Gene Details:
- Gene ID: AT3G20770
- Gene Symbol: AtEIN3, EIN3
- Gene Name: ETHYLENE-INSENSITIVE3
- Description: Ethylene insensitive 3 family protein;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Germplasm Phenotype:
- CS16710 — In the triple response assay, roots of the double mutant are shorter than those of ein3-1 alone; in the light, the sur2 cotyledon and leaf epinasty is visible.
- CS67819 — long roots and reducion in root hairs when grown on media supplemented with methyl jasmonate and ACC; fails to produce pollen at 22C, but is fertile at 16C.
- ebf1-3 ebf2-3 ein3-1 — More dramatic rescue of the ebf1-3 ebf2-3 phenotype. Seedlings grow rapidly after germination and eventually developed large rosette of true leaves. However the leaves are epinastic with elongated petioles and small leaf blades. Produced fertile but shorter flowers and viable seeds.
- ebf1-3 ebf2-3 ein3-1 eil1-3 — Almost complete rescue of the ebf1-3 ebf2-3 phenotype. Plants are phenotypically indistinguishable from the wild type.
- eer4; ein3-1 — eer4 partially restores the ethylene responsiveness to the ein3-1 mutant. Exposure of the eer4;ein3-1 mutant to saturating levels of ethylene results in moderate hypocotyl inhibition along with the generation of a pronounced apical hook.
Function-related keywords:
Literature:
- Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and ETHYLENE-RESPONSE-FACTOR1. DOI: 10.1101/gad.12.23.3703 ; PMID: 9851977
- The molecular basis of ethylene signalling in Arabidopsis. DOI: 10.1098/rstb.1998.0298 ; PMID: 9800206
- Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. DOI: 10.1016/s0092-8674(00)80300-1 ; PMID: 9215635
- Genetic analysis of ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress response pathway. DOI: 10.1093/genetics/139.3.1393 ; PMID: 7768447
- Ethylene signaling: from mutants to molecules. DOI: 10.1016/s1369-5266(00)00096-0 ; PMID: 11019801
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Susceptibility to the sugar beet cyst nematode is modulated by ethylene signal transduction in Arabidopsis thaliana. DOI: 10.1094/MPMI.2001.14.10.1206 ; PMID: 11605960
- Ethylene can stimulate Arabidopsis hypocotyl elongation in the light. DOI: 10.1073/pnas.94.6.2756 ; PMID: 11038610
- ERN1, a novel ethylene-regulated nuclear protein of Arabidopsis. DOI: 10.1023/a:1006438432198 ; PMID: 11094976
- Cloning of a cDNA encoding EIN3-like protein (DC-EIL1) and decrease in its mRNA level during senescence in carnation flower tissues. DOI: NA ; PMID: 11283184
- A MAPK pathway mediates ethylene signaling in plants. DOI: 10.1093/emboj/cdg131 ; PMID: 12628921
- Five components of the ethylene-response pathway identified in a screen for weak ethylene-insensitive mutants in Arabidopsis. DOI: 10.1073/pnas.0438070100 ; PMID: 12606727
- Sugar and hormone connections. DOI: 10.1016/S1360-1385(03)00011-6 ; PMID: 12663220
- Dominant repression of target genes by chimeric repressors that include the EAR motif, a repression domain, in Arabidopsis. DOI: 10.1046/j.1365-313x.2003.01759.x ; PMID: 12787253
- Molecular and biochemical characterization of VR-EILs encoding mung bean ETHYLENE INSENSITIVE3-LIKE proteins. DOI: 10.1104/pp.103.022574 ; PMID: 12857828
- Differential regulation of EIN3 stability by glucose and ethylene signalling in plants. DOI: 10.1038/nature01984 ; PMID: 14523448
- EIN3-dependent regulation of plant ethylene hormone signaling by two arabidopsis F box proteins: EBF1 and EBF2. DOI: 10.1016/s0092-8674(03)00968-1 ; PMID: 14675533
- Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EIN3 transcription factor. DOI: 10.1016/s0092-8674(03)00969-3 ; PMID: 14675532
- Characterisation of an Arabidopsis-Leptosphaeria maculans pathosystem: resistance partially requires camalexin biosynthesis and is independent of salicylic acid, ethylene and jasmonic acid signalling. DOI: 10.1046/j.1365-313x.2003.01927.x ; PMID: 14675428
- Ethylene advances the transition from vegetative growth to flowering in Arabidopsis thaliana. DOI: 10.1078/0176-1617-01129 ; PMID: 14658386
- The Arabidopsis thaliana ABSCISIC ACID-INSENSITIVE8 encodes a novel protein mediating abscisic acid and sugar responses essential for growth. DOI: 10.1105/tpc.018077 ; PMID: 14742875
- The ethylene signaling pathway: new insights. DOI: 10.1016/j.pbi.2003.11.011 ; PMID: 14732440
- Growth regulators and the control of nucleotide sugar flux. DOI: 10.1105/tpc.019661 ; PMID: 14973160
