase 9 induces ethylene and camalexin biosynthesis and enhances sensitivity to salt stress in Arabidopsis. DOI: 10.1074/jbc.M801392200 ; PMID: 18693252
- Regulation of floral organ abscission in Arabidopsis thaliana. DOI: 10.1073/pnas.0805539105 ; PMID: 18809915
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Negative regulation of PAMP-triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis. DOI: 10.1016/j.cub.2008.07.085 ; PMID: 18771922
- Mechanical stress induces biotic and abiotic stress responses via a novel cis-element. DOI: 10.1371/journal.pgen.0030172 ; PMID: 17953483
- Arabidopsis stomatal initiation is controlled by MAPK-mediated regulation of the bHLH SPEECHLESS. DOI: 10.1126/science.1162263 ; PMID: 19008449
- Mitogen-activated protein kinase cascades and ethylene: signaling, biosynthesis, or both? DOI: 10.1104/pp.108.132241 ; PMID: 19109412
- Mitogen-activated protein kinases 3 and 6 are required for full priming of stress responses in Arabidopsis thaliana. DOI: 10.1105/tpc.108.062158 ; PMID: 19318610
- A mitogen-activated protein kinase gene, AhMPK3 of peanut: molecular cloning, genomic organization, and heterologous expression conferring resistance against Spodoptera litura in tobacco. DOI: 10.1007/s00438-009-0446-6 ; PMID: 19352711
- Trojan horse strategy in Agrobacterium transformation: abusing MAPK defense signaling. DOI: 10.1126/science.1148110 ; PMID: 17947581
- A Pseudomonas syringae effector inactivates MAPKs to suppress PAMP-induced immunity in plants. DOI: 10.1016/j.chom.2007.03.006 ; PMID: 18005697
- Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling. DOI: 10.1038/nature06543 ; PMID: 18273012
- Ethylene signaling is required for the acceleration of cell death induced by the activation of AtMEK5 in Arabidopsis. DOI: 10.1038/cr.2008.29 ; PMID: 18268539
- Overexpression of wound-responsive RNA-binding proteins induces leaf senescence and hypersensitive-like cell death. DOI: 10.1111/j.1469-8137.2008.02557.x ; PMID: 18705666
- Hypertonic stress increased extracellular ATP levels and the expression of stress-responsive genes in Arabidopsis thaliana seedlings. DOI: 10.1271/bbb.80660 ; PMID: 19502745
- Cell fate transitions during stomatal development. DOI: 10.1002/bies.200800231 ; PMID: 19565615
- The Arabidopsis MAP kinase kinase 7: A crosstalk point between auxin signaling and defense responses? DOI: 10.4161/psb.3.4.5230 ; PMID: 19704652
- Arabidopsis MPK3, a Key Signalling Intermediate in Stomatal Function. DOI: 10.4161/psb.2.4.3896 ; PMID: 19704678
- Suppression of MKK5 reduces ozone-induced signal transmission to both MPK3 and MPK6 and confers increased ozone sensitivity in Arabidopsis thaliana. DOI: 10.4161/psb.4.8.9298 ; PMID: 19820329
- Sometimes new results raise new questions: the question marks between mitogen-activated protein kinase and ethylene signaling. DOI: 10.1073/pnas.0810206106 ; PMID: 19820303
- The missing link?: Arabidopsis SPCH is a MAPK specificity factor that controls entry into the stomatal lineage. DOI: 10.4161/psb.4.5.8296 ; PMID: 19816100
- MAP kinase phosphatase1 and protein tyrosine phosphatase1 are repressors of salicylic acid synthesis and SNC1-mediated responses in Arabidopsis. DOI: 10.1105/tpc.109.067678 ; PMID: 19789277
- Regulation of Arabidopsis early anther development by the mitogen-activated protein kinases, MPK3 and MPK6, and the ERECTA and related receptor-like kinases. DOI: 10.1093/mp/ssn029 ; PMID: 19825569
- Novel and expanded roles for MAPK signaling in Arabidopsis stomatal cell fate revealed by cell type-specific manipulations. DOI: 10.1105/tpc.109.070110 ; PMID: 19897669
- PEPR2 is a second receptor for the Pep1 and Pep2 peptides and contributes to defense responses in Arabidopsis. DOI: 10.1105/tpc.109.068874 ; PMID: 20179141
- Cadmium activates Arabidopsis MPK3 and MPK6 via accumulation of reactive oxygen species. DOI: 10.1016/j.phytochem.2010.01.005 ; PMID: 20116811
- Activation of a mitogen-activated protein kinase pathway in Arabidopsis by chitin. DOI: 10.1111/j.1364-3703.2004.00215.x ; PMID: 20565589
- Mitogen-activated protein kinase 3 and 6 regulate Botrytis cinerea-induced ethylene production in Arabidopsis. DOI: 10.1111/j.1365-313X.2010.04318.x ; PMID: 20659280
- MAPK phosphatase MKP2 mediates disease responses in Arabidopsis and functionally interacts with MPK3 and MPK6. DOI: 10.1111/j.1365-313X.2010.04297.x ; PMID: 20626661
- VIP1 response elements mediate mitogen-activated protein kinase 3-induced stress gene expression. DOI: 10.1073/pnas.0905599106 ; PMID: 19820165
- Ca2+ signaling by plant Arabidopsis thaliana Pep peptides depends on AtPepR1, a receptor with guanylyl cyclase activity, and cGMP-activated Ca2+ channels. DOI: 10.1073/pnas.1000191107 ; PMID: 21088220
- A broad-spectrum, efficient and nontransgenic approach to control plant viruses by application of salicylic acid and jasmonic acid. DOI: 10.1007/s00425-010-1308-5 ; PMID: 21046144
- MAMP-responsive MAPK cascades regulate phytoalexin biosynthesis. DOI: 10.4161/psb.5.12.13982 ; PMID: 21150304
- MAPK phosphatase AP2C3 induces ectopic proliferation of epidermal cells leading to stomata development in Arabidopsis. DOI: 10.1371/journal.pone.0015357 ; PMID: 21203456
