Information report for AT3G20840
Gene Details
|
|
Functional Descriptions
- PO:0005052 — plant callus — callo (Spanish, exact), portion of plant callus tissue (exact), 植物カルス (Japanese, exact), callus (broad)
- plt1-1 — The mutation causes extra cells in the columella root cap and the QC.
- plt1-1/plt2-2 — Short roots due to premature stem cell differentiation. Increased telomere length likely resulting from fewer replicative stem cell divisions prior to differentiation.
- plt1-2 — The mutation causes extra cells in the columella root cap and the QC.
- plt3-1/plt2-2/plt1-4 — Rootless.Embryonic root differentiates 3 days after germination. Adventitious roots arrest 6 days after germination.
- ptl1-4 — sensitive to abscisic acid (ABA)
Functional Keywords
Literature and News
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- The PLETHORA genes mediate patterning of the Arabidopsis root stem cell niche. DOI: 10.1016/j.cell.2004.09.018 ; PMID: 15454085
- The PIN auxin efflux facilitator network controls growth and patterning in Arabidopsis roots. DOI: 10.1038/nature03184 ; PMID: 15635403
- A molecular framework for plant regeneration. DOI: 10.1126/science.1121790 ; PMID: 16424342
- Cytokinins determine Arabidopsis root-meristem size by controlling cell differentiation. DOI: 10.1016/j.cub.2007.02.047 ; PMID: 17363254
- MERISTEM-DEFECTIVE, an RS domain protein, is required for the correct meristem patterning and function in Arabidopsis. DOI: 10.1111/j.1365-313X.2008.03738.x ; PMID: 19000164
- Pluripotency of Arabidopsis xylem pericycle underlies shoot regeneration from root and hypocotyl explants grown in vitro. DOI: 10.1111/j.1365-313X.2008.03715.x ; PMID: 18980654
- Transcriptional networks in root cell fate specification. DOI: 10.1016/j.bbagrm.2008.09.006 ; PMID: 18973837
- PLETHORA proteins as dose-dependent master regulators of Arabidopsis root development. DOI: 10.1038/nature06206 ; PMID: 17960244
- What's the physiological role of domain II-less Aux/IAA proteins? DOI: 10.4161/psb.3.7.5994 ; PMID: 19704497
- SUMO E3 ligase HIGH PLOIDY2 regulates endocycle onset and meristem maintenance in Arabidopsis. DOI: 10.1105/tpc.109.068072 ; PMID: 19666737
- Control of Arabidopsis apical-basal embryo polarity by antagonistic transcription factors. DOI: 10.1038/nature08843 ; PMID: 20190735
- Auxin regulates distal stem cell differentiation in Arabidopsis roots. DOI: 10.1073/pnas.1000672107 ; PMID: 20543136
- Arabidopsis Tyrosylprotein sulfotransferase acts in the auxin/PLETHORA pathway in regulating postembryonic maintenance of the root stem cell niche. DOI: 10.1105/tpc.110.075721 ; PMID: 21045165
- RopGEF7 regulates PLETHORA-dependent maintenance of the root stem cell niche in Arabidopsis. DOI: 10.1105/tpc.111.085514 ; PMID: 21828289
- The basic helix-loop-helix transcription factor MYC2 directly represses PLETHORA expression during jasmonate-mediated modulation of the root stem cell niche in Arabidopsis. DOI: 10.1105/tpc.111.089870 ; PMID: 21954460
- SPT6L encoding a putative WG/GW-repeat protein regulates apical-basal polarity of embryo in Arabidopsis. DOI: 10.1093/mp/ssr073 ; PMID: 21948524
