Information report for AT3G12580
Gene Details
|
|
Functional Descriptions
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- hsp70-4-1 — Hypersensitive to prolonged, moderate heat stress. Seedlings die after exposure to 37C for 4 days.
Functional Keywords
- root , shoot system , plant embryo , vascular leaf , stamen , sepal , flower , inflorescence flower pedicel , cotyledon , hypocotyl , leaf apex , collective leaf structure , pollen
Literature and News
- Comprehensive expression profile analysis of the Arabidopsis Hsp70 gene family. DOI: 10.1104/pp.126.2.789 ; PMID: 11402207
- Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. DOI: 10.1111/j.1365-313X.2006.02889.x ; PMID: 17059409
- Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. DOI: 10.1105/tpc.107.051896 ; PMID: 18065690
- General detoxification and stress responses are mediated by oxidized lipids through TGA transcription factors in Arabidopsis. DOI: 10.1105/tpc.107.054809 ; PMID: 18334669
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- Tandem affinity purification and mass spectrometric analysis of ubiquitylated proteins in Arabidopsis. DOI: 10.1111/j.1365-313X.2009.03862.x ; PMID: 19292762
- The lack of mitochondrial AtFtsH4 protease alters Arabidopsis leaf morphology at the late stage of rosette development under short-day photoperiod. DOI: 10.1111/j.1365-313X.2009.03907.x ; PMID: 19453455
- Investigating the role of plant heat shock proteins during oxidative stress. DOI: 10.4161/psb.3.10.6021 ; PMID: 19704521
- The analysis of an Arabidopsis triple knock-down mutant reveals functions for MBF1 genes under oxidative stress conditions. DOI: 10.1016/j.jplph.2009.09.003 ; PMID: 19783066
- Control of the pattern-recognition receptor EFR by an ER protein complex in plant immunity. DOI: 10.1038/emboj.2009.262 ; PMID: 19763086
- Transgenic expression of the Trichoderma harzianum hsp70 gene increases Arabidopsis resistance to heat and other abiotic stresses. DOI: 10.1016/j.jplph.2009.11.012 ; PMID: 20080316
- H2A.Z-containing nucleosomes mediate the thermosensory response in Arabidopsis. DOI: 10.1016/j.cell.2009.11.006 ; PMID: 20079334
- Expression of five AtHsp90 genes in Saccharomyces cerevisiae reveals functional differences of AtHsp90s under abiotic stresses. DOI: 10.1016/j.jplph.2010.03.016 ; PMID: 20493581
- In silico identification of carboxylate clamp type tetratricopeptide repeat proteins in Arabidopsis and rice as putative co-chaperones of Hsp90/Hsp70. DOI: 10.1371/journal.pone.0012761 ; PMID: 20856808
- OEP61 is a chaperone receptor at the plastid outer envelope. DOI: 10.1042/BJ20110448 ; PMID: 21612577
- Cytosolic HSP90 cochaperones HOP and FKBP interact with freshly synthesized chloroplast preproteins of Arabidopsis. DOI: 10.1093/mp/ssr037 ; PMID: 21596689
- A chloroplast-targeted DnaJ protein AtJ8 is negatively regulated by light and has rapid turnover in darkness. DOI: 10.1016/j.jplph.2011.04.001 ; PMID: 21592617