- Arabidopsis EIN3-binding F-box 1 and 2 form ubiquitin-protein ligases that repress ethylene action and promote growth by directing EIN3 degradation. DOI: 10.1073/pnas.0401698101 ; PMID: 15090654
- [Research progress of ethylene signal transduction in plants]. DOI: NA ; PMID: 15643078
- Arabidopsis ethylene signaling pathway. DOI: 10.1126/stke.2762005cm4 ; PMID: 15784880
- Immediate-early and delayed cytokinin response genes of Arabidopsis thaliana identified by genome-wide expression profiling reveal novel cytokinin-sensitive processes and suggest cytokinin action through transcriptional cascades. DOI: 10.1111/j.1365-313X.2005.02530.x ; PMID: 16212609
- Genes involved in biosynthesis and signalisation of ethylene in Brassica oleracea and Arabidopsis thaliana: identification and genome comparative mapping of specific gene homologues. DOI: 10.1007/s00122-005-0136-7 ; PMID: 16311726
- ETHYLENE-INSENSITIVE5 encodes a 5'–>3' exoribonuclease required for regulation of the EIN3-targeting F-box proteins EBF1/2. DOI: 10.1073/pnas.0605528103 ; PMID: 16920797
- Possible role of light in the maintenance of EIN3/EIL1 stability in Arabidopsis seedlings. DOI: 10.1016/j.bbrc.2006.09.074 ; PMID: 17011517
- The Arabidopsis EIN3 binding F-Box proteins EBF1 and EBF2 have distinct but overlapping roles in ethylene signaling. DOI: 10.1105/tpc.106.048140 ; PMID: 17307926
- The plant stress hormone ethylene controls floral transition via DELLA-dependent regulation of floral meristem-identity genes. DOI: 10.1073/pnas.0610717104 ; PMID: 17389366
- Characterization of the VIER F-BOX PROTEINE genes from Arabidopsis reveals their importance for plant growth and development. DOI: 10.1105/tpc.105.040675 ; PMID: 17435085
- Arabidopsis enhanced ethylene response 4 encodes an EIN3-interacting TFIID transcription factor required for proper ethylene response, including ERF1 induction. DOI: 10.1093/jxb/erm080 ; PMID: 17526916
- Ethylene is one of the key elements for cell death and defense response control in the Arabidopsis lesion mimic mutant vad1. DOI: 10.1104/pp.107.106302 ; PMID: 17720753
- MYB72 is required in early signaling steps of rhizobacteria-induced systemic resistance in Arabidopsis. DOI: 10.1104/pp.107.113829 ; PMID: 18218967
- The eer5 mutation, which affects a novel proteasome-related subunit, indicates a prominent role for the COP9 signalosome in resetting the ethylene-signaling pathway in Arabidopsis. DOI: 10.1111/j.1365-313X.2008.03521.x ; PMID: 18429939
- Ethylene signaling in Arabidopsis involves feedback regulation via the elaborate control of EBF2 expression by EIN3. DOI: 10.1111/j.1365-313X.2008.03551.x ; PMID: 18466304
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Mitogen-activated protein kinase cascades and ethylene: signaling, biosynthesis, or both? DOI: 10.1104/pp.108.132241 ; PMID: 19109412
- Tandem affinity purification and mass spectrometric analysis of ubiquitylated proteins in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.03862.x ; PMID: 19292762
- Dual control of nuclear EIN3 by bifurcate MAPK cascades in C2H4 signalling. DOI: 10.1038/nature06543 ; PMID: 18273012
- Genetic basis of ethylene perception and signal transduction in Arabidopsis. DOI: 10.1111/j.1744-7909.2008.00710.x ; PMID: 18713391
- F-box proteins regulate ethylene signaling and more. DOI: 10.1101/gad.1781609 ; PMID: 19240128
- Antagonism between abscisic acid and ethylene in Arabidopsis acts in parallel with the reciprocal regulation of their metabolism and signaling pathways. DOI: 10.1007/s11103-009-9509-7 ; PMID: 19513806
- MAPK signaling in plant hormone ethylene signal transduction. DOI: 10.4161/psb.3.10.5995 ; PMID: 19704518
- Arabidopsis-thrips system for analysis of plant response to insect feeding. DOI: 10.4161/psb.3.7.5556 ; PMID: 19704479
- ETHYLENE INSENSITIVE3 and ETHYLENE INSENSITIVE3-LIKE1 repress SALICYLIC ACID INDUCTION DEFICIENT2 expression to negatively regulate plant innate immunity in Arabidopsis. DOI: 10.1105/tpc.108.065193 ; PMID: 19717619
- EIN3/EIL1 cooperate with PIF1 to prevent photo-oxidation and to promote greening of Arabidopsis seedlings. DOI: 10.1073/pnas.0907670106 ; PMID: 19948955
- Ethylene signalling and ethylene-targeted transcription factors are required to balance beneficial and nonbeneficial traits in the symbiosis between the endophytic fungus Piriformospora indica and Arabidopsis thaliana. DOI: 10.1111/j.1469-8137.2009.03149.x ; PMID: 20085621