- LBD29 regulates the cell cycle progression in response to auxin during lateral root formation in Arabidopsis thaliana. DOI: 10.1093/aob/mcs019 ; PMID: 22334497
- A PLETHORA-auxin transcription module controls cell division plane rotation through MAP65 and CLASP. DOI: 10.1016/j.cell.2012.02.051 ; PMID: 22500804
- Stable establishment of cotyledon identity during embryogenesis in Arabidopsis by ANGUSTIFOLIA3 and HANABA TARANU. DOI: 10.1242/dev.081547 ; PMID: 22669825
- A genome-wide transcriptome profiling reveals the early molecular events during callus initiation in Arabidopsis multiple organs. DOI: 10.1016/j.ygeno.2012.05.013 ; PMID: 22664253
- Control of root meristem size by DA1-RELATED PROTEIN2 in Arabidopsis. DOI: 10.1104/pp.112.210237 ; PMID: 23296689
- Identification of SHRUBBY, a SHORT-ROOT and SCARECROW interacting protein that controls root growth and radial patterning. DOI: 10.1242/dev.090761 ; PMID: 23444357
- DAR2 acts as an important node connecting cytokinin, auxin, SHY2 and PLT1/2 in root meristem size control. DOI: 10.4161/psb.24226 ; PMID: 23518585
- The bps signal: embryonic arrest from an auxin-independent mechanism in bypass triple mutants. DOI: 10.4161/psb.20282 ; PMID: 22580686
- TIME FOR COFFEE controls root meristem size by changes in auxin accumulation in Arabidopsis. DOI: 10.1093/jxb/ert374 ; PMID: 24277277
- The key players of the primary root growth and development also function in lateral roots in Arabidopsis. DOI: 10.1007/s00299-014-1575-x ; PMID: 24504658
- Sulfur nutrient availability regulates root elongation by affecting root indole-3-acetic acid levels and the stem cell niche. DOI: 10.1111/jipb.12217 ; PMID: 24831283
- ROP3 GTPase contributes to polar auxin transport and auxin responses and is important for embryogenesis and seedling growth in Arabidopsis. DOI: 10.1105/tpc.114.127902 ; PMID: 25217509
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- ABA-mediated ROS in mitochondria regulate root meristem activity by controlling PLETHORA expression in Arabidopsis. DOI: 10.1371/journal.pgen.1004791 ; PMID: 25522358
- PLETHORA Genes Control Regeneration by a Two-Step Mechanism. DOI: 10.1016/j.cub.2015.02.022 ; PMID: 25819565
- Single-cell telomere-length quantification couples telomere length to meristem activity and stem cell development in Arabidopsis. DOI: 10.1016/j.celrep.2015.04.013 ; PMID: 25937286
- The Arabidopsis thaliana elongator complex subunit 2 epigenetically affects root development. DOI: 10.1093/jxb/erv230 ; PMID: 25998905
- The Arabidopsis SWI2/SNF2 Chromatin Remodeling ATPase BRAHMA Targets Directly to PINs and Is Required for Root Stem Cell Niche Maintenance. DOI: 10.1105/tpc.15.00091 ; PMID: 25991732
- A tetratricopeptide repeat domain-containing protein SSR1 located in mitochondria is involved in root development and auxin polar transport in Arabidopsis. DOI: 10.1111/tpj.12911 ; PMID: 26072661
- Identification of three LRR-RKs involved in perception of root meristem growth factor in Arabidopsis. DOI: 10.1073/pnas.1522639113 ; PMID: 27001831