- Proteomic analyses of apoplastic proteins from germinating Arabidopsis thaliana pollen. DOI: 10.1016/j.bbapap.2011.07.013 ; PMID: 21798377
- The Mediator complex in plants: structure, phylogeny, and expression profiling of representative genes in a dicot (Arabidopsis) and a monocot (rice) during reproduction and abiotic stress. DOI: 10.1104/pp.111.188300 ; PMID: 22021418
- AtTPR7 is a chaperone-docking protein of the Sec translocon in Arabidopsis. DOI: 10.1242/jcs.111054 ; PMID: 22899711
- A proteomic analysis of Arabidopsis thaliana seedling responses to 3-oxo-octanoyl-homoserine lactone, a bacterial quorum-sensing signal. DOI: 10.1016/j.bbrc.2012.09.044 ; PMID: 22995300
- The polyamine spermine protects Arabidopsis from heat stress-induced damage by increasing expression of heat shock-related genes. DOI: 10.1007/s11248-012-9666-3 ; PMID: 23080295
- Heat stress-induced BBX18 negatively regulates the thermotolerance in Arabidopsis. DOI: 10.1007/s11033-012-2354-9 ; PMID: 23238922
- An essential role for chloroplast heat shock protein 90 (Hsp90C) in protein import into chloroplasts. DOI: 10.1073/pnas.1219229110 ; PMID: 23382192
- Arabidopsis miR156 Regulates Tolerance to Recurring Environmental Stress through SPL Transcription Factors. DOI: 10.1105/tpc.114.123851 ; PMID: 24769482
- The THERMOSENSITIVE MALE STERILE 1 Interacts with the BiPs via DnaJ Domain and Stimulates Their ATPase Enzyme Activities in Arabidopsis. DOI: 10.1371/journal.pone.0132500 ; PMID: 26186593
- Crystallographic analysis of the Arabidopsis thaliana BAG5-calmodulin protein complex. DOI: 10.1107/S2053230X15005956 ; PMID: 26144232
- Phosphorylation and Dephosphorylation of the Presequence of Precursor MULTIPLE ORGANELLAR RNA EDITING FACTOR3 during Import into Mitochondria from Arabidopsis. DOI: 10.1104/pp.15.01115 ; PMID: 26304849
- BiP3 supports the early stages of female gametogenesis in the absence of BiP1 and BiP2 in Arabidopsis thaliana. DOI: 10.1080/15592324.2015.1035853 ; PMID: 26251880
- The Transcriptional Cascade in the Heat Stress Response of Arabidopsis Is Strictly Regulated at the Level of Transcription Factor Expression. DOI: 10.1105/tpc.15.00435 ; PMID: 26715648
- Functional analysis of the Hikeshi-like protein and its interaction with HSP70 in Arabidopsis. DOI: 10.1016/j.bbrc.2014.05.128 ; PMID: 24942879
- Salicylic acid signaling controls the maturation and localization of the arabidopsis defense protein ACCELERATED CELL DEATH6. DOI: 10.1093/mp/ssu072 ; PMID: 24923602
- A subclass of HSP70s regulate development and abiotic stress responses in Arabidopsis thaliana. DOI: 10.1007/s10265-016-0900-6 ; PMID: 28004282
- GIGANTEA is a co-chaperone which facilitates maturation of ZEITLUPE in the Arabidopsis circadian clock. DOI: 10.1038/s41467-016-0014-9 ; PMID: 28232745
- Interference with plastome gene expression and Clp protease activity in Arabidopsis triggers a chloroplast unfolded protein response to restore protein homeostasis. DOI: 10.1371/journal.pgen.1007022 ; PMID: 28937985