- Direct transcriptional control of the Arabidopsis immune receptor FLS2 by the ethylene-dependent transcription factors EIN3 and EIL1. DOI: 10.1073/pnas.1003347107 ; PMID: 20663954
- Ethylene-induced stabilization of ETHYLENE INSENSITIVE3 and EIN3-LIKE1 is mediated by proteasomal degradation of EIN3 binding F-box 1 and 2 that requires EIN2 in Arabidopsis. DOI: 10.1105/tpc.110.076588 ; PMID: 20647342
- Ethylene and nitric oxide involvement in the up-regulation of key genes related to iron acquisition and homeostasis in Arabidopsis. DOI: 10.1093/jxb/erq203 ; PMID: 20627899
- COI1, a jasmonate receptor, is involved in ethylene-induced inhibition of Arabidopsis root growth in the light. DOI: 10.1093/jxb/erq240 ; PMID: 20699268
- Ethylene suppression of sugar-induced anthocyanin pigmentation in Arabidopsis. DOI: 10.1104/pp.110.161869 ; PMID: 20876338
- Transcription factor AtMYB44 regulates induced expression of the ETHYLENE INSENSITIVE2 gene in Arabidopsis responding to a harpin protein. DOI: 10.1094/MPMI-07-10-0170 ; PMID: 21117868
- XAP5 CIRCADIAN TIMEKEEPER regulates ethylene responses in aerial tissues of Arabidopsis. DOI: 10.1104/pp.110.164277 ; PMID: 21163961
- Interaction between the bHLH transcription factor FIT and ETHYLENE INSENSITIVE3/ETHYLENE INSENSITIVE3-LIKE1 reveals molecular linkage between the regulation of iron acquisition and ethylene signaling in Arabidopsis. DOI: 10.1105/tpc.111.084715 ; PMID: 21586684
- EIN2 regulates salt stress response and interacts with a MA3 domain-containing protein ECIP1 in Arabidopsis. DOI: 10.1111/j.1365-3040.2011.02363.x ; PMID: 21631530
- rather than α-tocopherol alters ethylene signaling gene expression in the vte4 mutant of Arabidopsis thaliana. DOI: 10.1093/pcp/pcr085 ; PMID: 21719428
- Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis. DOI: 10.1073/pnas.1103959108 ; PMID: 21737749
- Biochemical and genetic requirements for function of the immune response regulator BOTRYTIS-INDUCED KINASE1 in plant growth, ethylene signaling, and PAMP-triggered immunity in Arabidopsis. DOI: 10.1105/tpc.111.087122 ; PMID: 21862710
- An AP2 domain-containing gene, ESE1, targeted by the ethylene signaling component EIN3 is important for the salt response in Arabidopsis. DOI: 10.1104/pp.111.179028 ; PMID: 21832142
- Enhanced Y1H assays for Arabidopsis. DOI: 10.1038/nmeth.1750 ; PMID: 22037706
- A small-molecule screen identifies L-kynurenine as a competitive inhibitor of TAA1/TAR activity in ethylene-directed auxin biosynthesis and root growth in Arabidopsis. DOI: 10.1105/tpc.111.089029 ; PMID: 22108404
- Repression of the Arabidopsis thaliana jasmonic acid/ethylene-induced defense pathway by TGA-interacting glutaredoxins depends on their C-terminal ALWL motif. DOI: 10.1093/mp/ssr113 ; PMID: 22207719
- Glycolate oxidase modulates reactive oxygen species-mediated signal transduction during nonhost resistance in Nicotiana benthamiana and Arabidopsis. DOI: 10.1105/tpc.111.093245 ; PMID: 22286136
- Coordinated regulation of apical hook development by gibberellins and ethylene in etiolated Arabidopsis seedlings. DOI: 10.1038/cr.2012.29 ; PMID: 22349459
- SR1, a calmodulin-binding transcription factor, modulates plant defense and ethylene-induced senescence by directly regulating NDR1 and EIN3. DOI: 10.1104/pp.111.192310 ; PMID: 22345509
- Arabidopsis RAP2.2 plays an important role in plant resistance to Botrytis cinerea and ethylene responses. DOI: 10.1111/j.1469-8137.2012.04160.x ; PMID: 22530619
- Transcriptome analysis of ein3 eil1 mutants in response to iron deficiency. DOI: 10.4161/psb.6.11.17847 ; PMID: 22212120
- Ethylene signaling negatively regulates freezing tolerance by repressing expression of CBF and type-A ARR genes in Arabidopsis. DOI: 10.1105/tpc.112.098640 ; PMID: 22706288
- A molecular framework of light-controlled phytohormone action in Arabidopsis. DOI: 10.1016/j.cub.2012.06.039 ; PMID: 22818915
- and light-regulated hypocotyl elongation. DOI: 10.1007/s00425-012-1730-y ; PMID: 22890836
- The nitrate transporter NRT2.1 functions in the ethylene response to nitrate deficiency in Arabidopsis. DOI: 10.1111/pce.12062 ; PMID: 23305042
- GDSL LIPASE1 modulates plant immunity through feedback regulation of ethylene signaling. DOI: 10.1104/pp.113.225649 ; PMID: 24170202
- The Arabidopsis Mediator subunit MED16 regulates iron homeostasis by associating with EIN3/EIL1 through subunit MED25. DOI: 10.1111/tpj.12440 ; PMID: 24456400
