Information report for AT3G17600
Gene Details
|
|
Functional Descriptions
- GO:0005515 — enables — protein binding
- GO:0048364 — acts upstream of or within — root development
- GO:0005634 — located in — nucleus
- GO:0009630 — acts upstream of or within — gravitropism
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0009733 — acts upstream of or within — response to auxin
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0048367 — acts upstream of or within — shoot system development
- GO:0042802 — enables — identical protein binding
- GO:0003700 — enables — DNA-binding transcription factor activity
- CS25218 — No visible phenotype.
Functional Keywords
Literature and News
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Genetics of Aux/IAA and ARF action in plant growth and development. DOI: NA ; PMID: 12036262
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- The Arabidopsis transcription factor HY5 integrates light and hormone signaling pathways. DOI: 10.1111/j.1365-313X.2004.02052.x ; PMID: 15078335
- Contrasting modes of diversification in the Aux/IAA and ARF gene families. DOI: 10.1104/pp.104.039669 ; PMID: 15247399
- Functional genomic analysis of the AUXIN/INDOLE-3-ACETIC ACID gene family members in Arabidopsis thaliana. DOI: 10.1105/tpc.105.036723 ; PMID: 16284307
- The Arabidopsis Aux/IAA protein family has diversified in degradation and auxin responsiveness. DOI: 10.1105/tpc.105.039172 ; PMID: 16489122
- Eukaryotic transcription factors in plastids–Bioinformatic assessment and implications for the evolution of gene expression machineries in plants. DOI: 10.1016/j.gene.2006.06.022 ; PMID: 16934950
- Differential binding of calmodulin-related proteins to their targets revealed through high-density Arabidopsis protein microarrays. DOI: 10.1073/pnas.0611615104 ; PMID: 17360592
- Overexpression of the non-canonical Aux/IAA genes causes auxin-related aberrant phenotypes in Arabidopsis. DOI: 10.1111/j.1399-3054.2008.01055.x ; PMID: 18298415
- Iron-dependent modifications of the flower transcriptome, proteome, metabolome, and hormonal content in an Arabidopsis ferritin mutant. DOI: 10.1093/jxb/ert112 ; PMID: 23682113
- Three MYB transcription factors control pollen tube differentiation required for sperm release. DOI: 10.1016/j.cub.2013.05.021 ; PMID: 23791732
- Transcriptional Regulation of Arabidopsis Polycomb Repressive Complex 2 Coordinates Cell-Type Proliferation and Differentiation. DOI: 10.1105/tpc.15.00744 ; PMID: 27650334
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Overexpression of the non-canonical Aux/IAA genes causes auxin-related aberrant phenotypes in Arabidopsis. DOI: 10.1111/j.1399-3054.2008.01055.x ; PMID: 18298415
Gene Resources
- UniProt: D3K0M2
- EMBL: AY669802, GU348639, GU348641
- AlphaFoldDB: D3K0M2
- EnsemblPlants: AT3G17600.1
- Gramene: AT3G17600.1
- KEGG: ath:AT3G17600
- Orthologous matrix: HMFRTTI
- ExpressionAtlas: AT3G17600
- InterPro: IPR003311, IPR033389, IPR053793
- PANTHER: PTHR31734, PTHR31734:SF216
- SUPFAM: SSF54277
- PROSITE: PS51745
- Gene3D: 3.10.20.90
- OrthoDB: D3K0M2
- SWISS-MODEL: D3K0M2
Homologs
- Actinidia chinensis CEY00_Acc04212
- Citrullus lanatus Cla97C05G085700
- Glycine max GmIAA9;qSW2, Glyma.10G031900
- Gossypium hirsutum Gohir.A07G209000, Gohir.D11G132700
- Juglans regia Jr01_31360
- Malus domestica MdIAA3
- Manihot esculenta MANES_03G169700, MANES_15G036200
- Nicotiana attenuata A4A49_02602
- Oryza sativa OsIAA17q5
- Populus trichocarpa POPTR_008G161200v3
- Prunus avium Pav_sc0000983.1_g260.1.mk
- Vitis vinifera VIT_14s0081g00010, VIT_05s0020g04690
Sequences
cDNA Sequence
- >AT3G17600.1
AACTAGACAGAGAGAAATAGAAATAGAGAGAGAGAGACATGAAGAGCACTCTCAATAGAGAAGAGAAGGAAGCATGAAGCTAGCTCTGCAGCTTCAAGGTCTCATTAATGGAGGTCTCTAACTCTTGTTCTTCATTTTCTTCATCCTCTGTCGACAGTACTAAACCTTCTCCTTCTGAATCTTCTGTTAATCTCTCCCTTAGTCTCACATTTCCTTCTACTTCTCCACAAAGAGAAGCAAGACAAGATTGGCCACCGATAAAGTCTAGATTAAGAGATACACTAAAGGGTCGTCGTCTTCTTCGTCGTGGTGATGACACTTCTCTCTTTGTTAAGGTTTATATGGAAGGTGTTCCCATTGGAAGAAAACTCGACCTTTGCGTATTCTCAGGCTACGAGAGTCTATTAGAAAATCTCTCTCACATGTTCGATACTTCAATCATCTGCGGTAATCGAGATCGAAAACATCATGTTTTGACATATGAAGACAAGGATGGAGATTGGATGATGGTCGGAGATATTCCATGGGATATGTTTCTTGAAACCGTGAGAAGACTAAAGATCACGAGACCGGAGAGGTATTAAAACTTGGATCGGTCAAGGCTGTGATTGCGCAGTTACGAGACGTGTAAGATTTAGGCATTGATGAAGAGACTTGAGGCGGGACGGAGCTATTGCTGCATATTGCAACAAAGGCCTTGAAGAAGTTGGAGAATTGATTGATGCATATATTTATTTATATGACACCTTTGAGTGTGTTTTTTCTTATAAATAAATCACAATATCCAAGACTTCTCTTTTTTGTTCTGAATAATAATAATGCAAAGATTTTTTATATGTTTGTAATCGTGTGTTTCTTCGAATGTGTTACATGACTAGGAAAAAAGTACACG
CDS Sequence
- >AT3G17600.1
ATGGAGGTCTCTAACTCTTGTTCTTCATTTTCTTCATCCTCTGTCGACAGTACTAAACCTTCTCCTTCTGAATCTTCTGTTAATCTCTCCCTTAGTCTCACATTTCCTTCTACTTCTCCACAAAGAGAAGCAAGACAAGATTGGCCACCGATAAAGTCTAGATTAAGAGATACACTAAAGGGTCGTCGTCTTCTTCGTCGTGGTGATGACACTTCTCTCTTTGTTAAGGTTTATATGGAAGGTGTTCCCATTGGAAGAAAACTCGACCTTTGCGTATTCTCAGGCTACGAGAGTCTATTAGAAAATCTCTCTCACATGTTCGATACTTCAATCATCTGCGGTAATCGAGATCGAAAACATCATGTTTTGACATATGAAGACAAGGATGGAGATTGGATGATGGTCGGAGATATTCCATGGGATATGTTTCTTGAAACCGTGAGAAGACTAAAGATCACGAGACCGGAGAGGTATTAA
Protein Sequence
- >AT3G17600.1
MEVSNSCSSFSSSSVDSTKPSPSESSVNLSLSLTFPSTSPQREARQDWPPIKSRLRDTLKGRRLLRRGDDTSLFVKVYMEGVPIGRKLDLCVFSGYESLLENLSHMFDTSIICGNRDRKHHVLTYEDKDGDWMMVGDIPWDMFLETVRRLKITRPERY