- Structural components involved in plastid protein import. DOI: 10.1042/EBC20170093 ; PMID: 29487196
- Glutathione modulates the expression of heat shock proteins via the transcription factors BZIP10 and MYB21 in Arabidopsis. DOI: 10.1093/jxb/ery166 ; PMID: 29722824
- Arabidopsis HSP70-16 is required for flower opening under normal or mild heat stress temperatures. DOI: 10.1111/pce.13480 ; PMID: 30426513
- Increased fes1a thermotolerance is induced by BAG6 knockout. DOI: 10.1007/s11103-019-00844-8 ; PMID: 30796711
- Capturing the phosphorylation and protein interaction landscape of the plant TOR kinase. DOI: 10.1038/s41477-019-0378-z ; PMID: 30833711
- HSP101 Interacts with the Proteasome and Promotes the Clearance of Ubiquitylated Protein Aggregates. DOI: 10.1104/pp.19.00263 ; PMID: 31113833
- Responses of PYR/PYL/RCAR ABA Receptors to Contrasting stresses, Heat and Cold in Arabidopsis. DOI: 10.1080/15592324.2019.1670596 ; PMID: 31552801
- Stress-seventy subfamily A 4, A member of HSP70, confers yeast cadmium tolerance in the loss of mitochondria pyruvate carrier 1. DOI: 10.1080/15592324.2020.1719312 ; PMID: 31985324
- Two Arabidopsis Chloroplast GrpE Homologues Exhibit Distinct Biological and Hetero-Oligomers. DOI: 10.3389/fpls.2019.01719 ; PMID: 32038688
- Structural and Functional Heat Stress Responses of Chloroplasts of Arabidopsis thaliana. DOI: 10.3390/genes11060650 ; PMID: 32545654
- AtHsc70-1 negatively regulates the basal heat tolerance in Arabidopsis thaliana through affecting the activity of HsfAs and Hsp101. DOI: 10.1111/tpj.14883 ; PMID: 32573848
- Endogenous activated small interfering RNAs in virus-infected Brassicaceae crops show a common host gene-silencing pattern affecting photosynthesis and stress response. DOI: 10.1111/nph.16932 ; PMID: 32945560
- Heat Shock Responsive Gene Expression Modulated by mRNA Poly(A) Tail Length. DOI: 10.3389/fpls.2020.01255 ; PMID: 32922425
- Expansion of the evolutionarily conserved network of J-domain proteins in the Arabidopsis mitochondrial import complex. DOI: 10.1007/s11103-020-01095-8 ; PMID: 33206359
- The CBP/p300 histone acetyltransferases function as plant-specific MEDIATOR subunits in Arabidopsis. DOI: 10.1111/jipb.13052 ; PMID: 33325122
- Genetic analysis implicates a molecular chaperone complex in regulating epigenetic silencing of methylated genomic regions. DOI: 10.1111/jipb.13155 ; PMID: 34289245
- Targeting conserved co-opted host factors to block virus replication: Using allosteric inhibitors of the cytosolic Hsp70s to interfere with tomato bushy stunt virus replication. DOI: 10.1016/j.virol.2021.08.002 ; PMID: 34399236
- and J-domain-containing proteins DJC31 and DJC62 are involved in abiotic stress responses in Arabidopsis thaliana. DOI: 10.1242/jcs.259032 ; PMID: 34515300
- The co-chaperone HOP3 participates in jasmonic acid signaling by regulating CORONATINE-INSENSITIVE 1 activity. DOI: 10.1093/plphys/kiab334 ; PMID: 34618051
- Regulation of heat shock proteins 70 and their role in plant immunity. DOI: 10.1093/jxb/erab549 ; PMID: 35022724