- The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases. DOI: 10.1111/j.1742-4658.2011.08033.x ; PMID: 21276203
- Arabidopsis MAP Kinase Phosphatase 1 (AtMKP1) negatively regulates MPK6-mediated PAMP responses and resistance against bacteria. DOI: 10.1111/j.1365-313X.2011.04588.x ; PMID: 21447069
- Phosphorylation of a WRKY transcription factor by two pathogen-responsive MAPKs drives phytoalexin biosynthesis in Arabidopsis. DOI: 10.1105/tpc.111.084996 ; PMID: 21498677
- Autophosphorylation profiling of Arabidopsis protein kinases using the cell-free system. DOI: 10.1016/j.phytochem.2011.02.029 ; PMID: 21477822
- Lipase activity in insect oral secretions mediates defense responses in Arabidopsis. DOI: 10.1104/pp.111.173567 ; PMID: 21546453
- Arabidopsis MAP kinase phosphatase 1 and its target MAP kinases 3 and 6 antagonistically determine UV-B stress tolerance, independent of the UVR8 photoreceptor pathway. DOI: 10.1111/j.1365-313X.2011.04725.x ; PMID: 21790814
- Arabidopsis MKK4 mediates osmotic-stress response via its regulation of MPK3 activity. DOI: 10.1016/j.bbrc.2011.07.064 ; PMID: 21806969
- N-acyl-homoserine lactone confers resistance toward biotrophic and hemibiotrophic pathogens via altered activation of AtMPK6. DOI: 10.1104/pp.111.180604 ; PMID: 21940998
- Ethylene-responsive element-binding factor 5, ERF5, is involved in chitin-induced innate immunity response. DOI: 10.1094/MPMI-06-11-0165 ; PMID: 21936663
- Constitutive expression of MKS1 confers susceptibility to Botrytis cinerea infection independent of PAD3 expression. DOI: 10.4161/psb.6.10.16759 ; PMID: 21900742
- Transient MPK6 activation in response to oxygen deprivation and reoxygenation is mediated by mitochondria and aids seedling survival in Arabidopsis. DOI: 10.1007/s11103-011-9850-5 ; PMID: 22086331
- Activation of the Arabidopsis thaliana mitogen-activated protein kinase MPK11 by the flagellin-derived elicitor peptide, flg22. DOI: 10.1094/MPMI-11-11-0281 ; PMID: 22204645
- A dominant allele of Arabidopsis pectin-binding wall-associated kinase induces a stress response suppressed by MPK6 but not MPK3 mutations. DOI: 10.1093/mp/ssr096 ; PMID: 22155845
- Identification of a C2H2-type zinc finger transcription factor (ZAT10) from Arabidopsis as a substrate of MAP kinase. DOI: 10.1007/s00299-011-1192-x ; PMID: 22134874
- or flagellin-induced resistance against Botrytis cinerea. DOI: 10.1104/pp.111.174003 ; PMID: 21803860
- Determination of primary sequence specificity of Arabidopsis MAPKs MPK3 and MPK6 leads to identification of new substrates. DOI: 10.1042/BJ20111809 ; PMID: 22631074
- Phosphorylation of the transcriptional regulator MYB44 by mitogen activated protein kinase regulates Arabidopsis seed germination. DOI: 10.1016/j.bbrc.2012.06.019 ; PMID: 22704933
- Identification of natural diterpenes that inhibit bacterial wilt disease in tobacco, tomato and Arabidopsis. DOI: 10.1093/pcp/pcs085 ; PMID: 22685082
- MAP Kinase Cascades in Arabidopsis Innate Immunity. DOI: 10.3389/fpls.2012.00169 ; PMID: 22837762
- Dual-level regulation of ACC synthase activity by MPK3/MPK6 cascade and its downstream WRKY transcription factor during ethylene induction in Arabidopsis. DOI: 10.1371/journal.pgen.1002767 ; PMID: 22761583
- MPK11-a fourth elicitor-responsive mitogen-activated protein kinase in Arabidopsis thaliana. DOI: 10.4161/psb.21323 ; PMID: 22899057
- Phosphorylation and stabilization of Arabidopsis MAP kinase phosphatase 1 in response to UV-B stress. DOI: 10.1074/jbc.M112.434654 ; PMID: 23188831
- ATR and MKP1 play distinct roles in response to UV-B stress in Arabidopsis. DOI: 10.1111/tpj.12095 ; PMID: 23237049
- Tight interconnection and multi-level control of Arabidopsis MYB44 in MAPK cascade signalling. DOI: 10.1371/journal.pone.0057547 ; PMID: 23437396
- An abscisic acid-independent oxylipin pathway controls stomatal closure and immune defense in Arabidopsis. DOI: 10.1371/journal.pbio.1001513 ; PMID: 23526882
- Phosphorylation of an ERF transcription factor by Arabidopsis MPK3/MPK6 regulates plant defense gene induction and fungal resistance. DOI: 10.1105/tpc.112.109074 ; PMID: 23524660
- Knockout of AtMKK1 enhances salt tolerance and modifies metabolic activities in Arabidopsis. DOI: 10.4161/psb.24206 ; PMID: 23511202
- Pattern-triggered immunity suppresses programmed cell death triggered by fumonisin b1. DOI: 10.1371/journal.pone.0060769 ; PMID: 23560104
- Putrescine regulating by stress-responsive MAPK cascade contributes to bacterial pathogen defense in Arabidopsis. DOI: 10.1016/j.bbrc.2013.06.080 ; PMID: 23831467
- An extracellular subtilase switch for immune priming in Arabidopsis. DOI: 10.1371/journal.ppat.1003445 ; PMID: 23818851
- Repression of growth regulating factors by the microRNA396 inhibits cell proliferation by UV-B radiation in Arabidopsis leaves. DOI: 10.1105/tpc.113.117473 ; PMID: 24076976
- A chemical genetic approach demonstrates that MPK3/MPK6 activation and NADPH oxidase-mediated oxidative burst are two independent signaling events in plant immunity. DOI: 10.1111/tpj.12382 ; PMID: 24245741