- RGF1 INSENSITIVE 1 to 5, a group of LRR receptor-like kinases, are essential for the perception of root meristem growth factor 1 in Arabidopsis thaliana. DOI: 10.1038/cr.2016.63 ; PMID: 27229312
- The MADS-box XAANTAL1 increases proliferation at the Arabidopsis root stem-cell niche and participates in transition to differentiation by regulating cell-cycle components. DOI: 10.1093/aob/mcw126 ; PMID: 27474508
- The PLETHORA Gene Regulatory Network Guides Growth and Cell Differentiation in Arabidopsis Roots. DOI: 10.1105/tpc.16.00656 ; PMID: 27920338
- ARF2 coordinates with PLETHORAs and PINs to orchestrate ABA-mediated root meristem activity in Arabidopsis . DOI: 10.1111/jipb.12506 ; PMID: 28074634
- PLETHORA transcription factors orchestrate de novo organ patterning during Arabidopsis lateral root outgrowth. DOI: 10.1073/pnas.1714410114 ; PMID: 29078398
- Regulation of Hormonal Control, Cell Reprogramming, and Patterning during De Novo Root Organogenesis. DOI: 10.1104/pp.17.00980 ; PMID: 29233938
- GIF Transcriptional Coregulators Control Root Meristem Homeostasis. DOI: 10.1105/tpc.17.00856 ; PMID: 29352064
- Control of auxin-induced callus formation by bZIP59-LBD complex in Arabidopsis regeneration. DOI: 10.1038/s41477-017-0095-4 ; PMID: 29358751
- Histone chaperones play crucial roles in maintenance of stem cell niche during plant root development. DOI: 10.1111/tpj.13933 ; PMID: 29676825
- Epigenetic reprogramming by histone acetyltransferase HAG1/AtGCN5 is required for pluripotency acquisition in Arabidopsis. DOI: 10.15252/embj.201798726 ; PMID: 30061313
- Elongator Is Required for Root Stem Cell Maintenance by Regulating SHORTROOT Transcription. DOI: 10.1104/pp.18.00534 ; PMID: 30401723
- Cystathionine beta-lyase is crucial for embryo patterning and the maintenance of root stem cell niche in Arabidopsis. DOI: 10.1111/tpj.14343 ; PMID: 31002461
- The miR396-GRF Regulatory Module Controls the Embryogenic Response in Arabidopsis via an Auxin-Related Pathway. DOI: 10.3390/ijms20205221 ; PMID: 31640280
- AtMOB1 Genes Regulate Jasmonate Accumulation and Plant Development. DOI: 10.1104/pp.19.01434 ; PMID: 31862839
- RIBOSE PHOSPHATE ISOMERSASE 1 Influences Root Development by Acting on Cell Wall Biosynthesis, Actin Organization, and Auxin Transport in Arabidopsis. DOI: 10.3389/fpls.2019.01641 ; PMID: 31969892
- Arabidopsis thaliana trehalose-6-phosphate phosphatase gene TPPI enhances drought tolerance by regulating stomatal apertures. DOI: 10.1093/jxb/eraa173 ; PMID: 32242234
- Phosphoethanolamine N-methyltransferase 1 contributes to maintenance of root apical meristem by affecting ROS and auxin-regulated cell differentiation in Arabidopsis. DOI: 10.1111/nph.16028 ; PMID: 31246280
- The pre-mRNA splicing factor RDM16 regulates root stem cell maintenance in Arabidopsis. DOI: 10.1111/jipb.13006 ; PMID: 32790237
- The YDA-MKK4/MKK5-MPK3/MPK6 Cascade Functions Downstream of the RGF1-RGI Ligand-Receptor Pair in Regulating Mitotic Activity in Root Apical Meristem. DOI: 10.1016/j.molp.2020.09.004 ; PMID: 32916336