- Presequence translocase-associated motor subunits of the mitochondrial protein import apparatus are dual-targeted to mitochondria and plastids. DOI: 10.3389/fpls.2022.981552 ; PMID: 36438081
- HOP co-chaperones contribute to GA signaling by promoting the accumulation of the F-box protein SNE in Arabidopsis. DOI: 10.1016/j.xplc.2023.100517 ; PMID: 36597357
- CASC3 Biomolecular Condensates Restrict Turnip Crinkle Virus by Limiting Host Factor Availability. DOI: 10.1016/j.jmb.2023.167956 ; PMID: 36642157
- Co-immunoprecipitation of Hsp101 with cytosolic Hsc70. DOI: 10.1016/j.plaphy.2004.10.006 ; PMID: 15763661
- Virus induction of heat shock protein 70 reflects a general response to protein accumulation in the plant cytosol. DOI: 10.1104/pp.104.058958 ; PMID: 15805473
- Dynamic histone acetylation of late embryonic genes during seed germination. DOI: 10.1007/s11103-005-2081-x ; PMID: 16307366
- Arabidopsis cell wall proteome defined using multidimensional protein identification technology. DOI: 10.1002/pmic.200500046 ; PMID: 16287169
- The early responses of Arabidopsis thaliana cells to cadmium exposure explored by protein and metabolite profiling analyses. DOI: 10.1002/pmic.200500543 ; PMID: 16502469
- Identification and functional characterization of the BAG protein family in Arabidopsis thaliana. DOI: 10.1074/jbc.M511794200 ; PMID: 16636050
- Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. DOI: 10.1111/j.1365-313X.2006.02889.x ; PMID: 17059409
- Analysis of the soluble ATP-binding proteome of plant mitochondria identifies new proteins and nucleotide triphosphate interactions within the matrix. DOI: 10.1021/pr060403j ; PMID: 17137349
- A proteomics dissection of Arabidopsis thaliana vacuoles isolated from cell culture. DOI: 10.1074/mcp.M600250-MCP200 ; PMID: 17151019
- Calmodulin-binding protein phosphatase PP7 is involved in thermotolerance in Arabidopsis. DOI: 10.1111/j.1365-3040.2006.01613.x ; PMID: 17238907
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- A rhizosphere fungus enhances Arabidopsis thermotolerance through production of an HSP90 inhibitor. DOI: 10.1104/pp.107.101808 ; PMID: 17631526
- The E3 ligase AtCHIP ubiquitylates FtsH1, a component of the chloroplast FtsH protease, and affects protein degradation in chloroplasts. DOI: 10.1111/j.1365-313X.2007.03239.x ; PMID: 17714429
- Nuclear-mitochondrial cross-talk during heat shock in Arabidopsis cell culture. DOI: 10.1111/j.1365-313X.2007.03275.x ; PMID: 17883376
- Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. DOI: 10.1105/tpc.107.051896 ; PMID: 18065690
- General detoxification and stress responses are mediated by oxidized lipids through TGA transcription factors in Arabidopsis. DOI: 10.1105/tpc.107.054809 ; PMID: 18334669
- Cell identity mediates the response of Arabidopsis roots to abiotic stress. DOI: 10.1126/science.1153795 ; PMID: 18436742
Gene Resources
- UniProt: A0A178VCC0
- EMBL: CACRSJ010000106, CACSHJ010000089, LUHQ01000003
