Information report for AT3G23130
Gene Details
|
|
Functional Descriptions
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
Functional Keywords
Literature and News
- Multiple modes of cell division control in Arabidopsis flower development. DOI: NA ; PMID: 10645419
- adaxial patterning in Arabidopsis ovules. DOI: 10.1101/gad.13.23.3160 ; PMID: 10601041
- Disruption of an RNA helicase/RNAse III gene in Arabidopsis causes unregulated cell division in floral meristems. DOI: 10.1242/dev.126.23.5231 ; PMID: 10556049
- Zinc-finger proteins: the classical zinc finger emerges in contemporary plant science. DOI: 10.1023/a:1006184519697 ; PMID: 10380795
- The Arabidopsis FILAMENTOUS FLOWER gene is required for flower formation. DOI: 10.1242/dev.126.12.2715 ; PMID: 10331982
- Targeted misexpression of AGAMOUS in whorl 2 of Arabidopsis flowers. DOI: 10.1046/j.1365-313x.1997.11040825.x ; PMID: 9161038
- FON1, an Arabidopsis gene that terminates floral meristem activity and controls flower organ number. DOI: 10.1105/tpc.9.2.115 ; PMID: 9061945
- The WUSCHEL gene is required for shoot and floral meristem integrity in Arabidopsis. DOI: 10.1242/dev.122.1.87 ; PMID: 8565856
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Control of CpNpG DNA methylation by the KRYPTONITE histone H3 methyltransferase. DOI: 10.1038/nature731 ; PMID: 11898023
- Requirement of CHROMOMETHYLASE3 for maintenance of CpXpG methylation. DOI: 10.1126/science.1059745 ; PMID: 11349138
- Role of the arabidopsis DRM methyltransferases in de novo DNA methylation and gene silencing. DOI: 10.1016/s0960-9822(02)00925-9 ; PMID: 12121623
- SUPERMAN attenuates positive INNER NO OUTER autoregulation to maintain polar development of Arabidopsis ovule outer integuments. DOI: 10.1242/dev.129.18.4281 ; PMID: 12183380
- Ectopic expression of SUPERMAN suppresses development of petals and stamens. DOI: 10.1093/pcp/pcf018 ; PMID: 11828022
- UNUSUAL FLORAL ORGANS Controls Meristem Identity and Organ Primordia Fate in Arabidopsis. DOI: 10.1105/tpc.7.9.1485 ; PMID: 12242408
- ARGONAUTE4 control of locus-specific siRNA accumulation and DNA and histone methylation. DOI: 10.1126/science.1079695 ; PMID: 12522258
- Multiple protein regions contribute to differential activities of YABBY proteins in reproductive development. DOI: 10.1104/pp.104.055368 ; PMID: 15665244
- Methylation patterns of histone H3 Lys 4, Lys 9 and Lys 27 in transcriptionally active and inactive Arabidopsis genes and in atx1 mutants. DOI: 10.1093/nar/gki830 ; PMID: 16157865
- SAZ, a new SUPERMAN-like protein, negatively regulates a subset of ABA-responsive genes in Arabidopsis. DOI: 10.1007/s00438-007-0306-1 ; PMID: 18030492
- Independence and interaction of regions of the INNER NO OUTER protein in growth control during ovule development. DOI: 10.1104/pp.107.114603 ; PMID: 18326791
- REBELOTE, SQUINT, and ULTRAPETALA1 function redundantly in the temporal regulation of floral meristem termination in Arabidopsis thaliana. DOI: 10.1105/tpc.107.053306 ; PMID: 18441215
- A spatial dissection of the Arabidopsis floral transcriptome by MPSS. DOI: 10.1186/1471-2229-8-43 ; PMID: 18426585
- Functional diversification of CLAVATA3-related CLE proteins in meristem maintenance in rice. DOI: 10.1105/tpc.107.057257 ; PMID: 18676878
- Phosphate starvation responses and gibberellic acid biosynthesis are regulated by the MYB62 transcription factor in Arabidopsis. DOI: 10.1093/mp/ssn081 ; PMID: 19529828
