Information report for AT3G15360
Gene Details
|
|
Functional Descriptions
- GO:0006109 — involved in — regulation of carbohydrate metabolic process
- GO:0009507 — located in — chloroplast
- GO:0005829 — located in — cytosol
- GO:0004857 — enables — enzyme inhibitor activity
- GO:0009570 — located in — chloroplast stroma
- GO:0009941 — located in — chloroplast envelope
- GO:0009535 — located in — chloroplast thylakoid membrane
- GO:0009579 — located in — thylakoid
- GO:0006979 — acts upstream of or within — response to oxidative stress
- GO:0015035 — enables — protein-disulfide reductase activity
- GO:0008047 — enables — enzyme activator activity
- GO:0005737 — is active in — cytoplasm
- GO:0009505 — located in — plant-type cell wall
- GO:0043086 — involved in — negative regulation of catalytic activity
Functional Keywords
Literature and News
- The Arabidopsis thaliana genome encodes at least four thioredoxins m and a new prokaryotic-like thioredoxin. DOI: 10.1016/s0378-1119(99)00448-5 ; PMID: 10580150
- Heterologous complementation of yeast reveals a new putative function for chloroplast m-type thioredoxin. DOI: 10.1046/j.0960-7412.2000.00943.x ; PMID: 11169189
- Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis determined by experimentation and genome-wide prediction. DOI: 10.1105/tpc.010304 ; PMID: 11826309
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- The plant thioredoxin system. DOI: 10.1007/s00018-004-4296-4 ; PMID: 15619004
- Cell wall proteins in apoplastic fluids of Arabidopsis thaliana rosettes: identification by mass spectrometry and bioinformatics. DOI: 10.1002/pmic.200400882 ; PMID: 15593128
- Protein profiling of plastoglobules in chloroplasts and chromoplasts. A surprising site for differential accumulation of metabolic enzymes. DOI: 10.1104/pp.105.076083 ; PMID: 16461379
- Exploiting the wild crucifer Thlaspi arvense to identify conserved and novel genes expressed during a plant's response to cold stress. DOI: 10.1007/s11103-006-9080-4 ; PMID: 16972165
- Evolution of redoxin genes in the green lineage. DOI: 10.1007/s11120-006-9095-3 ; PMID: 17031546
- Recent advances in plant cell wall proteomics. DOI: 10.1002/pmic.200700938 ; PMID: 18210371
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- A novel type of thioredoxin dedicated to symbiosis in legumes. DOI: 10.1104/pp.108.123778 ; PMID: 18614707
- A novel extended family of stromal thioredoxins. DOI: 10.1007/s11103-009-9471-4 ; PMID: 19259774
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Thioredoxin m4 controls photosynthetic alternative electron pathways in Arabidopsis. DOI: 10.1104/pp.112.207019 ; PMID: 23151348
- Genome-wide association mapping combined with reverse genetics identifies new effectors of low water potential-induced proline accumulation in Arabidopsis. DOI: 10.1104/pp.113.224014 ; PMID: 24218491
- Proteome and metabolome profiling of cytokinin action in Arabidopsis identifying and up-regulation. DOI: 10.1093/jxb/ert227 ; PMID: 24064926
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Chloroplastic thioredoxin m functions as a major regulator of Calvin cycle enzymes during photosynthesis in vivo. DOI: 10.1111/tpj.13049 ; PMID: 26468055
- Sulfurtransferase and thioredoxin specifically interact as demonstrated by bimolecular fluorescence complementation analysis and biochemical tests. DOI: 10.1016/j.fob.2015.10.001 ; PMID: 26605137
- M-type thioredoxins are involved in the xanthophyll cycle and proton motive force to alter NPQ under low-light conditions in Arabidopsis. DOI: 10.1007/s00299-017-2229-6 ; PMID: 29080907
- M-Type Thioredoxins Regulate the PGR5/PGRL1-Dependent Pathway by Forming a Disulfide-Linked Complex with PGRL1. DOI: 10.1105/tpc.20.00304 ; PMID: 33037145
- Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis determined by experimentation and genome-wide prediction. DOI: 10.1105/tpc.010304 ; PMID: 11826309
- Proteomic study of the Arabidopsis thaliana chloroplastic envelope membrane utilizing alternatives to traditional two-dimensional electrophoresis. DOI: 10.1021/pr034025j ; PMID: 12938931
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- The plant thioredoxin system. DOI: 10.1007/s00018-004-4296-4 ; PMID: 15619004
- Cell wall proteins in apoplastic fluids of Arabidopsis thaliana rosettes: identification by mass spectrometry and bioinformatics. DOI: 10.1002/pmic.200400882 ; PMID: 15593128
- High light response of the thylakoid proteome in arabidopsis wild type and the ascorbate-deficient mutant vtc2-2. A comparative proteomics study. DOI: 10.1104/pp.106.080150 ; PMID: 16648217
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A178VJ83
- EMBL: CACRSJ010000106, CACSHJ010000089, LUHQ01000003
- AlphaFoldDB: A0A178VJ83
- EnsemblPlants: AT3G15360.1
- Gramene: AT3G15360.1
- KEGG: ath:AT3G15360
- Orthologous matrix: VGRIFCE
- ExpressionAtlas: AT3G15360
- InterPro: IPR005746, IPR013766, IPR017937
- PANTHER: PTHR45663, PTHR45663:SF16
- SUPFAM: SSF52833
- PROSITE: PS00194, PS51352
- Gene3D: 3.40.30.10
- OrthoDB: A0A178VJ83
- SWISS-MODEL: A0A178VJ83
- Conserved Domain Database: cd02947
Homologs
- Daucus carota DCAR_019739
- Manihot esculenta Manes.11G039566, Manes.11G039376
- Oryza sativa Ostrxm, OsTrx23;OsTRXh1, OsTrxh4, PDIL2;3
- Panicum virgatum Pavir.8KG297800
- Raphanus raphanistrum RrC417_p8
- Zea mays GRMZM2G008647_P02
Sequences
cDNA Sequence
- >AT3G15360.1
CCGAAATCAAATTTGATAGTCGGTCTACTAAAACAATTGACGGTTTACAGGAGTCCTCTAAACGTTGTCGTTATCTCAAAGGAAAGAATGACGTGGCGAGGATAAAATCGCATTCGCCTCTGTGTGTGTTCTCAAGTCATTCAAATTGTCACCCGTATCTGCCAAAAACCCTCTAACCACTCAAAAAAATATCTCTGCTCTGCTCCAATGGCGTCGTTACTCGATTCCGTCACCGTGACCCGCGTGTTTTCTCTGCCGATTGCGGCTTCGGTCTCGTCTTCTTCAGCTGCTCCGTCGGTTTCACGACGCCGGATTTCTCCCGCCAGGTTTCTGGAATTCAGAGGTTTGAAGTCTTCGCGGAGTTTGGTGACTCAGTCGGCCAGTCTGGGTGCGAATCGTAGAACCAGAATCGCTCGCGGTGGACGAATCGCCTGTGAGGCTCAGGACACCACTGCCGCCGCCGTCGAAGTACCAAATCTGTCTGATTCAGAATGGCAAACAAAGGTTCTGGAATCAGATGTCCCAGTTCTGGTCGAGTTCTGGGCACCATGGTGTGGACCTTGCCGTATGATTCACCCCATAGTTGACCAGCTAGCCAAAGATTTCGCAGGGAAGTTCAAATTCTACAAAATCAACACTGACGAGAGCCCAAATACAGCAAACCGTTACGGGATACGAAGCGTTCCAACAGTAATCATCTTCAAAGGCGGTGAGAAGAAAGATAGCATCATTGGAGCTGTGCCTAGAGAGACGTTGGAGAAAACTATAGAAAGATTCTTGGTCGAGTAACAAAATTTGACTCTTTTGTCACTCTGAACCATTTTACCTTATCTTCTCTCTTGTAATCTCTGTAAAGTCTTTTAAGTTTTTGACTATTATGTTATCGTGGGTCCTCTTTGTCTTCTTCAATAAAAAAAATGGAAACAAAGTAATCCACCGACGCATGAGAAGCATAACTCCACGTTGAACCACATGCCATTGTTCTTCCTAATTCACCGTACAATCTATATACATACATATGTTTTGAGTAATGTAGGCTTCCGTACTGTTTCATTCTGTGTACTGCATAGGACATATATTAATACCACGAGGGGGTCTATGTAATCTTATATTATATCATGTATGTTTTCGATTTCTAATCCAATTATGTGAGTATATACTATGTGGC
CDS Sequence
- >AT3G15360.1
ATGGCGTCGTTACTCGATTCCGTCACCGTGACCCGCGTGTTTTCTCTGCCGATTGCGGCTTCGGTCTCGTCTTCTTCAGCTGCTCCGTCGGTTTCACGACGCCGGATTTCTCCCGCCAGGTTTCTGGAATTCAGAGGTTTGAAGTCTTCGCGGAGTTTGGTGACTCAGTCGGCCAGTCTGGGTGCGAATCGTAGAACCAGAATCGCTCGCGGTGGACGAATCGCCTGTGAGGCTCAGGACACCACTGCCGCCGCCGTCGAAGTACCAAATCTGTCTGATTCAGAATGGCAAACAAAGGTTCTGGAATCAGATGTCCCAGTTCTGGTCGAGTTCTGGGCACCATGGTGTGGACCTTGCCGTATGATTCACCCCATAGTTGACCAGCTAGCCAAAGATTTCGCAGGGAAGTTCAAATTCTACAAAATCAACACTGACGAGAGCCCAAATACAGCAAACCGTTACGGGATACGAAGCGTTCCAACAGTAATCATCTTCAAAGGCGGTGAGAAGAAAGATAGCATCATTGGAGCTGTGCCTAGAGAGACGTTGGAGAAAACTATAGAAAGATTCTTGGTCGAGTAA
Protein Sequence
- >AT3G15360.1
MASLLDSVTVTRVFSLPIAASVSSSSAAPSVSRRRISPARFLEFRGLKSSRSLVTQSASLGANRRTRIARGGRIACEAQDTTAAAVEVPNLSDSEWQTKVLESDVPVLVEFWAPWCGPCRMIHPIVDQLAKDFAGKFKFYKINTDESPNTANRYGIRSVPTVIIFKGGEKKDSIIGAVPRETLEKTIERFLVE