- Interaction between MYC2 and ETHYLENE INSENSITIVE3 modulates antagonism between jasmonate and ethylene signaling in Arabidopsis. DOI: 10.1105/tpc.113.120394 ; PMID: 24399301
- A DELLA gene, RhGAI1, is a direct target of EIN3 and mediates ethylene-regulated rose petal cell expansion via repressing the expression of RhCesA2. DOI: 10.1093/jxb/ert296 ; PMID: 24014864
- Ethylene plays an essential role in the recovery of Arabidopsis during post-anaerobiosis reoxygenation. DOI: 10.1111/pce.12292 ; PMID: 24506560
- Jasmonate-activated MYC2 represses ETHYLENE INSENSITIVE3 activity to antagonize ethylene-promoted apical hook formation in Arabidopsis. DOI: 10.1105/tpc.113.122002 ; PMID: 24668749
- Gene regulatory cascade of senescence-associated NAC transcription factors activated by ETHYLENE-INSENSITIVE2-mediated leaf senescence signalling in Arabidopsis. DOI: 10.1093/jxb/eru112 ; PMID: 24659488
- GDSL lipase 1 regulates ethylene signaling and ethylene-associated systemic immunity in Arabidopsis. DOI: 10.1016/j.febslet.2014.02.062 ; PMID: 24631536
- Ethylene-orchestrated circuitry coordinates a seedling's response to soil cover and etiolated growth. DOI: 10.1073/pnas.1402491111 ; PMID: 24599595
- Ethylene promotes hypocotyl growth and HY5 degradation by enhancing the movement of COP1 to the nucleus in the light. DOI: 10.1371/journal.pgen.1004025 ; PMID: 24348273
- Salt-induced stabilization of EIN3/EIL1 confers salinity tolerance by deterring ROS accumulation in Arabidopsis. DOI: 10.1371/journal.pgen.1004664 ; PMID: 25330213
- The Arabidopsis ethylene/jasmonic acid-NRT signaling module coordinates nitrate reallocation and the trade-off between growth and environmental adaptation. DOI: 10.1105/tpc.114.129296 ; PMID: 25326291
- Arabidopsis acyl-CoA-binding protein ACBP3 participates in plant response to hypoxia by modulating very-long-chain fatty acid metabolism. DOI: 10.1111/tpj.12692 ; PMID: 25284079
- Arabidopsis ROOT HAIR DEFECTIVE3 is involved in nitrogen starvation-induced anthocyanin accumulation. DOI: 10.1111/jipb.12320 ; PMID: 25494721
- Heterotrimeric G protein mediates ethylene-induced stomatal closure via hydrogen peroxide synthesis in Arabidopsis. DOI: 10.1111/tpj.12799 ; PMID: 25704455
- Regulatory role of BOTRYTIS INDUCED KINASE1 in ETHYLENE INSENSITIVE3-dependent gene expression in Arabidopsis. DOI: 10.1007/s00299-015-1812-y ; PMID: 26021844
- Ethylene Inhibits Root Elongation during Alkaline Stress through AUXIN1 and Associated Changes in Auxin Accumulation. DOI: 10.1104/pp.15.00523 ; PMID: 26109425
- PHYTOCHROME-INTERACTING FACTOR 5 (PIF5) positively regulates dark-induced senescence and chlorophyll degradation in Arabidopsis. DOI: 10.1016/j.plantsci.2015.05.010 ; PMID: 26089152
- Mitogen-Activated Protein Kinase 6 and Ethylene and Auxin Signaling Pathways Are Involved in Arabidopsis Root-System Architecture Alterations by Trichoderma atroviride. DOI: 10.1094/MPMI-01-15-0005-R ; PMID: 26067203
- Ethylene Inhibits Cell Proliferation of the Arabidopsis Root Meristem. DOI: 10.1104/pp.15.00415 ; PMID: 26149574
- EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in Arabidopsis. DOI: 10.1371/journal.pgen.1005399 ; PMID: 26218222
- Mitogen-activated protein kinase 6 mediates nuclear translocation of ORE3 to promote ORE9 gene expression in methyl jasmonate-induced leaf senescence. DOI: 10.1093/jxb/erv438 ; PMID: 26507893
- Quantitative and Functional Phosphoproteomic Analysis Reveals that Ethylene Regulates Water Transport via the C-Terminal Phosphorylation of Aquaporin PIP2;1 in Arabidopsis. DOI: 10.1016/j.molp.2015.10.001 ; PMID: 26476206
- NO Promotes Seed Germination and Seedling Growth Under High Salt May Depend on EIN3 Protein in Arabidopsis. DOI: 10.3389/fpls.2015.01203 ; PMID: 26779234
- Serotonin modulates Arabidopsis root growth via changes in reactive oxygen species and jasmonic acid-ethylene signaling. DOI: 10.1111/ppl.12429 ; PMID: 26864878
- Salt Stress and Ethylene Antagonistically Regulate Nucleocytoplasmic Partitioning of COP1 to Control Seed Germination. DOI: 10.1104/pp.15.01724 ; PMID: 26850275
- The Molecular Mechanism of Ethylene-Mediated Root Hair Development Induced by Phosphate Starvation. DOI: 10.1371/journal.pgen.1006194 ; PMID: 27427911
- Local Transcriptional Control of YUCCA Regulates Auxin Promoted Root-Growth Inhibition in Response to Aluminium Stress in Arabidopsis. DOI: 10.1371/journal.pgen.1006360 ; PMID: 27716807