- Dual regulation of gene expression mediated by extended MAPK activation and salicylic acid contributes to robust innate immunity in Arabidopsis thaliana. DOI: 10.1371/journal.pgen.1004015 ; PMID: 24348271
- The heat shock factor A4A confers salt tolerance and is regulated by oxidative stress and the mitogen-activated protein kinases MPK3 and MPK6. DOI: 10.1104/pp.114.237891 ; PMID: 24676858
- Salt-induced subcellular kinase relocation and seedling susceptibility caused by overexpression of Medicago SIMKK in Arabidopsis. DOI: 10.1093/jxb/eru115 ; PMID: 24648569
- Alleviation of salt stress by enterobacter sp. EJ01 in tomato and Arabidopsis is accompanied by up-regulation of conserved salinity responsive factors in plants. DOI: 10.14348/molcells.2014.2239 ; PMID: 24598995
- Selective regulation of the chitin-induced defense response by the Arabidopsis receptor-like cytoplasmic kinase PBL27. DOI: 10.1111/tpj.12535 ; PMID: 24750441
- The Arabidopsis thaliana mitogen-activated protein kinases MPK3 and MPK6 target a subclass of 'VQ-motif'-containing proteins to regulate immune responses. DOI: 10.1111/nph.12817 ; PMID: 24750137
- Two Mitogen-Activated Protein Kinases, MPK3 and MPK6, Are Required for Funicular Guidance of Pollen Tubes in Arabidopsis. DOI: 10.1104/pp.113.231274 ; PMID: 24717717
- Activation of MKK9-MPK3/MPK6 enhances phosphate acquisition in Arabidopsis thaliana. DOI: 10.1111/nph.12872 ; PMID: 24865627
- EDR1 physically interacts with MKK4/MKK5 and negatively regulates a MAP kinase cascade to modulate plant innate immunity. DOI: 10.1371/journal.pgen.1004389 ; PMID: 24830651
- Phosphorylation of a WRKY transcription factor by MAPKs is required for pollen development and function in Arabidopsis. DOI: 10.1371/journal.pgen.1004384 ; PMID: 24830428
- Timing is everything: highly specific and transient expression of a MAP kinase determines auxin-induced leaf venation patterns in Arabidopsis. DOI: 10.1093/mp/ssu080 ; PMID: 25064848
- Arabidopsis LIP5, a positive regulator of multivesicular body biogenesis, is a critical target of pathogen-responsive MAPK cascade in plant basal defense. DOI: 10.1371/journal.ppat.1004243 ; PMID: 25010425
- Functional analysis of Arabidopsis immune-related MAPKs uncovers a role for MPK3 as negative regulator of inducible defences. DOI: 10.1186/gb-2014-15-6-r87 ; PMID: 24980080
- Sclareol induces plant resistance to root-knot nematode partially through ethylene-dependent enhancement of lignin accumulation. DOI: 10.1094/MPMI-10-14-0320-R ; PMID: 25423264
- MicroRNA biogenesis factor DRB1 is a phosphorylation target of mitogen activated protein kinase MPK3 in both rice and Arabidopsis. DOI: 10.1111/febs.13159 ; PMID: 25417716
- Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana. DOI: 10.3389/fpls.2014.00554 ; PMID: 25368622
- MAP kinase phosphatase 1 harbors a novel PTS1 and is targeted to peroxisomes following stress treatments. DOI: 10.1016/j.jplph.2015.03.002 ; PMID: 25817413
- Identification of new members of the MAPK gene family in plants shows diverse conserved domains and novel activation loop variants. DOI: 10.1186/s12864-015-1244-7 ; PMID: 25888265
- NPR1 is Instrumental in Priming for the Enhanced flg22-induced MPK3 and MPK6 Activation. DOI: 10.5423/PPJ.NT.10.2014.0112 ; PMID: 26060439
- Mitogen-activated protein kinase kinase 5 (MKK5)-mediated signalling cascade regulates expression of iron superoxide dismutase gene in Arabidopsis under salinity stress. DOI: 10.1093/jxb/erv305 ; PMID: 26136265
- Multilayered Regulation of Ethylene Induction Plays a Positive Role in Arabidopsis Resistance against Pseudomonas syringae. DOI: 10.1104/pp.15.00659 ; PMID: 26265775
- The state of cell wall pectin monitored by wall associated kinases: A model. DOI: 10.1080/15592324.2015.1035854 ; PMID: 26251881
- A Critical Role of Lyst-Interacting Protein5, a Positive Regulator of Multivesicular Body Biogenesis, in Plant Responses to Heat and Salt Stresses. DOI: 10.1104/pp.15.00518 ; PMID: 26229051
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Mitogen-activated protein kinase kinase kinase (MAPKKK) 4 from rapeseed (Brassica napus L.) is a novel member inducing ROS accumulation and cell death. DOI: 10.1016/j.bbrc.2015.10.063 ; PMID: 26498521
- The polyamine spermine induces the unfolded protein response via the MAPK cascade in Arabidopsis. DOI: 10.3389/fpls.2015.00687 ; PMID: 26442007
- Plant resistance against the parasitic nematode Heterodera schachtii is mediated by MPK3 and MPK6 kinases, which are controlled by the MAPK phosphatase AP2C1 in Arabidopsis. DOI: 10.1093/jxb/erv440 ; PMID: 26438412
- MPK3/MPK6 are involved in iron deficiency-induced ethylene production in Arabidopsis. DOI: 10.3389/fpls.2015.00953 ; PMID: 26579185
- The Innate Immune Signaling System as a Regulator of Disease Resistance and Induced Systemic Resistance Activity Against Verticillium dahliae. DOI: 10.1094/MPMI-11-15-0261-R ; PMID: 26780421
- Regulation of WRKY46 Transcription Factor Function by Mitogen-Activated Protein Kinases in Arabidopsis thaliana. DOI: 10.3389/fpls.2016.00061 ; PMID: 26870073
