Information report for AT3G17820
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009010 — seed — semilla (Spanish, exact), 種子 (Japanese, exact), pyrene (narrow), diaspore (broad)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- GO:0022626 — located in — cytosolic ribosome
- GO:0005829 — located in — cytosol
- GO:0042128 — acts upstream of or within — nitrate assimilation
- GO:0004356 — enables — glutamine synthetase activity
- GO:0005507 — enables — copper ion binding
- GO:0006542 — acts upstream of or within — glutamine biosynthetic process
- GO:0005886 — located in — plasma membrane
- GO:0006542 — involved in — glutamine biosynthetic process
- GO:0009507 — located in — chloroplast
- GO:0005737 — located in — cytoplasm
- GO:0005737 — is active in — cytoplasm
Functional Keywords
- root , seed , pollen tube cell , pollen
Literature and News
- Carbon and amino acids reciprocally modulate the expression of glutamine synthetase in Arabidopsis. DOI: 10.1104/pp.121.1.301 ; PMID: 10482686
- The glutamine synthetase gene family of Arabidopsis thaliana: light-regulation and differential expression in leaves, roots and seeds. DOI: 10.1007/BF00290662 ; PMID: 1684022
- Kinetic properties and ammonium-dependent regulation of cytosolic isoenzymes of glutamine synthetase in Arabidopsis. DOI: 10.1074/jbc.M313710200 ; PMID: 14757761
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- Comparative transcriptome analysis reveals significant differences in gene expression and signalling pathways between developmental and dark/starvation-induced senescence in Arabidopsis. DOI: 10.1111/j.1365-313X.2005.02399.x ; PMID: 15860015
- Extracellular ATP functions as an endogenous external metabolite regulating plant cell viability. DOI: 10.1105/tpc.105.036806 ; PMID: 16199612
- Gln49 and Ser174 residues play critical roles in determining the catalytic efficiencies of plant glutamine synthetase. DOI: 10.1093/pcp/pci238 ; PMID: 16338958
- Towards the proteome of Brassica napus phloem sap. DOI: 10.1002/pmic.200500155 ; PMID: 16400686
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Effect of sulfur availability on the integrity of amino acid biosynthesis in plants. DOI: 10.1007/s00726-005-0251-4 ; PMID: 16552493
- Effect of sugar-induced senescence on gene expression and implications for the regulation of senescence in Arabidopsis. DOI: 10.1007/s00425-006-0243-y ; PMID: 16514542
- Proteomic investigation of the effect of salicylic acid on Arabidopsis seed germination and establishment of early defense mechanisms. DOI: 10.1104/pp.106.082057 ; PMID: 16679420
- Response diversity of Arabidopsis thaliana ecotypes in elevated [CO2] in the field. DOI: 10.1007/s11103-006-9041-y ; PMID: 16941220
- Integration of metabolite with transcript and enzyme activity profiling during diurnal cycles in Arabidopsis rosettes. DOI: 10.1186/gb-2006-7-8-R76 ; PMID: 16916443
- Arabidopsis transcriptome changes in response to phloem-feeding silverleaf whitefly nymphs. Similarities and distinctions in responses to aphids. DOI: 10.1104/pp.106.090662 ; PMID: 17189325
- Global transcription profiling reveals differential responses to chronic nitrogen stress and putative nitrogen regulatory components in Arabidopsis. DOI: 10.1186/1471-2164-8-281 ; PMID: 17705847
