Gene Details:
- Gene ID: AT3G27000
- Gene Symbol: ARP2, ATARP2, WRM
- Gene Name: actin related protein 2, ACTIN RELATED PROTEIN 2, WURM
- Description: actin related protein 2;(source:Araport11)
- TAIR Accession: locus:2092005
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000079 — fusiform initial cell — célula inicial fusiforme (Spanish, exact), fusiform initial (exact), 紡錘形始原細胞 (Japanese, exact), xylem initial (related), xylem mother cell (related)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0009001 — fruit — frucht (exact, German), fruto (exact, Spanish), 果実 (exact, Japanese), coenocarp (narrow), syncarp (narrow), aggregate fruit (broad), compound fruit (broad), dehiscent fruit (broad), diaspore (broad), indehiscent fruit (broad), multiple fruit (broad), propagule (broad)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
Gene Ontology:
- GO:0000902 — acts upstream of or within — cell morphogenesis
- GO:0030036 — acts upstream of or within — actin cytoskeleton organization
- GO:0051015 — contributes to — actin filament binding
- GO:0009825 — acts upstream of or within — multidimensional cell growth
- GO:0010090 — acts upstream of or within — trichome morphogenesis
- GO:0034314 — involved in — Arp2/3 complex-mediated actin nucleation
- GO:0030479 — is active in — actin cortical patch
- GO:0007015 — acts upstream of or within — actin filament organization
- GO:0030029 — acts upstream of or within — actin filament-based process
- GO:0005885 — part of — Arp2/3 protein complex
- GO:0005737 — located in — cytoplasm
Germplasm Phenotype:
- brk1;arp2 — alterations in F-actin organization in expanding trichomes
- wurm — Altered cell expansion
- wurm — alterations in F-actin organization in expanding trichomes
Function-related keywords:
- fusiform initial cell , pollen , fruit , root , vascular leaf , flower , root
Literature:
- The actin cytoskeleton is required to elaborate and maintain spatial patterning during trichome cell morphogenesis in Arabidopsis thaliana. DOI: 10.1242/dev.126.24.5559 ; PMID: 10572033
- The Arabidopsis actin-related protein 2 (AtARP2) promoter directs expression in xylem precursor cells and pollen. DOI: 10.1023/a:1006247600932 ; PMID: 10561069
- Arabidopsis contains ancient classes of differentially expressed actin-related protein genes. DOI: 10.1104/pp.010906 ; PMID: 11891255
- Regulation of cell expansion by the DISTORTED genes in Arabidopsis thaliana: actin controls the spatial organization of microtubules. DOI: 10.1007/s00438-003-0843-1 ; PMID: 12690443
- Mutations in actin-related proteins 2 and 3 affect cell shape development in Arabidopsis. DOI: 10.1105/tpc.011676 ; PMID: 12837952
- The putative Arabidopsis arp2/3 complex controls leaf cell morphogenesis. DOI: 10.1104/pp.103.028563 ; PMID: 12913159
- Requirements for Arabidopsis ATARP2 and ATARP3 during epidermal development. DOI: 10.1016/s0960-9822(03)00493-7 ; PMID: 12906796
- Identification of functionally important residues of Arp2/3 complex by analysis of homology models from diverse species. DOI: 10.1016/j.jmb.2003.12.017 ; PMID: 14757065
- Breaking the WAVE complex: the point of Arabidopsis trichomes. DOI: 10.1016/j.pbi.2004.11.004 ; PMID: 15653407
- Plant actin-related proteins. DOI: 10.1016/j.tplants.2004.02.004 ; PMID: 15063870
- IRREGULAR TRICHOME BRANCH1 in Arabidopsis encodes a plant homolog of the actin-related protein2/3 complex activator Scar/WAVE that regulates actin and microtubule organization. DOI: 10.1105/tpc.104.028670 ; PMID: 16006582