- POWERDRESS and diversified expression of the MIR172 gene family bolster the floral stem cell network. DOI: 10.1371/journal.pgen.1003218 ; PMID: 23349639
- Regulation of floral meristem activity through the interaction of AGAMOUS, SUPERMAN, and CLAVATA3 in Arabidopsis. DOI: 10.1007/s00497-017-0315-0 ; PMID: 29218596
- SUPERMAN regulates floral whorl boundaries through control of auxin biosynthesis. DOI: 10.15252/embj.201797499 ; PMID: 29764982
- Arabidopsis ZINC FINGER PROTEIN1 Acts Downstream of GL2 to Repress Root Hair Initiation and Elongation by Directly Suppressing bHLH Genes. DOI: 10.1105/tpc.19.00226 ; PMID: 31732703
- The genetic framework of shoot regeneration in Arabidopsis comprises master regulators and conditional fine-tuning factors. DOI: 10.1038/s42003-020-01274-9 ; PMID: 33009513
- Improving the Efficiency of Adventitious Shoot Induction and Somatic Embryogenesis via Modification of WUSCHEL and LEAFY COTYLEDON 1. DOI: 10.3390/plants9111434 ; PMID: 33113787
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Gene Resources
- UniProt: C0SVC6
- EMBL: AB493629
- AlphaFoldDB: C0SVC6
- EnsemblPlants: AT3G23130.1
- Gramene: AT3G23130.1
- KEGG: ath:AT3G23130
- Orthologous matrix: NADQDYV
- ExpressionAtlas: AT3G23130
Homologs
- Brassica napus BnaA01G0294800ZS, BnaC07G0124600ZS, BnaC01G0363800ZS
- Brassica oleracea Bo7g040940, XP_013592211.1, Bo1g102390
- Brassica rapa XP_009108205.1, Bra023759
- Raphanus raphanistrum RrC4852_p1
Sequences
cDNA Sequence
- >AT3G23130.1
AAGAGCCCCAACCCTATCATCACACACACCTCTCTCTCATCTCTATATCTCTCTCTCTCTCTCTAAGAGACAGACAGACATAGATATATCTTAGATTTTTCCCAGGGGAAAAAAGTGAGTTCATCTTTTCAGATCTTACAAACACTTTGCTTTTATAAACTGATGTACCACAAATCATTACTAGTACTATCTTAATTATCTTTACAATTTTTTTATCTAGCATAGCCAAAAAGAAAGAGCTTGCACATATGGAGAGATCAAACAGCATAGAGTTGAGGAACAGCTTCTATGGCCGTGCAAGAACTTCACCATGGAGCTATGGAGATTATGATAATTGCCAACAGGATCATGATTATCTTCTAGGGTTTTCATGGCCACCAAGATCCTACACTTGCAGCTTCTGCAAAAGGGAATTCAGATCGGCTCAAGCACTTGGTGGCCACATGAATGTTCACAGAAGAGACAGAGCAAGACTCAGATTACAACAGTCTCCATCATCATCTTCAACACCTTCTCCTCCTTACCCTAACCCTAATTACTCTTACTCAACCATGGCAAACTCTCCTCCTCCTCATCATTCTCCTCTAACCCTATTTCCAACCCTTTCTCCTCCATCCTCACCAAGATATAGGGCAGGTTTGATCCGTTCCTTGAGCCCCAAGTCAAAACATACACCAGAAAACGCTTGTAAGACTAAGAAATCATCTCTTTTAGTGGAGGCTGGAGAGGCTACAAGGTTCACCAGTAAAGATGCTTGCAAGATCCTGAGGAATGATGAAATCATCAGCTTGGAGCTTGAGATTGGTTTGATTAACGAATCAGAGCAAGATCTGGATCTAGAACTCCGTTTGGGTTTCGCTTAATTAGATGGTAATAACTTTATCCATAAAGGATTCGAAGTTCACAATTCTAGAAGATATGATGCTTCTCTAAGGTTAATTAGTTTCATCCATATGAAATTCTCTAAGCTTGCTATTTAGTAGAACGTTATAGTTGATTATATGATTATAGTATAAGCTATAAGCTTGCGTTAGATGTTATATAATATGTATGCGCTTGTTACCGTTTTATGTATGACAATGGATACAATTTTGTCTCCTTAATTATTGTTTATCTC
CDS Sequence
- >AT3G23130.1
ATGGAGAGATCAAACAGCATAGAGTTGAGGAACAGCTTCTATGGCCGTGCAAGAACTTCACCATGGAGCTATGGAGATTATGATAATTGCCAACAGGATCATGATTATCTTCTAGGGTTTTCATGGCCACCAAGATCCTACACTTGCAGCTTCTGCAAAAGGGAATTCAGATCGGCTCAAGCACTTGGTGGCCACATGAATGTTCACAGAAGAGACAGAGCAAGACTCAGATTACAACAGTCTCCATCATCATCTTCAACACCTTCTCCTCCTTACCCTAACCCTAATTACTCTTACTCAACCATGGCAAACTCTCCTCCTCCTCATCATTCTCCTCTAACCCTATTTCCAACCCTTTCTCCTCCATCCTCACCAAGATATAGGGCAGGTTTGATCCGTTCCTTGAGCCCCAAGTCAAAACATACACCAGAAAACGCTTGTAAGACTAAGAAATCATCTCTTTTAGTGGAGGCTGGAGAGGCTACAAGGTTCACCAGTAAAGATGCTTGCAAGATCCTGAGGAATGATGAAATCATCAGCTTGGAGCTTGAGATTGGTTTGATTAACGAATCAGAGCAAGATCTGGATCTAGAACTCCGTTTGGGTTTCGCTTAA
Protein Sequence
- >AT3G23130.1
MERSNSIELRNSFYGRARTSPWSYGDYDNCQQDHDYLLGFSWPPRSYTCSFCKREFRSAQALGGHMNVHRRDRARLRLQQSPSSSSTPSPPYPNPNYSYSTMANSPPPHHSPLTLFPTLSPPSSPRYRAGLIRSLSPKSKHTPENACKTKKSSLLVEAGEATRFTSKDACKILRNDEIISLELEIGLINESEQDLDLELRLGFA