- AlphaFoldDB: A0A178VCC0
- EnsemblPlants: AT3G12580.1
- Gramene: AT3G12580.1
- KEGG: ath:AT3G12580
- Orthologous matrix: QADKSHW
- ExpressionAtlas: AT3G12580
- InterPro: IPR013126, IPR018181, IPR029047
- PANTHER: PTHR19375
- SUPFAM: SSF100920, SSF100934, SSF53067
- PROSITE: PS00297, PS00329, PS01036
- Gene3D: 1.20.1270.10, 2.60.34.10, 3.30.30.30
- OrthoDB: A0A178VCC0
- SWISS-MODEL: A0A178VCC0
- Conserved Domain Database: cd10233
Homologs
- Lotus japonicus Lj1g0009050, Lj1g0004521, Lj1g0001470, Lj1g0002023
- Medicago truncatula Medtr2g040370, Medtr2g040260, Medtr2g040160, Medtr2g040220, Medtr2g040350
- Oryza sativa OsctHSP70-1, HSP70, OsBiP2;Bip2, OsBip1, OsBiP5, OsBiP4, OsBiP3;BiP3
- Triticum aestivum TaHSP70-3, TaHSP70-2, TaHSP70-1, Traes_6DL_7662129AC
Sequences
cDNA Sequence
- >AT3G12580.1
CGGCTGAGATCTTTACTCGTGAACGTTCTCGAAAGCTCTTTGCCGACCCACTCTTCATTCATATATAAACAAACACCTCTCTGCCTTCTCTTCCTCACACAATCATAAACACAACAACACTCACAAATTCTCTTAAAGCTCACAGACGAATTCTTTCTATTTTTAATCTTTCCGGCGAACAATTCTGATCTCTAATAATGGCGGGTAAAGGTGAAGGTCCAGCTATCGGTATCGATCTCGGTACAACCTACTCTTGCGTCGGTGTTTGGCAACATGACCGCGTCGAAATCATCGCCAACGATCAAGGCAACCGCACCACTCCTTCCTACGTTGCTTTCACTGACAGCGAGCGTCTCATCGGGGATGCTGCCAAGAATCAAGTCGCCATGAACCCTACCAACACCGTCTTCGATGCTAAGCGTCTAATCGGAAGAAGATACAGTGATCCCTCTGTTCAAGCGGATAAGAGTCACTGGCCTTTTAAGGTTGTTTCCGGTCCAGGTGAGAAGCCTATGATTGTGGTTAACCACAAGGGAGAGGAGAAACAGTTCTCTGCTGAGGAAATCTCGTCGATGGTTCTTATTAAGATGCGGGAGATTGCAGAAGCTTTCCTTGGTTCTCCTGTTAAGAACGCTGTCGTTACAGTTCCTGCTTATTTCAACGACTCTCAGCGTCAAGCGACTAAGGACGCTGGAGTTATCTCTGGTCTCAACGTGATGCGTATCATCAATGAGCCAACTGCTGCTGCTATTGCTTACGGTCTTGACAAGAAGGCGTCGAGTGTTGGCGAGAAGAATGTTTTGATCTTTGATTTGGGAGGTGGTACTTTTGATGTGTCTTTGCTTACGATTGAGGAAGGTATCTTTGAAGTCAAGGCAACTGCTGGTGACACGCATCTTGGTGGTGAGGACTTCGACAACAGGATGGTTAATCATTTTGTTCAGGAGTTTAAGAGGAAGAACAAGAAGGATATTACTGGGAACCCGAGAGCTTTGAGGAGGCTTAGGACAGCTTGTGAGCGGGCGAAGAGAACTCTTTCTTCGACTGCTCAGACGACTATAGAGATTGACTCTCTTTTTGAGGGTATTGATTTCTACACTACCATCACTCGTGCTAGGTTCGAGGAGCTCAACATGGATTTGTTTAGGAAGTGTATGGAGCCAGTGGAGAAGTGTTTGAGGGATGCTAAGATGGACAAGAGCAGTGTTCATGATGTTGTTCTTGTTGGTGGCTCTACAAGGATTCCCAAAGTGCAGCAGCTTTTGCAAGACTTCTTCAATGGGAAAGAGCTCTGTAAAAGCATTAACCCGGACGAGGCTGTTGCTTACGGAGCAGCTGTGCAAGCTGCAATCTTGAGCGGTGAAGGGAATGAGAAGGTCCAGGACTTGTTACTTCTTGATGTCACTCCTCTGTCCTTGGGTTTGGAAACTGCCGGTGGTGTTATGACTGTTTTGATTCCGAGGAACACCACAATTCCGACCAAGAAAGAGCAGATATTCTCTACCTATTCAGACAACCAGCCCGGTGTACTGATCCAGGTCTACGAAGGAGAGAGGGCACGAACAAAGGACAACAACCTTTTGGGAAAGTTCGAGCTCAGTGGTATACCACCTGCTCCACGAGGTGTACCGCAGATTACTGTCTGTTTCGACATCGACGCCAATGGTATCCTGAATGTGTCGGCTGAGGACAAGACGACTGGTCAGAAGAACAAGATCACAATCACAAACGACAAGGGAAGGTTATCAAAGGAAGAGATCGAGAAGATGGTACAAGAGGCAGAGAAGTACAAGGCTGAGGATGAAGAACACAAGAAGAAGGTGGATGCAAAGAACGCTCTCGAGAACTATGCATACAACATGAGGAACACGATCAAGGACGAGAAGATCGCATCTAAGCTTGACGCAGCTGACAAGAAGAAGATTGAGGATGCAATCGACCAAGCTATTGAATGGTTAGATGGGAATCAACTGGCTGAGGCAGATGAGTTCGAGGATAAGATGAAGGAGCTCGAGTCTCTTTGCAACCCTATTATTGCAAGAATGTACCAAGGAGCTGGGCCTGATATGGGTGGTGCAGGAGGAATGGATGACGACACACCTGCTGGTGGTAGCGGCGGTGCTGGCCCAAAGATTGAAGAAGTTGATTAAGCCTTTTGGCTTTTGTTTACTCTGTTTGCTTGAGATTCTAGTTGGTTTCTTGTTCTTAGTTTTATCTTTCTATGTCACTCTGAAACTGGTGTGTGATCATTTTGATGCTTTAAGAATTTAGCTTTACCGTTTTTAAAACTCGCTCTGACCTATGAAAGACGACTGGGCATAATACTCTACACGAAATATAGTAGACAAAGTGAAAGAAGTTAAGTTCATGGTTTAAGGAATATGATCTTAGCACTTTGATTTTATAATTAACCATCCAATATGAATCCAAGATCTCTTGTTATACATATTAAAGAAAATTTTCTTCTTATTTCAATATAGTTTATCTGAAAAACCGTACAAATTGTAGTGGGATTCCATA