- Diverse roles of jasmonates and ethylene in abiotic stress tolerance. DOI: 10.1016/j.tplants.2015.02.001 ; PMID: 25731753
- Activation of HLS1 by Mechanical Stress via Ethylene-Stabilized EIN3 Is Crucial for Seedling Soil Emergence. DOI: 10.3389/fpls.2016.01571 ; PMID: 27822221
- Establishment of Expression in the SHORTROOT-SCARECROW Transcriptional Cascade through Opposing Activities of Both Activators and Repressors. DOI: 10.1016/j.devcel.2016.09.031 ; PMID: 27923776
- EIN3 interferes with the sulfur deficiency signaling in Arabidopsis thaliana through direct interaction with the SLIM1 transcription factor. DOI: 10.1016/j.plantsci.2016.09.002 ; PMID: 27968996
- EIN3 and SOS2 synergistically modulate plant salt tolerance. DOI: 10.1038/srep44637 ; PMID: 28300216
- Ethylene Improves Root System Development under Cadmium Stress by Modulating Superoxide Anion Concentration in Arabidopsis thaliana. DOI: 10.3389/fpls.2017.00253 ; PMID: 28286514
- Type B Response Regulators Act As Central Integrators in Transcriptional Control of the Auxin Biosynthesis Enzyme TAA1. DOI: 10.1104/pp.17.00878 ; PMID: 28931628
- EIN3 and PIF3 Form an Interdependent Module That Represses Chloroplast Development in Buried Seedlings. DOI: 10.1105/tpc.17.00508 ; PMID: 29114016
- Ethylene promotes root hair growth through coordinated EIN3/EIL1 and RHD6/RSL1 activity in Arabidopsis. DOI: 10.1073/pnas.1711723115 ; PMID: 29233944
- Identification of Transcriptional and Receptor Networks That Control Root Responses to Ethylene. DOI: 10.1104/pp.17.00907 ; PMID: 29259106
- Brassinosteroids regulate root growth by controlling reactive oxygen species homeostasis and dual effect on ethylene synthesis in Arabidopsis. DOI: 10.1371/journal.pgen.1007144 ; PMID: 29324765
- Integration of Environmental and Developmental (or Metabolic) Control of Seed Mass by Sugar and Ethylene Metabolisms in Arabidopsis. DOI: 10.1021/acs.jafc.7b05992 ; PMID: 29528636
- The plant hormone ethylene restricts Arabidopsis growth via the epidermis. DOI: 10.1073/pnas.1717649115 ; PMID: 29643073
- Genome-wide regulation of light-controlled seedling morphogenesis by three families of transcription factors. DOI: 10.1073/pnas.1803861115 ; PMID: 29844157
- Ethylene promotes cadmium-induced root growth inhibition through EIN3 controlled XTH33 and LSU1 expression in Arabidopsis. DOI: 10.1111/pce.13361 ; PMID: 29869796
- ERF72 interacts with ARF6 and BZR1 to regulate hypocotyl elongation in Arabidopsis. DOI: 10.1093/jxb/ery220 ; PMID: 29897568
- High ambient temperature antagonizes ethylene-induced exaggerated apical hook formation in etiolated Arabidopsis seedlings. DOI: 10.1111/pce.13417 ; PMID: 30088270
- Integrated Regulation of Apical Hook Development by Transcriptional Coupling of EIN3/EIL1 and PIFs in Arabidopsis. DOI: 10.1105/tpc.18.00018 ; PMID: 30104405
- Sucrose Signaling Regulates Anthocyanin Biosynthesis Through a MAPK Cascade in Arabidopsis thaliana. DOI: 10.1534/genetics.118.301470 ; PMID: 30143593
- Jasmonate promotes auxin-induced adventitious rooting in dark-grown Arabidopsis thaliana seedlings and stem thin cell layers by a cross-talk with ethylene signalling and a modulation of xylogenesis. DOI: 10.1186/s12870-018-1392-4 ; PMID: 30189848
- HOMEOBOX PROTEIN52 Mediates the Crosstalk between Ethylene and Auxin Signaling during Primary Root Elongation by Modulating Auxin Transport-Related Gene Expression. DOI: 10.1105/tpc.18.00584 ; PMID: 30333147
- Ascorbic Acid Integrates the Antagonistic Modulation of Ethylene and Abscisic Acid in the Accumulation of Reactive Oxygen Species. DOI: 10.1104/pp.18.01250 ; PMID: 30723177
- Unravelling calcium-alleviated aluminium toxicity in Arabidopsis thaliana: Insights into regulatory mechanisms using proteomics. DOI: 10.1016/j.jprot.2019.02.013 ; PMID: 30822537
- ETR1 Integrates Response to Ethylene and Cytokinins into a Single Multistep Phosphorelay Pathway to Control Root Growth. DOI: 10.1016/j.molp.2019.05.012 ; PMID: 31176773
- Shaping Ethylene Response: The Role of EIN3/EIL1 Transcription Factors. DOI: 10.3389/fpls.2019.01030 ; PMID: 31507622
- Low Temperature Enhances Plant Immunity via Salicylic Acid Pathway Genes That Are Repressed by Ethylene. DOI: 10.1104/pp.19.01130 ; PMID: 31694900
- Salicylic Acid Suppresses Apical Hook Formation via NPR1-Mediated Repression of EIN3 and EIL1 in Arabidopsis. DOI: 10.1105/tpc.19.00658 ; PMID: 31888966