- Substrate thiophosphorylation by Arabidopsis mitogen-activated protein kinases. DOI: 10.1186/s12870-016-0731-6 ; PMID: 26912131
- Mitogen-activated protein kinase pathways are required for melatonin-mediated defense responses in plants. DOI: 10.1111/jpi.12314 ; PMID: 26927635
- Pathogen-Responsive MPK3 and MPK6 Reprogram the Biosynthesis of Indole Glucosinolates and Their Derivatives in Arabidopsis Immunity. DOI: 10.1105/tpc.15.00871 ; PMID: 27081184
- Bacterial AvrRpt2-Like Cysteine Proteases Block Activation of the Arabidopsis Mitogen-Activated Protein Kinases, MPK4 and MPK11. DOI: 10.1104/pp.16.00336 ; PMID: 27208280
- A double-mutant collection targeting MAP kinase related genes in Arabidopsis for studying genetic interactions. DOI: 10.1111/tpj.13292 ; PMID: 27490954
- Mitogen-Activated Protein Kinase Cascade MKK7-MPK6 Plays Important Roles in Plant Development and Regulates Shoot Branching by Phosphorylating PIN1 in Arabidopsis. DOI: 10.1371/journal.pbio.1002550 ; PMID: 27618482
- Phosphorylation of the Polarity Protein BASL Differentiates Asymmetric Cell Fate through MAPKs and SPCH. DOI: 10.1016/j.cub.2016.08.066 ; PMID: 27746029
- Involvement of YODA and mitogen activated protein kinase 6 in Arabidopsis post-embryogenic root development through auxin up-regulation and cell division plane orientation. DOI: 10.1111/nph.12880 ; PMID: 24923680
- Phytochrome B-mediated activation of lipoxygenase modulates an excess red light-induced defence response in Arabidopsis. DOI: 10.1093/jxb/eru247 ; PMID: 24916071
- Bimolecular fluorescent complementation (BiFC) by MAP kinases and MAPK phosphatases. DOI: 10.1007/978-1-4939-0922-3_12 ; PMID: 24908126
- Immunofluorescent localization of MAPKs and colocalization with microtubules in Arabidopsis seedling whole-mount probes. DOI: 10.1007/978-1-4939-0922-3_9 ; PMID: 24908123
- RNA interference of plant MAPK cascades for functional studies. DOI: 10.1007/978-1-4939-0922-3_8 ; PMID: 24908122
- The Receptor-Like Kinase SIT1 Mediates Salt Sensitivity by Activating MAPK3/6 and Regulating Ethylene Homeostasis in Rice. DOI: 10.1105/tpc.114.125187 ; PMID: 24907341
- Ménage à trois: the complex relationships between mitogen-activated protein kinases, WRKY transcription factors, and VQ-motif-containing proteins. DOI: 10.4161/psb.29519 ; PMID: 25763630
- Nucleoporin-Regulated MAP Kinase Signaling in Immunity to a Necrotrophic Fungal Pathogen. DOI: 10.1104/pp.16.00832 ; PMID: 27591188
- Correction: An Extracellular Subtilase Switch for Immune Priming in Arabidopsis. DOI: 10.1371/journal.ppat.1006003 ; PMID: 27806116
- Mitogen-Activated Protein Kinase Phosphatases Affect UV-B-Induced Stomatal Closure via Controlling NO in Guard Cells. DOI: 10.1104/pp.16.01656 ; PMID: 27837091
- Teaching an old dog new tricks: Suppressing activation of specific mitogen-activated kinases as a potential virulence function of the bacterial AvrRpt2 effector protein. DOI: 10.1080/15592324.2016.1257456 ; PMID: 27830985
- AIK1, A Mitogen-Activated Protein Kinase, Modulates Abscisic Acid Responses through the MKK5-MPK6 Kinase Cascade. DOI: 10.1104/pp.16.01386 ; PMID: 27913741
- Coronatine Inhibits Stomatal Closure through Guard Cell-Specific Inhibition of NADPH Oxidase-Dependent ROS Production. DOI: 10.3389/fpls.2016.01851 ; PMID: 28018388
- Overexpression of oligouridylate binding protein 1b results in ABA hypersensitivity. DOI: 10.1080/15592324.2017.1282591 ; PMID: 28112571
- Mild osmotic stress promotes 4-methoxy indolyl-3-methyl glucosinolate biosynthesis mediated by the MKK9-MPK3/MPK6 cascade in Arabidopsis. DOI: 10.1007/s00299-017-2101-8 ; PMID: 28155113
- Phosphorylation of SPOROCYTELESS/NOZZLE by the MPK3/6 Kinase Is Required for Anther Development. DOI: 10.1104/pp.16.01765 ; PMID: 28209842
- Regulation of Stomatal Immunity by Interdependent Functions of a Pathogen-Responsive MPK3/MPK6 Cascade and Abscisic Acid. DOI: 10.1105/tpc.16.00577 ; PMID: 28254778
- Histone H2B monoubiquitination regulates salt stress-induced microtubule depolymerization in Arabidopsis. DOI: 10.1111/pce.12950 ; PMID: 28337773
- Constitutively Active Arabidopsis MAP Kinase 3 Triggers Defense Responses Involving Salicylic Acid and SUMM2 Resistance Protein. DOI: 10.1104/pp.17.00378 ; PMID: 28400495
- Mitogen-activated protein kinases and calcium-dependent protein kinases are involved in wounding-induced ethylene biosynthesis in Arabidopsis thaliana. DOI: 10.1111/pce.12984 ; PMID: 28543054
- and jasmonate-inducible MAPK phosphatase and its interception by Arabidopsis immunity. DOI: 10.1073/pnas.1702613114 ; PMID: 28652328
- Abscisic acid negatively regulates post-penetration resistance of Arabidopsis to the biotrophic powdery mildew fungus. DOI: 10.1007/s11427-017-9036-2 ; PMID: 28702742
- A novel family of proline/serine-rich proteins, which are phospho-targets of stress-related mitogen-activated protein kinases, differentially regulates growth and pathogen defense in Arabidopsis thaliana. DOI: 10.1007/s11103-017-0641-5 ; PMID: 28755319
- The integration of Gβ and MAPK signaling cascade in zygote development. DOI: 10.1038/s41598-017-08230-4 ; PMID: 28821747