- Alternative and effective proteomic analysis in Arabidopsis. DOI: 10.1002/pmic.200700346 ; PMID: 17828791
- Systems approach identifies an organic nitrogen-responsive gene network that is regulated by the master clock control gene CCA1. DOI: 10.1073/pnas.0800211105 ; PMID: 18344319
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Complex I dysfunction redirects cellular and mitochondrial metabolism in Arabidopsis. DOI: 10.1104/pp.108.125880 ; PMID: 18784283
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Systems analysis of seed filling in Arabidopsis: using general linear modeling to assess concordance of transcript and protein expression. DOI: 10.1104/pp.109.152413 ; PMID: 20118269
- Knockout mutants as a tool to identify the subunit composition of Arabidopsis glutamine synthetase isoforms. DOI: 10.1016/j.plaphy.2014.02.023 ; PMID: 24657507
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Cytosolic Glutamine Synthetase Gln1;2 Is the Main Isozyme Contributing to GS1 Activity and Can Be Up-Regulated to Relieve Ammonium Toxicity. DOI: 10.1104/pp.16.01195 ; PMID: 27231101
- Nitrogen remobilization during leaf senescence: lessons from Arabidopsis to crops. DOI: 10.1093/jxb/erw365 ; PMID: 27707774
- Contributions of two cytosolic glutamine synthetase isozymes to ammonium assimilation in Arabidopsis roots. DOI: 10.1093/jxb/erw454 ; PMID: 28007952
- Cytosolic Glutamine Synthetase Isozymes Play Redundant Roles in Ammonium Assimilation Under Low-Ammonium Conditions in Roots of Arabidopsis thaliana. DOI: 10.1093/pcp/pcy014 ; PMID: 29373725
- Three cytosolic glutamine synthetase isoforms localized in different-order veins act together for N remobilization and seed filling in Arabidopsis. DOI: 10.1093/jxb/ery217 ; PMID: 29873769
- Roles of Cytosolic Glutamine Synthetases in Arabidopsis Development and Stress Responses. DOI: 10.1093/pcp/pcy235 ; PMID: 30649517
- Arabidopsis thaliana mutants devoid of chloroplast glutamine synthetase (GS2) have non-lethal phenotype under photorespiratory conditions. DOI: 10.1016/j.plaphy.2019.10.009 ; PMID: 31622939
- The plant defensin gene AtPDF2.1 mediates ammonium metabolism by regulating glutamine synthetase activity in Arabidopsis thaliana. DOI: 10.1186/s12870-019-2183-2 ; PMID: 31842759
- Proteomic characterization of evolutionarily conserved and variable proteins of Arabidopsis cytosolic ribosomes. DOI: 10.1104/pp.104.053637 ; PMID: 15734919
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Proteomic survey of copper-binding proteins in Arabidopsis roots by immobilized metal affinity chromatography and mass spectrometry. DOI: 10.1002/pmic.200500108 ; PMID: 16526091
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A178VNQ6
- EMBL: CACRSJ010000106, CACSHJ010000089, LR881468
- AlphaFoldDB: A0A178VNQ6
- EnsemblPlants: AT3G17820.1
- Gramene: AT3G17820.1
- KEGG: ath:AT3G17820
- Orthologous matrix: MQKDVNW
- ExpressionAtlas: AT3G17820
- InterPro: IPR008146, IPR008147, IPR014746
- PANTHER: PTHR20852, PTHR20852:SF86
- SUPFAM: SSF54368, SSF55931
- PROSITE: PS00180, PS00181, PS51986
- Gene3D: 3.10.20.70, 3.30.590.10
- OrthoDB: A0A178VNQ6