- Ethylene mediates salicylic-acid-induced stomatal closure by controlling reactive oxygen species and nitric oxide production in Arabidopsis. DOI: 10.1016/j.plantsci.2020.110464 ; PMID: 32234220
- ETHYLENE INSENSITIVE 3 suppresses plant de novo root regeneration from leaf explants and mediates age-regulated regeneration decline. DOI: 10.1242/dev.179457 ; PMID: 32291272
- Target of Rapamycin (TOR) Negatively Regulates Ethylene Signals in Arabidopsis. DOI: 10.3390/ijms21082680 ; PMID: 32290539
- Diverse contributions of MYC2 and EIN3 in the regulation of Arabidopsis jasmonate-responsive gene expression. DOI: 10.1002/pld3.15 ; PMID: 31245664
- Cytosolic Invertase-Mediated Root Growth Is Feedback Regulated by a Glucose-Dependent Signaling Loop. DOI: 10.1104/pp.20.00778 ; PMID: 32820066
- The nature of the interaction Azospirillum-Arabidopsis determine the molecular and morphological changes in root and plant growth promotion. DOI: 10.1007/s00709-020-01552-7 ; PMID: 33009649
- TREE1-EIN3-mediated transcriptional repression inhibits shoot growth in response to ethylene. DOI: 10.1073/pnas.2018735117 ; PMID: 33139535
- A Salt-Signaling Network Involving Ethylene, Extracellular ATP, Hydrogen Peroxide, and Calcium Mediates K(+)/Na(+) Homeostasis in Arabidopsis. DOI: 10.3390/ijms21228683 ; PMID: 33213111
- Salicylic acid and ethylene coordinately promote leaf senescence. DOI: 10.1111/jipb.13074 ; PMID: 33501782
- Ethylene and salicylic acid synergistically accelerate leaf senescence in Arabidopsis. DOI: 10.1111/jipb.13075 ; PMID: 33501715
- JASMONATE RESISTANT 1 negatively regulates root growth under boron deficiency in Arabidopsis. DOI: 10.1093/jxb/erab041 ; PMID: 33530106
- MYB30 and ETHYLENE INSENSITIVE3 antagonistically modulate root hair growth in Arabidopsis. DOI: 10.1111/tpj.15180 ; PMID: 33529413
- The RING E3 ligase SDIR1 destabilizes EBF1/EBF2 and modulates the ethylene response to ambient temperature fluctuations in Arabidopsis. DOI: 10.1073/pnas.2024592118 ; PMID: 33526703
- Ethylene-induced stomatal closure is mediated via MKK1/3-MPK3/6 cascade to EIN2 and EIN3. DOI: 10.1111/jipb.13083 ; PMID: 33605510
- EIN3-Mediated Ethylene Signaling Attenuates Auxin Response during Hypocotyl Thermomorphogenesis. DOI: 10.1093/pcp/pcab028 ; PMID: 33594435
- GENOMES UNCOUPLED1-independent retrograde signaling targets the ethylene pathway to repress photomorphogenesis. DOI: 10.1093/plphys/kiaa015 ; PMID: 33631804
- Tuning self-renewal in the Arabidopsis stomatal lineage by hormone and nutrient regulation of asymmetric cell division. DOI: 10.7554/eLife.63335 ; PMID: 33739283
- The microtubule-associated protein WDL4 modulates auxin distribution to promote apical hook opening in Arabidopsis. DOI: 10.1093/plcell/koab080 ; PMID: 33730147
- Two interacting ethylene response factors regulate heat stress response. DOI: 10.1093/plcell/koaa026 ; PMID: 33793870
- Influence of Ethylene Signaling in the Crosstalk Between Fe, S, and P Deficiency Responses in Arabidopsis thaliana. DOI: 10.3389/fpls.2021.643585 ; PMID: 33859661
- MYB30 and ETHYLENE INSENEITIVE3 antagonistically regulate root hair growth and phosphorus uptake under phosphate deficiency in Arabidopsis. DOI: 10.1080/15592324.2021.1913310 ; PMID: 33853500
- A dual mode of ethylene actions contributes to the optimization of hypocotyl growth under fluctuating temperature environments. DOI: 10.1080/15592324.2021.1926131 ; PMID: 33975509
- Endogenous stress-related signal directs shoot stem cell fate in Arabidopsis thaliana. DOI: 10.1038/s41477-021-00985-z ; PMID: 34354259
- UV RESISTANCE LOCUS8 mediates ultraviolet-B-induced stomatal closure in an ethylene-dependent manner. DOI: 10.1016/j.plantsci.2020.110679 ; PMID: 33218642
- Interaction between BZR1 and EIN3 mediates signalling crosstalk between brassinosteroids and ethylene. DOI: 10.1111/nph.17694 ; PMID: 34449890
- Cytokinin regulates apical hook development via the coordinated actions of EIN3/EIL1 and PIF transcription factors in Arabidopsis. DOI: 10.1093/jxb/erab403 ; PMID: 34459884
- Nitrogen form-mediated ethylene signal regulates root-to-shoot K(+) translocation via NRT1.5. DOI: 10.1111/pce.14182 ; PMID: 34505300
- Lack of ethylene does not affect reproductive success and synergid cell death in Arabidopsis. DOI: 10.1016/j.molp.2021.11.001 ; PMID: 34740849
- SAV4 is required for ethylene-induced root hair growth through stabilizing PIN2 auxin transporter in Arabidopsis. DOI: 10.1111/nph.18079 ; PMID: 35274300