- Activation of ZmMKK10, a maize mitogen-activated protein kinase kinase, induces ethylene-dependent cell death. DOI: 10.1016/j.plantsci.2017.09.012 ; PMID: 28969793
- MAP65-1 is required for the depolymerization and reorganization of cortical microtubules in the response to salt stress in Arabidopsis. DOI: 10.1016/j.plantsci.2017.09.004 ; PMID: 28969791
- Maternal control of embryogenesis by MPK6 and its upstream MKK4/MKK5 in Arabidopsis. DOI: 10.1111/tpj.13737 ; PMID: 29024034
- and MPK6-Mediated ICE1 Phosphorylation Negatively Regulates ICE1 Stability and Freezing Tolerance in Arabidopsis. DOI: 10.1016/j.devcel.2017.09.025 ; PMID: 29056553
- Bacillus cereus AR156 Activates Defense Responses to Pseudomonas syringae pv. tomato in Arabidopsis thaliana Similarly to flg22. DOI: 10.1094/MPMI-10-17-0240-R ; PMID: 29090631
- Quantitative Phosphoproteomic Analysis Reveals Shared and Specific Targets of Arabidopsis Mitogen-Activated Protein Kinases (MAPKs) MPK3, MPK4, and MPK6. DOI: 10.1074/mcp.RA117.000135 ; PMID: 29167316
- MAP kinases associate with high molecular weight multiprotein complexes. DOI: 10.1093/jxb/erx424 ; PMID: 29240956
- Combined (15)N-Labeling and TandemMOAC Quantifies Phosphorylation of MAP Kinase Substrates Downstream of MKK7 in Arabidopsis. DOI: 10.3389/fpls.2017.02050 ; PMID: 29276520
- Mitogen activated protein kinase 6 and MAP kinase phosphatase 1 are involved in the response of Arabidopsis roots to L-glutamate. DOI: 10.1007/s11103-018-0699-8 ; PMID: 29344832
- STRESS INDUCED FACTOR 2, a Leucine-Rich Repeat Kinase Regulates Basal Plant Pathogen Defense. DOI: 10.1104/pp.17.01266 ; PMID: 29463771
- Dissection of MAPK signaling specificity through protein engineering in a developmental context. DOI: 10.1186/s12870-018-1274-9 ; PMID: 29636017
- Active photosynthetic inhibition mediated by MPK3/MPK6 is critical to effector-triggered immunity. DOI: 10.1371/journal.pbio.2004122 ; PMID: 29723186
- and effector-triggered immunity. DOI: 10.1007/s00018-018-2839-3 ; PMID: 29789867
- Antagonistic interactions between two MAP kinase cascades in plant development and immune signaling. DOI: 10.15252/embr.201745324 ; PMID: 29789386
- Receptor-Like Cytoplasmic Kinases Directly Link Diverse Pattern Recognition Receptors to the Activation of Mitogen-Activated Protein Kinase Cascades in Arabidopsis. DOI: 10.1105/tpc.17.00981 ; PMID: 29871986
- Regulation of Plant Microprocessor Function in Shaping microRNA Landscape. DOI: 10.3389/fpls.2018.00753 ; PMID: 29922322
- MAP KINASE PHOSPHATASE1 Controls Cell Fate Transition during Stomatal Development. DOI: 10.1104/pp.18.00475 ; PMID: 30002258
- Underground Azelaic Acid-Conferred Resistance to Pseudomonas syringae in Arabidopsis. DOI: 10.1094/MPMI-07-18-0185-R ; PMID: 30156481
- A MPK3/6-WRKY33-ALD1-Pipecolic Acid Regulatory Loop Contributes to Systemic Acquired Resistance. DOI: 10.1105/tpc.18.00547 ; PMID: 30228125
- CLE9 peptide-induced stomatal closure is mediated by abscisic acid, hydrogen peroxide, and nitric oxide in Arabidopsis thaliana. DOI: 10.1111/pce.13475 ; PMID: 30378140
- A Förster resonance energy transfer sensor for live-cell imaging of mitogen-activated protein kinase activity in Arabidopsis. DOI: 10.1111/tpj.14164 ; PMID: 30444549
- Mitogen-activated protein kinases MPK3 and MPK6 are required for stem cell maintenance in the Arabidopsis shoot apical meristem. DOI: 10.1007/s00299-018-2367-5 ; PMID: 30552452
- Regulation of GDSL Lipase Gene Expression by the MPK3/MPK6 Cascade and Its Downstream WRKY Transcription Factors in Arabidopsis Immunity. DOI: 10.1094/MPMI-06-18-0171-R ; PMID: 30598046
- Regulation of pollen lipid body biogenesis by MAP kinases and downstream WRKY transcription factors in Arabidopsis. DOI: 10.1371/journal.pgen.1007880 ; PMID: 30586356
- Chemical genetic identification of a lectin receptor kinase that transduces immune responses and interferes with abscisic acid signaling. DOI: 10.1111/tpj.14232 ; PMID: 30659683
- Protein and metabolite composition of Arabidopsis stress granules. DOI: 10.1111/nph.15690 ; PMID: 30664249
- MKP1 acts as a key modulator of stomatal development. DOI: 10.1080/15592324.2019.1604017 ; PMID: 30983545
- Function of miR825 and miR825* as Negative Regulators in Bacillus cereus AR156-elicited Systemic Resistance to Botrytis cinerea in Arabidopsis thaliana. DOI: 10.3390/ijms20205032 ; PMID: 31614458
- H2Bub1 Regulates RbohD-Dependent Hydrogen Peroxide Signal Pathway in the Defense Responses to Verticillium dahliae Toxins. DOI: 10.1104/pp.19.00913 ; PMID: 31666300
- Involvement of the eIF2α Kinase GCN2 in UV-B Responses. DOI: 10.3389/fpls.2019.01492 ; PMID: 31850012
- YODA-HSP90 Module Regulates Phosphorylation-Dependent Inactivation of SPEECHLESS to Control Stomatal Development under Acute Heat Stress in Arabidopsis. DOI: 10.1016/j.molp.2020.01.001 ; PMID: 31935463
- Biological impacts of phosphomimic AtMYB75. DOI: 10.1007/s00425-020-03350-0 ; PMID: 32030477
- Involvement of active MKK9-MAPK3/MAPK6 in increasing respiration in salt-treated Arabidopsis callus. DOI: 10.1007/s00709-020-01483-3 ; PMID: 32008084
- Phosphorylation-dependent control of an RNA granule-localized protein that fine-tunes defence gene expression at a post-transcriptional level. DOI: 10.1111/tpj.14573 ; PMID: 31628867