- BRICK1/HSPC300 functions with SCAR and the ARP2/3 complex to regulate epidermal cell shape in Arabidopsis. DOI: 10.1242/dev.02280 ; PMID: 16481352
- Arabidopsis BRICK1/HSPC300 is an essential WAVE-complex subunit that selectively stabilizes the Arp2/3 activator SCAR2. DOI: 10.1016/j.cub.2006.03.061 ; PMID: 16584883
- The role of Arabidopsis SCAR genes in ARP2-ARP3-dependent cell morphogenesis. DOI: 10.1242/dev.02792 ; PMID: 17267444
- Arabidopsis SCARs function interchangeably to meet actin-related protein 2/3 activation thresholds during morphogenesis. DOI: 10.1105/tpc.107.055350 ; PMID: 18424615
- Transcriptome analysis of Arabidopsis wild-type and gl3-sst sim trichomes identifies four additional genes required for trichome development. DOI: 10.1093/mp/ssp037 ; PMID: 19626137
- Genetically encoded photoswitching of actin assembly through the Cdc42-WASP-Arp2/3 complex pathway. DOI: 10.1073/pnas.0801232105 ; PMID: 18728185
- The knock-out of ARP3a gene affects F-actin cytoskeleton organization altering cellular tip growth, morphology and development in moss Physcomitrella patens. DOI: 10.1002/cm.20298 ; PMID: 18613119
- The association of the Arabidopsis actin-related protein2/3 complex with cell membranes is linked to its assembly status but not its activation. DOI: 10.1104/pp.109.143859 ; PMID: 19801398
- Conservation in function of a SCAR/WAVE component during infection thread and root hair growth in Medicago truncatula. DOI: 10.1094/MPMI-06-10-0144 ; PMID: 20731530
- The reorganization of actin filaments is required for vacuolar fusion of guard cells during stomatal opening in Arabidopsis. DOI: 10.1111/j.1365-3040.2012.02592.x ; PMID: 22891733
- ARP2/3 localization in Arabidopsis leaf pavement cells: a diversity of intracellular pools and cytoskeletal interactions. DOI: 10.3389/fpls.2013.00238 ; PMID: 23874346
- An optimized optogenetic clustering tool for probing protein interaction and function. DOI: 10.1038/ncomms5925 ; PMID: 25233328
- Patterning mechanisms of cytoskeletal and cell wall systems during leaf trichome morphogenesis. DOI: 10.1038/nplants.2015.14 ; PMID: 27246881
- The role of Arabidopsis Actin-Related Protein 3 in amyloplast sedimentation and polar auxin transport in root gravitropism. DOI: 10.1093/jxb/erw294 ; PMID: 27473572
- The Arabidopsis CURVY1 (CVY1) gene encoding a novel receptor-like protein kinase regulates cell morphogenesis, flowering time and seed production. DOI: 10.1186/s12870-014-0221-7 ; PMID: 25158860
- Arabidopsis thaliana plants lacking the ARP2/3 complex show defects in cell wall assembly and auxin distribution. DOI: 10.1093/aob/mcx178 ; PMID: 29293873
- Microtubule-Dependent Confinement of a Cell Signaling and Actin Polymerization Control Module Regulates Polarized Cell Growth. DOI: 10.1016/j.cub.2018.05.076 ; PMID: 30033335
- Plant AtEH/Pan1 proteins drive autophagosome formation at ER-PM contact sites with actin and endocytic machinery. DOI: 10.1038/s41467-019-12782-6 ; PMID: 31723129
- ARP2/3-independent WAVE/SCAR pathway and class XI myosin control sperm nuclear migration in flowering plants. DOI: 10.1073/pnas.2015550117 ; PMID: 33288691
- The ARP2/3 complex, acting cooperatively with Class I formins, modulates penetration resistance in Arabidopsis against powdery mildew invasion. DOI: 10.1093/plcell/koab170 ; PMID: 34181022
- Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9-generated diallelic mutants reveal Arabidopsis actin-related protein 2 function in the trafficking of syntaxin PEN1. DOI: 10.3389/fpls.2022.934002 ; PMID: 36204067