- Ethylene regulates miRNA-mediated lignin biosynthesis and leaf serration in Arabidopsis thaliana. DOI: 10.1016/j.bbrc.2022.03.037 ; PMID: 35316763
- CLE42 delays leaf senescence by antagonizing ethylene pathway in Arabidopsis. DOI: 10.1111/nph.18154 ; PMID: 35396726
- Jasmonate Hypersensitive 3 negatively regulates both jasmonate and ethylene-mediated responses in Arabidopsis. DOI: 10.1093/jxb/erac208 ; PMID: 35552406
- Arabidopsis ETHYLENE INSENSITIVE 3 directly regulates the expression of PG1β-like family genes in response to aluminum stress. DOI: 10.1093/jxb/erac161 ; PMID: 35661874
- A molecular framework for signaling crosstalk between jasmonate and ethylene in anthocyanin biosynthesis, trichome development, and defenses against insect herbivores in Arabidopsis. DOI: 10.1111/jipb.13319 ; PMID: 35763421
- The carboxy terminal transmembrane domain of SPL7 mediates interaction with RAN1 at the endoplasmic reticulum to regulate ethylene signalling in Arabidopsis. DOI: 10.1111/nph.18376 ; PMID: 35832006
- Ethylene Plays a Dual Role during Infection by Plasmodiophora brassicae of Arabidopsis thaliana. DOI: 10.3390/genes13081299 ; PMID: 35893035
- Ethylene Acts as a Local and Systemic Signal to Mediate UV-B-Induced Nitrate Reallocation to Arabidopsis Leaves and Roots via Regulating the ERFs-NRT1.8 Signaling Module. DOI: 10.3390/ijms23169068 ; PMID: 36012333
- Long-distance transport of sucrose in source leaves promotes sink root growth by the EIN3-SUC2 module. DOI: 10.1371/journal.pgen.1010424 ; PMID: 36129930
- The C-Terminal Region of SLIM1 Transcription Factor Is Required for Sulfur Deficiency Response. DOI: 10.3390/plants11192595 ; PMID: 36235462
- Ethylene Activates the EIN2-EIN3/EIL1 Signaling Pathway in Tapetum and Disturbs Anther Development in Arabidopsis. DOI: 10.3390/cells11193177 ; PMID: 36231139
- Brassinosteroids promote etiolated apical structures in darkness by amplifying the ethylene response via the EBF-EIN3/PIF3 circuit. DOI: 10.1093/plcell/koac316 ; PMID: 36321994
- The AP2 transcription factors TOE1/TOE2 convey Arabidopsis age information to ethylene signaling in plant de novo root regeneration. DOI: 10.1007/s00425-022-04034-7 ; PMID: 36409377
- ETHYLENE INSENSITIVE3/EIN3-LIKE1 modulate FLOWERING LOCUS C expression via histone demethylase interaction. DOI: 10.1093/plphys/kiad131 ; PMID: 36852894
- Scaffold protein RACK1A positively regulates leaf senescence by coordinating the EIN3-miR164-ORE1 transcriptional cascade in Arabidopsis. DOI: 10.1111/jipb.13483 ; PMID: 36939002
- Arabidopsis EIN2 represses ABA responses during germination and early seedling growth by inactivating HLS1 protein independently of the canonical ethylene pathway. DOI: 10.1111/tpj.16335 ; PMID: 37269223
- Hypoxia response protein HRM1 modulates the activity of mitochondrial electron transport chain in Arabidopsis under hypoxic stress. DOI: 10.1111/nph.19006 ; PMID: 37301985
- Sugar status in preexisting leaves determines systemic stomatal development within newly developing leaves. DOI: 10.1073/pnas.2302854120 ; PMID: 37276396
- Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. DOI: 10.1016/s0092-8674(00)80300-1 ; PMID: 9215635
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Five components of the ethylene-response pathway identified in a screen for weak ethylene-insensitive mutants in Arabidopsis. DOI: 10.1073/pnas.0438070100 ; PMID: 12606727
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
- Ethylene signaling in Arabidopsis involves feedback regulation via the elaborate control of EBF2 expression by EIN3. DOI: 10.1111/j.1365-313X.2008.03551.x ; PMID: 18466304
- EIN3/EIL1 cooperate with PIF1 to prevent photo-oxidation and to promote greening of Arabidopsis seedlings. DOI: 10.1073/pnas.0907670106 ; PMID: 19948955
Sequences:
cDNA Sequence
- >AT3G20770.1