- Pathogen-Associated Molecular Pattern-Triggered Immunity Involves Proteolytic Degradation of Core Nonsense-Mediated mRNA Decay Factors During the Early Defense Response. DOI: 10.1105/tpc.19.00631 ; PMID: 32086363
- The MAPK substrate MASS proteins regulate stomatal development in Arabidopsis. DOI: 10.1371/journal.pgen.1008706 ; PMID: 32240168
- Single-stranded oligodeoxynucleotides induce plant defence in Arabidopsis thaliana. DOI: 10.1093/aob/mcaa061 ; PMID: 32266377
- Wounding and Insect Feeding Trigger Two Independent MAPK Pathways with Distinct Regulation and Kinetics. DOI: 10.1105/tpc.19.00917 ; PMID: 32265268
- Role of MPK4 in pathogen-associated molecular pattern-triggered alternative splicing in Arabidopsis. DOI: 10.1371/journal.ppat.1008401 ; PMID: 32302366
- Differential Phosphorylation of the Transcription Factor WRKY33 by the Protein Kinases CPK5/CPK6 and MPK3/MPK6 Cooperatively Regulates Camalexin Biosynthesis in Arabidopsis. DOI: 10.1105/tpc.19.00971 ; PMID: 32439826
- Induction of γ-aminobutyric acid plays a positive role to Arabidopsis resistance against Pseudomonas syringae. DOI: 10.1111/jipb.12974 ; PMID: 32458527
- Co-regulation of indole glucosinolates and camalexin biosynthesis by CPK5/CPK6 and MPK3/MPK6 signaling pathways. DOI: 10.1111/jipb.12973 ; PMID: 32449805
- A Kinase-Phosphatase-Transcription Factor Module Regulates Adventitious Root Emergence in Arabidopsis Root-Hypocotyl Junctions. DOI: 10.1016/j.molp.2020.06.002 ; PMID: 32534220
- Arabidopsis CPK5 Phosphorylates the Chitin Receptor LYK5 to Regulate Plant Innate Immunity. DOI: 10.3389/fpls.2020.00702 ; PMID: 32595659
- The Arabidopsis Pleiotropic Drug Resistance Transporters PEN3 and PDR12 Mediate Camalexin Secretion for Resistance to Botrytis cinerea. DOI: 10.1105/tpc.19.00239 ; PMID: 31239392
- Secreted Peptide PIP1 Induces Stomatal Closure by Activation of Guard Cell Anion Channels in Arabidopsis. DOI: 10.3389/fpls.2020.01029 ; PMID: 32733520
- Phosphorylation of the CAMTA3 Transcription Factor Triggers Its Destabilization and Nuclear Export. DOI: 10.1104/pp.20.00795 ; PMID: 32769161
- Stigma Receptivity Is Controlled by Functionally Redundant MAPK Pathway Components in Arabidopsis. DOI: 10.1016/j.molp.2020.08.015 ; PMID: 32890733
- Arabidopsis E3 ligase KEG associates with and ubiquitinates MKK4 and MKK5 to regulate plant immunity. DOI: 10.1111/jipb.13007 ; PMID: 32877006
- The YDA-MKK4/MKK5-MPK3/MPK6 Cascade Functions Downstream of the RGF1-RGI Ligand-Receptor Pair in Regulating Mitotic Activity in Root Apical Meristem. DOI: 10.1016/j.molp.2020.09.004 ; PMID: 32916336
- RGF1-RGI1, a Peptide-Receptor Complex, Regulates Arabidopsis Root Meristem Development via a MAPK Signaling Cascade. DOI: 10.1016/j.molp.2020.09.005 ; PMID: 32916335
- AtMPK6-induced phosphorylation of AtERF72 enhances its DNA binding activity and interaction with TGA4/OBF4 in Arabidopsis. DOI: 10.1111/plb.13196 ; PMID: 33073469
- Kinases and protein motifs required for AZI1 plastid localization and trafficking during plant defense induction. DOI: 10.1111/tpj.15137 ; PMID: 33342031
- Chromatin phosphoproteomics unravels a function for AT-hook motif nuclear localized protein AHL13 in PAMP-triggered immunity. DOI: 10.1073/pnas.2004670118 ; PMID: 33419940
- AtPFA-DSP3, an atypical dual-specificity protein tyrosine phosphatase, affects salt stress response by modulating MPK3 and MPK6 activity. DOI: 10.1111/pce.14002 ; PMID: 33464564
- Ethylene-induced stomatal closure is mediated via MKK1/3-MPK3/6 cascade to EIN2 and EIN3. DOI: 10.1111/jipb.13083 ; PMID: 33605510
- Exocyst subunit Exo70B2 is linked to immune signaling and autophagy. DOI: 10.1093/plcell/koaa022 ; PMID: 33630076
- SUMO enables substrate selectivity by mitogen-activated protein kinases to regulate immunity in plants. DOI: 10.1073/pnas.2021351118 ; PMID: 33649235
- Phosphorylation of Serine 114 of the transcription factor ABSCISIC ACID INSENSITIVE 4 is essential for activity. DOI: 10.1016/j.plantsci.2021.110847 ; PMID: 33691973
- A C-terminal fragment of Arabidopsis OXIDATIVE STRESS 2 can play a positive role in salt tolerance. DOI: 10.1016/j.bbrc.2021.03.127 ; PMID: 33836344
- Melatonin Regulates Chloroplast Protein Quality Control via a Mitogen-Activated Protein Kinase Signaling Pathway. DOI: 10.3390/antiox10040511 ; PMID: 33806011
- Cross Inhibition of MPK10 and WRKY10 Participating in the Growth of Endosperm in Arabidopsis thaliana. DOI: 10.3389/fpls.2021.640346 ; PMID: 33897728
- Modulation of polyamine metabolism in Arabidopsis thaliana by salicylic acid. DOI: 10.1111/ppl.13478 ; PMID: 34109645
- Naringenin Induces Pathogen Resistance Against Pseudomonas syringae Through the Activation of NPR1 in Arabidopsis. DOI: 10.3389/fpls.2021.672552 ; PMID: 34093630
- MPK6 Kinase Regulates Plasma Membrane H(+)-ATPase Activity in Cold Acclimation. DOI: 10.3390/ijms22126338 ; PMID: 34199294
- Multiple phosphorylation events of the mitochondrial membrane protein TTM1 regulate cell death during senescence. DOI: 10.1111/tpj.15470 ; PMID: 34409658