- SWISS-MODEL: A0A178VNQ6
Homologs
- Brassica oleracea Bo1g034320
- Oryza sativa OsGS;OsGS1, GLN1;2;GS1;2, OsGS1;3;OsGLN1;3, OsGS2;lambdaGS31
Sequences
cDNA Sequence
- >AT3G17820.1
ATTAAATATTGTTGCCATAATAACCTGTAATCTCAGGAGAATCCTAACGGAAAAGAGAATATTAGACGATAGTATTATATGGAGTATTAATTACTTATTAACAATTCTAGGAGATAATATCAGCACACAACAATAAAAGAAATTACTAATTTACTGGAATCATGTATTCACCGTAATTATTTAAGGAGAGGAAAAAAAAAATACAAGCTCTTTCTCTATAAACACACACTCTCAGGAGAGAAGTTGTATTGATCGTCTTCTCTTTCCCTAAACACACTGATTATTTTCTCTCCGACGCCGCCATGTCTCTGCTCTCAGATCTCGTTAACCTCAACCTCACCGATGCCACCGGGAAAATCATCGCCGAATACATATGGATCGGTGGATCTGGAATGGATATCAGAAGCAAAGCCAGGACACTACCAGGACCAGTGACTGATCCATCAAAGCTTCCCAAGTGGAACTACGACGGATCCAGCACCGGTCAGGCTGCTGGAGAAGACAGTGAAGTCATTCTATACCCTCAGGCAATATTCAAGGATCCCTTCAGGAAAGGCAACAACATCCTGGTGATGTGTGATGCTTACACACCAGCTGGTGATCCTATTCCAACCAACAAGAGGCACAACGCTGCTAAGATCTTCAGCCACCCCGACGTTGCCAAGGAGGAGCCTTGGTATGGGATTGAGCAAGAATACACTTTGATGCAAAAGGATGTGAACTGGCCAATTGGTTGGCCTGTTGGTGGCTACCCTGGCCCTCAGGGACCTTACTACTGTGGTGTGGGAGCTGACAAAGCCATTGGTCGTGACATTGTGGATGCTCACTACAAGGCCTGTCTTTACGCCGGTATTGGTATTTCTGGTATCAATGGAGAAGTCATGCCAGGCCAGTGGGAGTTCCAAGTCGGCCCTGTTGAGGGTATTAGTTCTGGTGATCAAGTCTGGGTTGCTCGATACCTTCTCGAGAGGATCACTGAGATCTCTGGTGTAATTGTCAGCTTCGACCCGAAACCAGTCCCGGGTGACTGGAATGGAGCTGGAGCTCACTGCAACTACAGCACTAAGACAATGAGAAACGATGGAGGATTAGAAGTGATCAAGAAAGCGATAGGGAAGCTTCAGCTGAAACACAAAGAACACATTGCTGCTTACGGTGAAGGAAACGAGCGTCGTCTCACTGGAAAGCACGAAACCGCAGACATCAACACATTCTCTTGGGGAGTCGCGAACCGTGGAGCGTCAGTGAGAGTGGGACGTGACACAGAGAAGGAAGGTAAAGGGTACTTCGAAGACAGAAGGCCAGCTTCTAACATGGATCCTTACGTTGTCACCTCCATGATCGCTGAGACGACCATACTCGGTTGATGACACATTTCATGATTTGATTTCTCTCCAATTTGGTTTTTTTTTTTTCCCTTTTGATTGCACTTTTCGATAATAAAAAAATAATTCTTATTATGGGCGTATTGTTGTGACATTTTGTGTTTTGTTTCGAATAATTAAATAAGCGCTTCTTAAGGTGAAAATAAATAATAATTAGTGATTTTTAATC
CDS Sequence
- >AT3G17820.1
ATGTCTCTGCTCTCAGATCTCGTTAACCTCAACCTCACCGATGCCACCGGGAAAATCATCGCCGAATACATATGGATCGGTGGATCTGGAATGGATATCAGAAGCAAAGCCAGGACACTACCAGGACCAGTGACTGATCCATCAAAGCTTCCCAAGTGGAACTACGACGGATCCAGCACCGGTCAGGCTGCTGGAGAAGACAGTGAAGTCATTCTATACCCTCAGGCAATATTCAAGGATCCCTTCAGGAAAGGCAACAACATCCTGGTGATGTGTGATGCTTACACACCAGCTGGTGATCCTATTCCAACCAACAAGAGGCACAACGCTGCTAAGATCTTCAGCCACCCCGACGTTGCCAAGGAGGAGCCTTGGTATGGGATTGAGCAAGAATACACTTTGATGCAAAAGGATGTGAACTGGCCAATTGGTTGGCCTGTTGGTGGCTACCCTGGCCCTCAGGGACCTTACTACTGTGGTGTGGGAGCTGACAAAGCCATTGGTCGTGACATTGTGGATGCTCACTACAAGGCCTGTCTTTACGCCGGTATTGGTATTTCTGGTATCAATGGAGAAGTCATGCCAGGCCAGTGGGAGTTCCAAGTCGGCCCTGTTGAGGGTATTAGTTCTGGTGATCAAGTCTGGGTTGCTCGATACCTTCTCGAGAGGATCACTGAGATCTCTGGTGTAATTGTCAGCTTCGACCCGAAACCAGTCCCGGGTGACTGGAATGGAGCTGGAGCTCACTGCAACTACAGCACTAAGACAATGAGAAACGATGGAGGATTAGAAGTGATCAAGAAAGCGATAGGGAAGCTTCAGCTGAAACACAAAGAACACATTGCTGCTTACGGTGAAGGAAACGAGCGTCGTCTCACTGGAAAGCACGAAACCGCAGACATCAACACATTCTCTTGGGGAGTCGCGAACCGTGGAGCGTCAGTGAGAGTGGGACGTGACACAGAGAAGGAAGGTAAAGGGTACTTCGAAGACAGAAGGCCAGCTTCTAACATGGATCCTTACGTTGTCACCTCCATGATCGCTGAGACGACCATACTCGGTTGA
Protein Sequence
- >AT3G17820.1
MSLLSDLVNLNLTDATGKIIAEYIWIGGSGMDIRSKARTLPGPVTDPSKLPKWNYDGSSTGQAAGEDSEVILYPQAIFKDPFRKGNNILVMCDAYTPAGDPIPTNKRHNAAKIFSHPDVAKEEPWYGIEQEYTLMQKDVNWPIGWPVGGYPGPQGPYYCGVGADKAIGRDIVDAHYKACLYAGIGISGINGEVMPGQWEFQVGPVEGISSGDQVWVARYLLERITEISGVIVSFDPKPVPGDWNGAGAHCNYSTKTMRNDGGLEVIKKAIGKLQLKHKEHIAAYGEGNERRLTGKHETADINTFSWGVANRGASVRVGRDTEKEGKGYFEDRRPASNMDPYVVTSMIAETTILG