CDS Sequence
- >AT3G12580.1
ATGGCGGGTAAAGGTGAAGGTCCAGCTATCGGTATCGATCTCGGTACAACCTACTCTTGCGTCGGTGTTTGGCAACATGACCGCGTCGAAATCATCGCCAACGATCAAGGCAACCGCACCACTCCTTCCTACGTTGCTTTCACTGACAGCGAGCGTCTCATCGGGGATGCTGCCAAGAATCAAGTCGCCATGAACCCTACCAACACCGTCTTCGATGCTAAGCGTCTAATCGGAAGAAGATACAGTGATCCCTCTGTTCAAGCGGATAAGAGTCACTGGCCTTTTAAGGTTGTTTCCGGTCCAGGTGAGAAGCCTATGATTGTGGTTAACCACAAGGGAGAGGAGAAACAGTTCTCTGCTGAGGAAATCTCGTCGATGGTTCTTATTAAGATGCGGGAGATTGCAGAAGCTTTCCTTGGTTCTCCTGTTAAGAACGCTGTCGTTACAGTTCCTGCTTATTTCAACGACTCTCAGCGTCAAGCGACTAAGGACGCTGGAGTTATCTCTGGTCTCAACGTGATGCGTATCATCAATGAGCCAACTGCTGCTGCTATTGCTTACGGTCTTGACAAGAAGGCGTCGAGTGTTGGCGAGAAGAATGTTTTGATCTTTGATTTGGGAGGTGGTACTTTTGATGTGTCTTTGCTTACGATTGAGGAAGGTATCTTTGAAGTCAAGGCAACTGCTGGTGACACGCATCTTGGTGGTGAGGACTTCGACAACAGGATGGTTAATCATTTTGTTCAGGAGTTTAAGAGGAAGAACAAGAAGGATATTACTGGGAACCCGAGAGCTTTGAGGAGGCTTAGGACAGCTTGTGAGCGGGCGAAGAGAACTCTTTCTTCGACTGCTCAGACGACTATAGAGATTGACTCTCTTTTTGAGGGTATTGATTTCTACACTACCATCACTCGTGCTAGGTTCGAGGAGCTCAACATGGATTTGTTTAGGAAGTGTATGGAGCCAGTGGAGAAGTGTTTGAGGGATGCTAAGATGGACAAGAGCAGTGTTCATGATGTTGTTCTTGTTGGTGGCTCTACAAGGATTCCCAAAGTGCAGCAGCTTTTGCAAGACTTCTTCAATGGGAAAGAGCTCTGTAAAAGCATTAACCCGGACGAGGCTGTTGCTTACGGAGCAGCTGTGCAAGCTGCAATCTTGAGCGGTGAAGGGAATGAGAAGGTCCAGGACTTGTTACTTCTTGATGTCACTCCTCTGTCCTTGGGTTTGGAAACTGCCGGTGGTGTTATGACTGTTTTGATTCCGAGGAACACCACAATTCCGACCAAGAAAGAGCAGATATTCTCTACCTATTCAGACAACCAGCCCGGTGTACTGATCCAGGTCTACGAAGGAGAGAGGGCACGAACAAAGGACAACAACCTTTTGGGAAAGTTCGAGCTCAGTGGTATACCACCTGCTCCACGAGGTGTACCGCAGATTACTGTCTGTTTCGACATCGACGCCAATGGTATCCTGAATGTGTCGGCTGAGGACAAGACGACTGGTCAGAAGAACAAGATCACAATCACAAACGACAAGGGAAGGTTATCAAAGGAAGAGATCGAGAAGATGGTACAAGAGGCAGAGAAGTACAAGGCTGAGGATGAAGAACACAAGAAGAAGGTGGATGCAAAGAACGCTCTCGAGAACTATGCATACAACATGAGGAACACGATCAAGGACGAGAAGATCGCATCTAAGCTTGACGCAGCTGACAAGAAGAAGATTGAGGATGCAATCGACCAAGCTATTGAATGGTTAGATGGGAATCAACTGGCTGAGGCAGATGAGTTCGAGGATAAGATGAAGGAGCTCGAGTCTCTTTGCAACCCTATTATTGCAAGAATGTACCAAGGAGCTGGGCCTGATATGGGTGGTGCAGGAGGAATGGATGACGACACACCTGCTGGTGGTAGCGGCGGTGCTGGCCCAAAGATTGAAGAAGTTGATTAA
Protein Sequence
- >AT3G12580.1
MAGKGEGPAIGIDLGTTYSCVGVWQHDRVEIIANDQGNRTTPSYVAFTDSERLIGDAAKNQVAMNPTNTVFDAKRLIGRRYSDPSVQADKSHWPFKVVSGPGEKPMIVVNHKGEEKQFSAEEISSMVLIKMREIAEAFLGSPVKNAVVTVPAYFNDSQRQATKDAGVISGLNVMRIINEPTAAAIAYGLDKKASSVGEKNVLIFDLGGGTFDVSLLTIEEGIFEVKATAGDTHLGGEDFDNRMVNHFVQEFKRKNKKDITGNPRALRRLRTACERAKRTLSSTAQTTIEIDSLFEGIDFYTTITRARFEELNMDLFRKCMEPVEKCLRDAKMDKSSVHDVVLVGGSTRIPKVQQLLQDFFNGKELCKSINPDEAVAYGAAVQAAILSGEGNEKVQDLLLLDVTPLSLGLETAGGVMTVLIPRNTTIPTKKEQIFSTYSDNQPGVLIQVYEGERARTKDNNLLGKFELSGIPPAPRGVPQITVCFDIDANGILNVSAEDKTTGQKNKITITNDKGRLSKEEIEKMVQEAEKYKAEDEEHKKKVDAKNALENYAYNMRNTIKDEKIASKLDAADKKKIEDAIDQAIEWLDGNQLAEADEFEDKMKELESLCNPIIARMYQGAGPDMGGAGGMDDDTPAGGSGGAGPKIEEVD