- MPK3/6-induced degradation of ARR1/10/12 promotes salt tolerance in Arabidopsis. DOI: 10.15252/embr.202152457 ; PMID: 34402578
- MPK3/MPK6-mediated phosphorylation of ERF72 positively regulates resistance to Botrytis cinerea through directly and indirectly activating the transcription of camalexin biosynthesis enzymes. DOI: 10.1093/jxb/erab415 ; PMID: 34499162
- The kinase CIPK14 functions as a negative regulator of plant immune responses to Pseudomonas syringae in Arabidopsis. DOI: 10.1016/j.plantsci.2021.111017 ; PMID: 34620426
- MKK4/5-MPK3/6 Cascade Regulates Agrobacterium-Mediated Transformation by Modulating Plant Immunity in Arabidopsis. DOI: 10.3389/fpls.2021.731690 ; PMID: 34659297
- and MPK6-mediated VLN3 phosphorylation regulates actin dynamics during stomatal immunity in Arabidopsis. DOI: 10.1038/s41467-021-26827-2 ; PMID: 34753953
- and MPK6-mediated hypoxia signaling in Arabidopsis. DOI: 10.1093/plcell/koab289 ; PMID: 34850198
- AtPFA-DSP5 interacts with MPK3/MPK6 and negatively regulates plant salt responses. DOI: 10.1080/15592324.2021.2000808 ; PMID: 34839796
- Two phylogenetically unrelated peptide-receptor modules jointly regulate lateral root initiation via a partially shared signaling pathway in Arabidopsis thaliana. DOI: 10.1111/nph.17919 ; PMID: 34913488
- MPK3 and MPK6 control salicylic acid signaling by up-regulating NLR receptors and effector-triggered immunity. DOI: 10.1093/jxb/erab544 ; PMID: 35032388
- Dual control of MAPK activities by AP2C1 and MKP1 MAPK phosphatases regulates defence responses in Arabidopsis. DOI: 10.1093/jxb/erac018 ; PMID: 35088853
- S-Nitrosation of Arabidopsis thaliana Protein Tyrosine Phosphatase 1 Prevents Its Irreversible Oxidation by Hydrogen Peroxide. DOI: 10.3389/fpls.2022.807249 ; PMID: 35222471
- Dynamic Phosphorylation of miRNA Biogenesis Factor HYL1 by MPK3 Involving Nuclear-Cytoplasmic Shuttling and Protein Stability in Arabidopsis. DOI: 10.3390/ijms23073787 ; PMID: 35409147
- Ultraviolet-B Radiation Represses Primary Root Elongation by Inhibiting Cell Proliferation in the Meristematic Zone of Arabidopsis Seedlings. DOI: 10.3389/fpls.2022.829336 ; PMID: 35401611
- Dichotomy of the BSL phosphatase signaling spatially regulates MAPK components in stomatal fate determination. DOI: 10.1038/s41467-022-30254-2 ; PMID: 35508457
- Phytocytokine signalling reopens stomata in plant immunity and water loss. DOI: 10.1038/s41586-022-04684-3 ; PMID: 35508659
- Phosphorylation of an ethylene response factor by MPK3/MPK6 mediates negative feedback regulation of pathogen-induced ethylene biosynthesis in Arabidopsis. DOI: 10.1016/j.jgg.2022.04.012 ; PMID: 35562093
- Multilayered synergistic regulation of phytoalexin biosynthesis by ethylene, jasmonate, and MAPK signaling pathways in Arabidopsis. DOI: 10.1093/plcell/koac139 ; PMID: 35543483
- Overlapping functions of YDA and MAPKKK3/MAPKKK5 upstream of MPK3/MPK6 in plant immunity and growth/development. DOI: 10.1111/jipb.13309 ; PMID: 35652263
- Bacterial cyclodipeptides elicit Arabidopsis thaliana immune responses reducing the pathogenic effects of Pseudomonas aeruginosa PAO1 strains on plant development. DOI: 10.1016/j.jplph.2022.153738 ; PMID: 35690030
- CYSTEINE-RICH RECEPTOR-LIKE KINASE5 (CRK5) and CRK22 regulate the response to Verticillium dahliae toxins. DOI: 10.1093/plphys/kiac277 ; PMID: 35674361
- Bacillus amyloliquefaciens PMB05 Increases Resistance to Bacterial Wilt by Activating Mitogen-Activated Protein Kinase and Reactive Oxygen Species Pathway Crosstalk in Arabidopsis thaliana. DOI: 10.1094/PHYTO-04-22-0134-R ; PMID: 35793151
- ERECTA regulates seed size independently of its intracellular domain via MAPK-DA1-UBP15 signaling. DOI: 10.1093/plcell/koac194 ; PMID: 35848951
- Phosphorylation of the auxin signaling transcriptional repressor IAA15 by MPKs is required for the suppression of root development under drought stress in Arabidopsis. DOI: 10.1093/nar/gkac798 ; PMID: 36161329
- Arabidopsis MPK3 and MPK6 regulates D-glucose signaling and interacts with G-protein, RGS1. DOI: 10.1016/j.plantsci.2022.111484 ; PMID: 36195119
- BPL3 binds the long non-coding RNA nalncFL7 to suppress FORKED-LIKE7 and modulate HAI1-mediated MPK3/6 dephosphorylation in plant immunity. DOI: 10.1093/plcell/koac311 ; PMID: 36269178
- Arabidopsis EXTRA-LARGE G PROTEIN 1 (XLG1) functions together with XLG2 and XLG3 in PAMP-triggered MAPK activation and immunity. DOI: 10.1111/jipb.13391 ; PMID: 36250681
- ROOT MERISTEM GROWTH FACTOR1 (RGF1)-RGF1 INSENSITIVE 1 peptide-receptor pair inhibits lateral root development via the MPK6-PUCHI module in Arabidopsis. DOI: 10.1093/jxb/erac495 ; PMID: 36516421
- RAV1 family members function as transcriptional regulators and play a positive role in plant disease resistance. DOI: 10.1111/tpj.16114 ; PMID: 36703574
- Phosphorylation of the LCB1 subunit of Arabidopsis serine palmitoyltransferase stimulates its activity and modulates sphingolipid biosynthesis. DOI: 10.1111/jipb.13461 ; PMID: 36738228
- EDR1 associates with its homologs to synergistically regulate plant immunity in Arabidopsis. DOI: 10.1016/j.plantsci.2023.111619 ; PMID: 36737004