AGTATATATACTATGATCTATCTTCCTGATCTACAGAGAGACTCCACAAAGAAACGCAAATAAACAAAAGTCGCTTTCTAGCCACGTGATCTTTCGTCGACTTTTCTTCTTCTTCTTCTTCTTCCTCTTCCTCATCTCGTATCTCTAACTTTTGTCGAAGTTCTTTTGATGAAACTAGGGTTTATTATCTTCTCCTTCTTTTTCCCATCACCATAGAAAAGGCAGAGACCTTTTTCTTCATCATTTTTATTCTCCTTCTTCTTCTGCTGTTCATTTCTCCAGGTTACAATGATGTTTAATGAGATGGGAATGTGTGGAAACATGGATTTCTTCTCTTCTGGATCACTTGGTGAAGTTGATTTCTGTCCTGTTCCACAAGCTGAGCCTGATTCCATTGTTGAAGATGACTATACTGATGATGAGATTGATGTTGATGAATTGGAGAGGAGGATGTGGAGAGACAAAATGCGGCTTAAACGTCTCAAGGAGCAGGATAAGGGTAAAGAAGGTGTTGATGCTGCTAAACAGAGGCAGTCTCAAGAGCAAGCTAGGAGGAAGAAAATGTCTAGAGCTCAAGATGGGATCTTGAAGTATATGTTGAAGATGATGGAAGTTTGTAAAGCTCAAGGCTTTGTTTATGGGATTATTCCGGAGAATGGGAAGCCTGTGACTGGTGCTTCTGATAATTTAAGGGAGTGGTGGAAAGATAAGGTTAGGTTTGATCGTAATGGTCCTGCGGCTATTACCAAGTATCAAGCGGAGAATAATATCCCGGGGATTCATGAAGGTAATAACCCGATTGGACCGACTCCTCATACCTTGCAAGAGCTTCAAGACACGACTCTTGGATCGCTTTTGTCTGCGTTGATGCAACACTGTGATCCTCCTCAGAGACGTTTTCCTTTGGAGAAAGGAGTTCCTCCTCCGTGGTGGCCTAATGGGAAAGAGGATTGGTGGCCTCAACTTGGTTTGCCTAAAGATCAAGGTCCTGCACCTTACAAGAAGCCTCATGATTTGAAGAAGGCGTGGAAAGTCGGCGTTTTGACTGCGGTTATCAAGCATATGTTTCCTGATATTGCTAAGATCCGTAAGCTCGTGAGGCAATCTAAATGTTTGCAGGATAAGATGACTGCTAAAGAGAGTGCTACCTGGCTTGCTATTATTAACCAAGAAGAGTCCTTGGCTAGAGAGCTTTATCCCGAGTCATGTCCACCTCTTTCTCTGTCTGGTGGAAGTTGCTCGCTTCTGATGAATGATTGCAGTCAATACGATGTTGAAGGTTTCGAGAAGGAGTCTCACTATGAAGTGGAAGAGCTCAAGCCAGAAAAAGTTATGAATTCTTCAAACTTTGGGATGGTTGCTAAAATGCATGACTTTCCTGTCAAAGAAGAAGTCCCAGCAGGAAACTCGGAATTCATGAGAAAGAGAAAGCCAAACAGAGATCTGAACACTATTATGGACAGAACCGTTTTCACCTGCGAGAATCTTGGGTGTGCGCACAGCGAAATCAGCCGGGGATTTCTGGATAGGAATTCGAGAGACAACCATCAACTGGCATGTCCACATCGAGACAGTCGCTTACCGTATGGAGCAGCACCATCCAGGTTTCATGTCAATGAAGTTAAGCCTGTAGTTGGATTTCCTCAGCCAAGGCCAGTGAACTCAGTAGCCCAACCAATTGACTTAACGGGTATAGTTCCTGAAGATGGACAGAAGATGATCTCAGAGCTCATGTCCATGTACGACAGAAATGTCCAGAGCAACCAAACCTCTATGGTCATGGAAAATCAAAGCGTGTCACTGCTTCAACCCACAGTCCATAACCATCAAGAACATCTCCAGTTCCCAGGAAACATGGTGGAAGGAAGTTTCTTTGAAGACTTGAACATCCCAAACAGAGCAAACAACAACAACAGCAGCAACAATCAAACGTTTTTTCAAGGGAACAACAACAACAACAATGTGTTTAAGTTCGACACTGCAGATCACAACAACTTTGAAGCTGCACATAACAACAACAATAACAGTAGCGGCAACAGGTTCCAGCTTGTGTTTGATTCCACACCGTTCGACATGGCGTCATTCGATTACAGAGATGATATGTCGATGCCAGGAGTAGTAGGAACGATGGATGGAATGCAGCAGAAGCAGCAAGATGTATCCATATGGTTCTAAAGTCTTGGTAGTAGATTTCATCTTCTCTTATTTTTATCTTTTGTGTTCTTACATTCACTCAACCATGTAATATTTTTTCCTGGGTCTCTCTGTCTCTATCGCTTGTTATGATGTGTCTGTAAGAGTCTCTAAAAACTCTCTGTTACTGTGTGTCTTTGTCTCGGCTTGGTGAATCTCTCTGTCATCATCAGCTTTTAGTTACACACCCGACTTGGGGATGAACGAACACTAAATGTAAGTTTTCATAATATAAATATATTTGCAAGCTCTCTT
CDS Sequence
- >AT3G20770.1
ATGATGTTTAATGAGATGGGAATGTGTGGAAACATGGATTTCTTCTCTTCTGGATCACTTGGTGAAGTTGATTTCTGTCCTGTTCCACAAGCTGAGCCTGATTCCATTGTTGAAGATGACTATACTGATGATGAGATTGATGTTGATGAATTGGAGAGGAGGATGTGGAGAGACAAAATGCGGCTTAAACGTCTCAAGGAGCAGGATAAGGGTAAAGAAGGTGTTGATGCTGCTAAACAGAGGCAGTCTCAAGAGCAAGCTAGGAGGAAGAAAATGTCTAGAGCTCAAGATGGGATCTTGAAGTATATGTTGAAGATGATGGAAGTTTGTAAAGCTCAAGGCTTTGTTTATGGGATTATTCCGGAGAATGGGAAGCCTGTGACTGGTGCTTCTGATAATTTAAGGGAGTGGTGGAAAGATAAGGTTAGGTTTGATCGTAATGGTCCTGCGGCTATTACCAAGTATCAAGCGGAGAATAATATCCCGGGGATTCATGAAGGTAATAACCCGATTGGACCGACTCCTCATACCTTGCAAGAGCTTCAAGACACGACTCTTGGATCGCTTTTGTCTGCGTTGATGCAACACTGTGATCCTCCTCAGAGACGTTTTCCTTTGGAGAAAGGAGTTCCTCCTCCGTGGTGGCCTAATGGGAAAGAGGATTGGTGGCCTCAACTTGGTTTGCCTAAAGATCAAGGTCCTGCACCTTACAAGAAGCCTCATGATTTGAAGAAGGCGTGGAAAGTCGGCGTTTTGACTGCGGTTATCAAGCATATGTTTCCTGATATTGCTAAGATCCGTAAGCTCGTGAGGCAATCTAAATGTTTGCAGGATAAGATGACTGCTAAAGAGAGTGCTACCTGGCTTGCTATTATTAACCAAGAAGAGTCCTTGGCTAGAGAGCTTTATCCCGAGTCATGTCCACCTCTTTCTCTGTCTGGTGGAAGTTGCTCGCTTCTGATGAATGATTGCAGTCAATACGATGTTGAAGGTTTCGAGAAGGAGTCTCACTATGAAGTGGAAGAGCTCAAGCCAGAAAAAGTTATGAATTCTTCAAACTTTGGGATGGTTGCTAAAATGCATGACTTTCCTGTCAAAGAAGAAGTCCCAGCAGGAAACTCGGAATTCATGAGAAAGAGAAAGCCAAACAGAGATCTGAACACTATTATGGACAGAACCGTTTTCACCTGCGAGAATCTTGGGTGTGCGCACAGCGAAATCAGCCGGGGATTTCTGGATAGGAATTCGAGAGACAACCATCAACTGGCATGTCCACATCGAGACAGTCGCTTACCGTATGGAGCAGCACCATCCAGGTTTCATGTCAATGAAGTTAAGCCTGTAGTTGGATTTCCTCAGCCAAGGCCAGTGAACTCAGTAGCCCAACCAATTGACTTAACGGGTATAGTTCCTGAAGATGGACAGAAGATGATCTCAGAGCTCATGTCCATGTACGACAGAAATGTCCAGAGCAACCAAACCTCTATGGTCATGGAAAATCAAAGCGTGTCACTGCTTCAACCCACAGTCCATAACCATCAAGAACATCTCCAGTTCCCAGGAAACATGGTGGAAGGAAGTTTCTTTGAAGACTTGAACATCCCAAACAGAGCAAACAACAACAACAGCAGCAACAATCAAACGTTTTTTCAAGGGAACAACAACAACAACAATGTGTTTAAGTTCGACACTGCAGATCACAACAACTTTGAAGCTGCACATAACAACAACAATAACAGTAGCGGCAACAGGTTCCAGCTTGTGTTTGATTCCACACCGTTCGACATGGCGTCATTCGATTACAGAGATGATATGTCGATGCCAGGAGTAGTAGGAACGATGGATGGAATGCAGCAGAAGCAGCAAGATGTATCCATATGGTTCTAA
Protein Sequence
- >AT3G20770.1
MMFNEMGMCGNMDFFSSGSLGEVDFCPVPQAEPDSIVEDDYTDDEIDVDELERRMWRDKMRLKRLKEQDKGKEGVDAAKQRQSQEQARRKKMSRAQDGILKYMLKMMEVCKAQGFVYGIIPENGKPVTGASDNLREWWKDKVRFDRNGPAAITKYQAENNIPGIHEGNNPIGPTPHTLQELQDTTLGSLLSALMQHCDPPQRRFPLEKGVPPPWWPNGKEDWWPQLGLPKDQGPAPYKKPHDLKKAWKVGVLTAVIKHMFPDIAKIRKLVRQSKCLQDKMTAKESATWLAIINQEESLARELYPESCPPLSLSGGSCSLLMNDCSQYDVEGFEKESHYEVEELKPEKVMNSSNFGMVAKMHDFPVKEEVPAGNSEFMRKRKPNRDLNTIMDRTVFTCENLGCAHSEISRGFLDRNSRDNHQLACPHRDSRLPYGAAPSRFHVNEVKPVVGFPQPRPVNSVAQPIDLTGIVPEDGQKMISELMSMYDRNVQSNQTSMVMENQSVSLLQPTVHNHQEHLQFPGNMVEGSFFEDLNIPNRANNNNSSNNQTFFQGNNNNNNVFKFDTADHNNFEAAHNNNNNSSGNRFQLVFDSTPFDMASFDYRDDMSMPGVVGTMDGMQQKQQDVSIWF