- CRISPR-Cas9 Arabidopsis mutants of genes for ARPC1 and ARPC3 subunits of ARP2/3 complex reveal differential roles of complex subunits. DOI: 10.1038/s41598-022-22982-8 ; PMID: 36307477
Sequences:
cDNA Sequence
- >AT3G27000.1
AAACGAGGAAACAGCTGCTTTTTGTTTGTCGAAGAGCAAATATGTTTTCTCGATCGCGACCAAACAAGTAGAGAAGAGTGATTCTTCGCTTCGATTCAAAGACAGGTTTTTTCTTTTGTTCCCTGAGAGATCGAATCGAAGAAATCGAAATTTTTGTACTTCGATAAAAATCTGTAGTCTCTATAGAAATCGGAGAAGATGGACAACAAAAACGTCGTCGTTTGCGACAACGGCACCGGTTATGTAAAATGTGGATTTGCTGGAGAGAATTTCCCAACGTCTGTTTTCCCCTGTGTCGTGGGAAGGCCATTGCTTCGGTATGAAGAATCACTCATGGAGCAACAAGTCAAGGATATAGTTGTTGGGGAGACTTGCTCTGAGCTCCGGCATCAATTGGATATAAATTATCCTGTCCACAATGGTATTGTGCAGAATTGGGATGATATGGAACATGTTTGGGATCATGCTTTCTATAACGAATTGAAAATCAATCCATCTGACTGTAAGATATTGCTCACGGATCCACCTCTTAATCCGTCCAAGAATCGTGAAAAAATGATTGAGACAATGTTTGAGAAATACAATTTCGCTGGCGTTTTCATTCAAATCCAAGCCGTTTTGACTCTCTATGCTCAAGGTTTGCTAACTGGTTTGGTTATTGATTCTGGTGATGGTGTTACTCATGTGGTTCCGGTGGTTGACGGCTACTCGTTCCCTCATCTTACTAAAAGAATGAATGTTGCTGGCAGACACATAACAGCATATCTCGTTGATCTACTATCTCGACGAGGATATGCGATGAACAAAACAGCTGACTTTGAGACGGTTAGGGAAATTAAAGAGAAGCTCTGCTATATAAGTTATGATTACAAGAGAGAATCTCAGCTTGGCCTTGAGACAACTATCCTTGTTAAGAATTATACTCTTCCAGATGGGAGGGTTATCAAAGTAGGCACTGAAAGATTCCAAGCACCTGAAGCGCTTTTTACTCCGGAACTCATTGATGTTGAAGGTGATGGAATGGCAGACATGGTTTTCCGATGTATTCAAGAAATGGATATTGATAACCGCATGATGCTCTACCAACACATAGTTTTAAGCGGAGGTAGCACCATGTACCCAGGATTACCTAGCCGTCTTGAGAAAGAAATACAGGATCGGTATCTCGACACAGTTCTAAAAGGAAACAAAGATGGCTTGAAGAAACTCAGATTGCGGATCGAAGATCCACCGAGAAGGAAACACATGGTATACCTCGGAGGTGCTGTTCTTGCAGGAATCATGAAGGACGCACCAGAGTTCTGGATCAATAGAGAGGACTATATGGAAGAAGGAATTAATTGTTTGAATAAAATGAGCCAAGCTTAATAACTTTCAAACGCAGAACTCATACTTGTACTTGTACCCCTTTTTTTTACTACCGTCAGGATGATTTAATTCCGTTTGTGAATTCAGTATTTTAGGTTTCAAAGTTTGAGTACAATTGGTTGCAGTTAGGGATCCAAAATTCGACATGTGATTGGTGGGATATACAGAAAAACGTGTATTAACTAATAATGTTGAGACTAATATATTGTGTAATAACCAAAGCCAAAAGGTCGAGAAGAGACGAAATGCATATATCTTAATTCTTGAGTAAGCAAACAGAGTCAAAACAGTGAAAGATTATTTGTAAT
CDS Sequence
- >AT3G27000.1
ATGGACAACAAAAACGTCGTCGTTTGCGACAACGGCACCGGTTATGTAAAATGTGGATTTGCTGGAGAGAATTTCCCAACGTCTGTTTTCCCCTGTGTCGTGGGAAGGCCATTGCTTCGGTATGAAGAATCACTCATGGAGCAACAAGTCAAGGATATAGTTGTTGGGGAGACTTGCTCTGAGCTCCGGCATCAATTGGATATAAATTATCCTGTCCACAATGGTATTGTGCAGAATTGGGATGATATGGAACATGTTTGGGATCATGCTTTCTATAACGAATTGAAAATCAATCCATCTGACTGTAAGATATTGCTCACGGATCCACCTCTTAATCCGTCCAAGAATCGTGAAAAAATGATTGAGACAATGTTTGAGAAATACAATTTCGCTGGCGTTTTCATTCAAATCCAAGCCGTTTTGACTCTCTATGCTCAAGGTTTGCTAACTGGTTTGGTTATTGATTCTGGTGATGGTGTTACTCATGTGGTTCCGGTGGTTGACGGCTACTCGTTCCCTCATCTTACTAAAAGAATGAATGTTGCTGGCAGACACATAACAGCATATCTCGTTGATCTACTATCTCGACGAGGATATGCGATGAACAAAACAGCTGACTTTGAGACGGTTAGGGAAATTAAAGAGAAGCTCTGCTATATAAGTTATGATTACAAGAGAGAATCTCAGCTTGGCCTTGAGACAACTATCCTTGTTAAGAATTATACTCTTCCAGATGGGAGGGTTATCAAAGTAGGCACTGAAAGATTCCAAGCACCTGAAGCGCTTTTTACTCCGGAACTCATTGATGTTGAAGGTGATGGAATGGCAGACATGGTTTTCCGATGTATTCAAGAAATGGATATTGATAACCGCATGATGCTCTACCAACACATAGTTTTAAGCGGAGGTAGCACCATGTACCCAGGATTACCTAGCCGTCTTGAGAAAGAAATACAGGATCGGTATCTCGACACAGTTCTAAAAGGAAACAAAGATGGCTTGAAGAAACTCAGATTGCGGATCGAAGATCCACCGAGAAGGAAACACATGGTATACCTCGGAGGTGCTGTTCTTGCAGGAATCATGAAGGACGCACCAGAGTTCTGGATCAATAGAGAGGACTATATGGAAGAAGGAATTAATTGTTTGAATAAAATGAGCCAAGCTTAA
Protein Sequence
- >AT3G27000.1
MDNKNVVVCDNGTGYVKCGFAGENFPTSVFPCVVGRPLLRYEESLMEQQVKDIVVGETCSELRHQLDINYPVHNGIVQNWDDMEHVWDHAFYNELKINPSDCKILLTDPPLNPSKNREKMIETMFEKYNFAGVFIQIQAVLTLYAQGLLTGLVIDSGDGVTHVVPVVDGYSFPHLTKRMNVAGRHITAYLVDLLSRRGYAMNKTADFETVREIKEKLCYISYDYKRESQLGLETTILVKNYTLPDGRVIKVGTERFQAPEALFTPELIDVEGDGMADMVFRCIQEMDIDNRMMLYQHIVLSGGSTMYPGLPSRLEKEIQDRYLDTVLKGNKDGLKKLRLRIEDPPRRKHMVYLGGAVLAGIMKDAPEFWINREDYMEEGINCLNKMSQA