- The Raf-like MAPKKK INTEGRIN-LINKED KINASE 5 regulates purinergic receptor-mediated innate immunity in Arabidopsis. DOI: 10.1093/plcell/koad029 ; PMID: 36762404
- Suppression of ETI by PTI priming to balance plant growth and defense through an MPK3/MPK6-WRKYs-PP2Cs module. DOI: 10.1016/j.molp.2023.04.004 ; PMID: 37041748
- Dual regulations of cell cycle regulator DPa by auxin in Arabidopsis root distal stem cell maintenance. DOI: 10.1073/pnas.2218503120 ; PMID: 37126711
- A prospective study of short-term apoplastic responses to ammonium treatment. DOI: 10.1016/j.jplph.2023.154008 ; PMID: 37245458
- Cell type-specific proteomics uncovers a RAF15-SnRK2.6/OST1 kinase cascade in guard cells. DOI: 10.1111/jipb.13536 ; PMID: 37226855
- MYB44 regulates PTI by promoting the expression of EIN2 and MPK3/6 in Arabidopsis. DOI: 10.1016/j.xplc.2023.100628 ; PMID: 37221824
- Mitogen-activated protein kinase signaling in postgermination arrest of development by abscisic acid. DOI: 10.1073/pnas.242607499 ; PMID: 12434021
- Mitogen-activated protein kinase cascades in plants: a new nomenclature. DOI: 10.1016/s1360-1385(02)02302-6 ; PMID: 12119167
- Ancient signals: comparative genomics of plant MAPK and MAPKK gene families. DOI: 10.1016/j.tplants.2006.02.007 ; PMID: 16537113
- Stomatal development and patterning are regulated by environmentally responsive mitogen-activated protein kinases in Arabidopsis. DOI: 10.1105/tpc.106.048298 ; PMID: 17259259
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: Q0WVS7
- EMBL: AK226663
- AlphaFoldDB: Q0WVS7
- EnsemblPlants: AT3G45640.1
- Gramene: AT3G45640.1
- KEGG: ath:AT3G45640
- Orthologous matrix: MDIPRPE
- ExpressionAtlas: AT3G45640
Homologs
- Brassica rapa Brara.A02887
Sequences
cDNA Sequence
- >AT3G45640.1
CACTATTATTGTCATTATTTAACTATGGCAGATAGATAGATACAGAACCGTAAAGGACGTTAGGAAGAGGAAGAACGTTGACGAAGTCAACAACGAACAGAAACCGTCGATTTGAGGCGGCTCTAATCTCAACCACACGATCTTCTCTGCCTTTCCCTCTTCTCTCTTCTTCTTCTTCTTCATCTTCTTCCTCGCAATTACCGCGAAAACTCATCTCTGCTCAATCCTCAATCTCAGTCTCTCTGTTGACTCCGACTGTTATATAAAACCATACAAATACCTTCAGATTCACTACTTCAAACCTCAAAGCAACCACTGAATCTCGACTTTGATCAATTGAGAGAGAAATGAACACCGGCGGTGGCCAATACACGGATTTTCCGGCGGTGGAAACTCACGGAGGACAGTTCATAAGTTACGATATCTTCGGTAGTTTATTCGAGATCACATCTAAGTATCGTCCTCCGATTATACCAATTGGTCGTGGAGCTTATGGAATCGTTTGCTCTGTGTTGGATACGGAGACGAACGAGCTAGTAGCGATGAAGAAGATAGCTAATGCTTTTGATAATCATATGGATGCTAAGCGTACGCTTCGTGAGATCAAGCTTCTTCGTCATCTTGATCATGAAAACATTATAGCTATAAGAGATGTTGTTCCACCACCACTAAGAAGACAGTTCAGTGATGTTTATATCTCTACTGAATTAATGGATACTGATCTTCATCAAATCATCAGATCTAACCAGAGTTTATCAGAAGAACACTGTCAGTACTTCTTGTACCAGCTACTTCGAGGACTGAAGTATATCCACTCAGCTAACATTATTCATAGGGATTTAAAGCCGAGCAATCTTCTGTTGAACGCGAATTGCGATTTAAAGATTTGTGATTTCGGTCTTGCTAGACCTACTTCAGAGAATGATTTTATGACTGAGTATGTTGTTACGAGATGGTATAGAGCACCTGAGCTTCTGTTGAACTCTTCAGATTACACAGCTGCTATTGATGTTTGGTCTGTTGGTTGTATCTTTATGGAGCTTATGAATAGAAAGCCTTTGTTCCCTGGTAAAGACCATGTTCATCAAATGCGCTTATTGACAGAGTTGCTTGGCACACCGACAGAATCTGATCTCGGTTTTACTCACAATGAGGATGCGAAAAGATACATCCGGCAACTTCCCAACTTCCCACGTCAGCCCTTAGCTAAACTTTTCTCTCATGTTAACCCAATGGCCATTGATCTTGTTGACAGAATGTTGACGTTTGACCCCAACAGAAGAATCACTGTTGAACAAGCTCTGAATCACCAGTACCTTGCTAAATTGCACGACCCGAATGATGAGCCAATCTGTCAAAAGCCATTCTCTTTTGAGTTCGAACAACAGCCTCTGGATGAGGAACAGATAAAAGAGATGATCTACCAAGAAGCCATAGCACTCAATCCAACATACGGTTAGAAGTGCAGCAGCCCCGTGAATGCCTGGTATTACCCAATAACCATCCGAATGGCTACTTAGTATCTTTGCCTGTTCTTTTATTCATGTACTTCTTCCACATATGTAATCTTGTAACTTTTATTTGTTTGTTCATGTTATTTACTGCTAGTGATTAAGTGTAGCTCCAATGTAAAGTACTCCAGTTATTAAAGAATATCTATAGACTTTTTTACTTCACATACTCTTGAGTCTTCCCTAGTAAACAAAGAGAAGAGAGAATATAATTTTGTAATGTACAGAGCCTCAATATTTGTGGGAGACATTATAGAGCTAGAGCCAGAGTCAATGCTGTCGCCGTGAGTTGTCTATTCTCATTCAATGACTTTCAATAGATTTTAGTGGGATTGGCTTTAGGTAGC
CDS Sequence
- >AT3G45640.1
ATGAACACCGGCGGTGGCCAATACACGGATTTTCCGGCGGTGGAAACTCACGGAGGACAGTTCATAAGTTACGATATCTTCGGTAGTTTATTCGAGATCACATCTAAGTATCGTCCTCCGATTATACCAATTGGTCGTGGAGCTTATGGAATCGTTTGCTCTGTGTTGGATACGGAGACGAACGAGCTAGTAGCGATGAAGAAGATAGCTAATGCTTTTGATAATCATATGGATGCTAAGCGTACGCTTCGTGAGATCAAGCTTCTTCGTCATCTTGATCATGAAAACATTATAGCTATAAGAGATGTTGTTCCACCACCACTAAGAAGACAGTTCAGTGATGTTTATATCTCTACTGAATTAATGGATACTGATCTTCATCAAATCATCAGATCTAACCAGAGTTTATCAGAAGAACACTGTCAGTACTTCTTGTACCAGCTACTTCGAGGACTGAAGTATATCCACTCAGCTAACATTATTCATAGGGATTTAAAGCCGAGCAATCTTCTGTTGAACGCGAATTGCGATTTAAAGATTTGTGATTTCGGTCTTGCTAGACCTACTTCAGAGAATGATTTTATGACTGAGTATGTTGTTACGAGATGGTATAGAGCACCTGAGCTTCTGTTGAACTCTTCAGATTACACAGCTGCTATTGATGTTTGGTCTGTTGGTTGTATCTTTATGGAGCTTATGAATAGAAAGCCTTTGTTCCCTGGTAAAGACCATGTTCATCAAATGCGCTTATTGACAGAGTTGCTTGGCACACCGACAGAATCTGATCTCGGTTTTACTCACAATGAGGATGCGAAAAGATACATCCGGCAACTTCCCAACTTCCCACGTCAGCCCTTAGCTAAACTTTTCTCTCATGTTAACCCAATGGCCATTGATCTTGTTGACAGAATGTTGACGTTTGACCCCAACAGAAGAATCACTGTTGAACAAGCTCTGAATCACCAGTACCTTGCTAAATTGCACGACCCGAATGATGAGCCAATCTGTCAAAAGCCATTCTCTTTTGAGTTCGAACAACAGCCTCTGGATGAGGAACAGATAAAAGAGATGATCTACCAAGAAGCCATAGCACTCAATCCAACATACGGTTAG
Protein Sequence
- >AT3G45640.1
MNTGGGQYTDFPAVETHGGQFISYDIFGSLFEITSKYRPPIIPIGRGAYGIVCSVLDTETNELVAMKKIANAFDNHMDAKRTLREIKLLRHLDHENIIAIRDVVPPPLRRQFSDVYISTELMDTDLHQIIRSNQSLSEEHCQYFLYQLLRGLKYIHSANIIHRDLKPSNLLLNANCDLKICDFGLARPTSENDFMTEYVVTRWYRAPELLLNSSDYTAAIDVWSVGCIFMELMNRKPLFPGKDHVHQMRLLTELLGTPTESDLGFTHNEDAKRYIRQLPNFPRQPLAKLFSHVNPMAIDLVDRMLTFDPNRRITVEQALNHQYLAKLHDPNDEPICQKPFSFEFEQQPLDEEQIKEMIYQEAIALNPTYG