- RGF1-RGI1, a Peptide-Receptor Complex, Regulates Arabidopsis Root Meristem Development via a MAPK Signaling Cascade. DOI: 10.1016/j.molp.2020.09.005 ; PMID: 32916335
- Transcriptional Regulation of PLETHORA1 in the Root Meristem Through an Importin and Its Two Antagonistic Cargos. DOI: 10.1105/tpc.20.00108 ; PMID: 32989172
- Salicylic acid promotes quiescent center cell division through ROS accumulation and down-regulation of PLT1, PLT2, and WOX5. DOI: 10.1111/jipb.13020 ; PMID: 33017089
- N,N-dimethyl-hexadecylamine modulates Arabidopsis root growth through modifying the balance between stem cell niche and jasmonic acid-dependent gene expression. DOI: 10.1016/j.gep.2021.119201 ; PMID: 34329770
- Essential roles of SERKs in the ROOT MERISTEM GROWTH FACTOR-mediated signaling pathway. DOI: 10.1093/plphys/kiac036 ; PMID: 35134233
- SYNTAXIN OF PLANTS81 regulates root meristem activity and stem cell niche maintenance via ROS signaling. DOI: 10.1093/plphys/kiac530 ; PMID: 36427205
- A role for brassinosteroid signalling in decision-making processes in the Arabidopsis seedling. DOI: 10.1371/journal.pgen.1010541 ; PMID: 36508461
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
Gene Resources
Homologs
- Brassica napus GSBRNA2T00022850001, GSBRNA2T00122353001, GSBRNA2T00009262001
- Brassica oleracea XP_013589373.1, XP_013585217.1
- Brassica rapa XP_009110086.1, XP_009145544.1
- Raphanus raphanistrum RrC1442_p1
Sequences
cDNA Sequence
- >AT3G20840.1
CACAAATATCTTCTCCTTTGTTAAAACCCTAAAGCTAGAGTTTATAGCTTTTGAGAGAACGAGAACGAGAAAGAGAAAGAGAAAGAGAAAGAGAGATAGATATATAAATCTGAAGAATACATCTACCTATATAAATACATATTCTCCAATCTTTGAAAGCAGTCTTGATCATTAAATTATCTTTCCCCAATCCTTGATAGTTGAATCTTCCTTTCTTCTCTGATTGGCTTAGAGCTTGGTATATTGATCATACCAAAGTGGTAGTGATTTATTGATTAACCCAAACACAAAATAAACAGATTTGACTCAAAAAGAAGAAAATGAATTCTAACAACTGGCTTGGCTTTCCTCTTTCACCGAACAACTCTTCTTTGCCTCCTCATGAATACAACCTTGGCTTGGTCAGCGACCATATGGACAACCCTTTTCAAACACAAGAGTGGAATATGATCAATCCACACGGTGGAGGAGGAGATGAAGGAGGAGAGGTTCCAAAAGTGGCCGATTTTCTCGGTGTGAGCAAACCGGACGAAAACCAATCCAACCACCTAGTAGCTTACAACGACTCAGACTACTACTTCCATACCAATAGCTTGATGCCTAGCGTCCAATCAAACGATGTCGTTGTAGCAGCTTGTGACTCCAATACTCCTAACAACAGTAGCTATCATGAGCTTCAAGAGAGTGCTCACAATCTACAGTCACTTACTTTGTCCATGGGGACCACCGCTGGTAATAATGTTGTAGACAAAGCTTCACCATCCGAGACCACCGGGGATAACGCTAGCGGTGGAGCACTAGCCGTTGTTGAGACGGCCACGCCAAGACGTGCATTGGACACTTTCGGACAACGAACCTCGATCTATCGTGGTGTCACAAGACATCGATGGACTGGTCGATATGAGGCTCATCTATGGGATAATAGTTGTAGAAGGGAAGGCCAGTCTAGGAAAGGAAGACAAGTTTACTTGGGTGGATATGACAAAGAAGATAAAGCAGCAAGATCATATGATCTAGCTGCACTTAAGTACTGGGGTCCTTCAACTACTACTAATTTCCCCATTACAAACTACGAGAAAGAAGTAGAGGAAATGAAGCACATGACGAGACAAGAGTTCGTGGCTGCCATTAGAAGGAAAAGTAGTGGATTTTCGAGAGGCGCTTCGATGTATCGAGGAGTTACAAGGCATCACCAACATGGAAGATGGCAAGCAAGGATCGGCCGAGTCGCCGGAAACAAAGACCTCTACTTGGGAACTTTTAGCACTGAGGAAGAAGCAGCAGAAGCTTACGATATAGCTGCAATAAAGTTTAGAGGACTTAATGCAGTGACCAACTTCGAGATCAACCGGTACGACGTGAAAGCCATTCTAGAGAGTAGCACTCTTCCCATCGGAGGAGGCGCAGCTAAACGGCTCAAAGAAGCTCAAGCTCTTGAGTCTTCAAGGAAACGCGAGGCGGAGATGATAGCCCTTGGTTCAAGTTTCCAGTACGGTGGTGGCTCGAGCACAGGCTCTGGCTCCACCTCATCAAGACTTCAGCTTCAACCTTACCCTCTAAGCATTCAACAACCATTAGAGCCTTTTCTATCTCTTCAGAACAATGACATCTCTCATTACAACAACAACAATGCTCACGATTCCTCCTCTTTTAATCACCATAGCTATATCCAGACACAACTTCATCTCCACCAACAGACCAACAATTACTTGCAGCAACAGTCGAGCCAGAACTCTCAGCAGCTCTACAATGCGTATCTTCATAGCAATCCGGCTCTGCTTCATGGACTTGTCTCTACCTCTATCGTTGACAACAATAATAACAATGGAGGCTCTAGTGGGAGCTACAACACTGCAGCATTTCTTGGGAACCACGGTATTGGTATTGGGTCCAGCTCGACTGTTGGATCGACCGAGGAGTTTCCAACCGTTAAAACAGATTACGATATGCCTTCCAGTGATGGAACCGGAGGGTATAGTGGTTGGACCAGTGAGTCTGTTCAGGGGTCAAACCCTGGTGGTGTTTTCACTATGTGGAATGAGTAAACAAGGATCTCTTTCTTGCGGCACAAGGAATGGGTCTGAATAGTAACTATTTTAATCTCTACTCTCAATTTTTATTTCTTTCTTGTCTTGGAAGTAATAGGATCAATTTAGAGGGGGCCTTTTGGTAGAAGAATTTAGGTGACGCAAGGAGTTCTTTCTATATTTACGGCGAAGGTATTCTCAGACTGGTTAAATGGTTCTTGAGGGTTAGGGTTTTATGGGTACTCAATTAAGTTTGTGTACCCAAATTTTGTTTACAGCTAACCCTTTTGACTAATTTCCAAATTTGTAATTCGTTTATAAAGATGTTTTCTCTAGCTCTT
CDS Sequence
- >AT3G20840.1
ATGAATTCTAACAACTGGCTTGGCTTTCCTCTTTCACCGAACAACTCTTCTTTGCCTCCTCATGAATACAACCTTGGCTTGGTCAGCGACCATATGGACAACCCTTTTCAAACACAAGAGTGGAATATGATCAATCCACACGGTGGAGGAGGAGATGAAGGAGGAGAGGTTCCAAAAGTGGCCGATTTTCTCGGTGTGAGCAAACCGGACGAAAACCAATCCAACCACCTAGTAGCTTACAACGACTCAGACTACTACTTCCATACCAATAGCTTGATGCCTAGCGTCCAATCAAACGATGTCGTTGTAGCAGCTTGTGACTCCAATACTCCTAACAACAGTAGCTATCATGAGCTTCAAGAGAGTGCTCACAATCTACAGTCACTTACTTTGTCCATGGGGACCACCGCTGGTAATAATGTTGTAGACAAAGCTTCACCATCCGAGACCACCGGGGATAACGCTAGCGGTGGAGCACTAGCCGTTGTTGAGACGGCCACGCCAAGACGTGCATTGGACACTTTCGGACAACGAACCTCGATCTATCGTGGTGTCACAAGACATCGATGGACTGGTCGATATGAGGCTCATCTATGGGATAATAGTTGTAGAAGGGAAGGCCAGTCTAGGAAAGGAAGACAAGTTTACTTGGGTGGATATGACAAAGAAGATAAAGCAGCAAGATCATATGATCTAGCTGCACTTAAGTACTGGGGTCCTTCAACTACTACTAATTTCCCCATTACAAACTACGAGAAAGAAGTAGAGGAAATGAAGCACATGACGAGACAAGAGTTCGTGGCTGCCATTAGAAGGAAAAGTAGTGGATTTTCGAGAGGCGCTTCGATGTATCGAGGAGTTACAAGGCATCACCAACATGGAAGATGGCAAGCAAGGATCGGCCGAGTCGCCGGAAACAAAGACCTCTACTTGGGAACTTTTAGCACTGAGGAAGAAGCAGCAGAAGCTTACGATATAGCTGCAATAAAGTTTAGAGGACTTAATGCAGTGACCAACTTCGAGATCAACCGGTACGACGTGAAAGCCATTCTAGAGAGTAGCACTCTTCCCATCGGAGGAGGCGCAGCTAAACGGCTCAAAGAAGCTCAAGCTCTTGAGTCTTCAAGGAAACGCGAGGCGGAGATGATAGCCCTTGGTTCAAGTTTCCAGTACGGTGGTGGCTCGAGCACAGGCTCTGGCTCCACCTCATCAAGACTTCAGCTTCAACCTTACCCTCTAAGCATTCAACAACCATTAGAGCCTTTTCTATCTCTTCAGAACAATGACATCTCTCATTACAACAACAACAATGCTCACGATTCCTCCTCTTTTAATCACCATAGCTATATCCAGACACAACTTCATCTCCACCAACAGACCAACAATTACTTGCAGCAACAGTCGAGCCAGAACTCTCAGCAGCTCTACAATGCGTATCTTCATAGCAATCCGGCTCTGCTTCATGGACTTGTCTCTACCTCTATCGTTGACAACAATAATAACAATGGAGGCTCTAGTGGGAGCTACAACACTGCAGCATTTCTTGGGAACCACGGTATTGGTATTGGGTCCAGCTCGACTGTTGGATCGACCGAGGAGTTTCCAACCGTTAAAACAGATTACGATATGCCTTCCAGTGATGGAACCGGAGGGTATAGTGGTTGGACCAGTGAGTCTGTTCAGGGGTCAAACCCTGGTGGTGTTTTCACTATGTGGAATGAGTAA
Protein Sequence
- >AT3G20840.1
MNSNNWLGFPLSPNNSSLPPHEYNLGLVSDHMDNPFQTQEWNMINPHGGGGDEGGEVPKVADFLGVSKPDENQSNHLVAYNDSDYYFHTNSLMPSVQSNDVVVAACDSNTPNNSSYHELQESAHNLQSLTLSMGTTAGNNVVDKASPSETTGDNASGGALAVVETATPRRALDTFGQRTSIYRGVTRHRWTGRYEAHLWDNSCRREGQSRKGRQVYLGGYDKEDKAARSYDLAALKYWGPSTTTNFPITNYEKEVEEMKHMTRQEFVAAIRRKSSGFSRGASMYRGVTRHHQHGRWQARIGRVAGNKDLYLGTFSTEEEAAEAYDIAAIKFRGLNAVTNFEINRYDVKAILESSTLPIGGGAAKRLKEAQALESSRKREAEMIALGSSFQYGGGSSTGSGSTSSRLQLQPYPLSIQQPLEPFLSLQNNDISHYNNNNAHDSSSFNHHSYIQTQLHLHQQTNNYLQQQSSQNSQQLYNAYLHSNPALLHGLVSTSIVDNNNNNGGSSGSYNTAAFLGNHGIGIGSSSTVGSTEEFPTVKTDYDMPSSDGTGGYSGWTSESVQGSNPGGVFTMWNE