Gene Details:
- Gene ID: AT3G11260
- Gene Symbol: WOX5, WOX5B
- Gene Name: WUSCHEL related homeobox 5, WUSCHEL related homeobox 5B
- Description: WUSCHEL related homeobox 5;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0020149 — quiescent center — centro de division de células del meristema (Spanish, exact), 静止中心 (Japanese, exact)
Germplasm Phenotype:
- tin — The tin mutant was slightly shorter than the wild type when grown on the control medium, but maintained normal root and hypocotyl growth on turanose. Turanose mimics sucrose in its ability to stimulate adventitious roots on wild-type hypocotyls. In the tin mutant the number of adventitious roots induced by turanose and sucrose was clearly lower. Adult tin plants did not show any apparent orphological differences from the wild type, but their flowering time was delayed due to a prolonged vegetative phase. tin overproduced ethylene on the control medium; and sucrose, but not turanose, enhanced ethylene production. The control tin, and the sucrose-treated tin mutant, displays a higher IAA-conjugate level when compared with the wild type.
Function-related keywords:
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Rapid identification of Arabidopsis insertion mutants by non-radioactive detection of T-DNA tagged genes. DOI: 10.1046/j.1365-313x.2002.01416.x ; PMID: 12383089
- Expression dynamics of WOX genes mark cell fate decisions during early embryonic patterning in Arabidopsis thaliana. DOI: 10.1242/dev.00963 ; PMID: 14711878
- A turanose-insensitive mutant suggests a role for WOX5 in auxin homeostasis in Arabidopsis thaliana. DOI: 10.1111/j.1365-313X.2005.02555.x ; PMID: 16262712
- Phylogenomics of plant genomes: a methodology for genome-wide searches for orthologs in plants. DOI: 10.1186/1471-2164-9-183 ; PMID: 18426584
- Key divisions in the early Arabidopsis embryo require POL and PLL1 phosphatases to establish the root stem cell organizer and vascular axis. DOI: 10.1016/j.devcel.2008.05.008 ; PMID: 18606144
- Conserved factors regulate signalling in Arabidopsis thaliana shoot and root stem cell organizers. DOI: 10.1038/nature05703 ; PMID: 17429400
- A signaling module controlling the stem cell niche in Arabidopsis root meristems. DOI: 10.1016/j.cub.2009.03.060 ; PMID: 19398337
- Discrete shoot and root stem cell-promoting WUS/WOX5 functions are an evolutionary innovation of angiosperms. DOI: 10.1093/molbev/msp084 ; PMID: 19387013
- The association of homeobox gene expression with stem cell formation and morphogenesis in cultured Medicago truncatula. DOI: 10.1007/s00425-009-0988-1 ; PMID: 19639337
- Is the Arabidopsis root niche protected by sequestration of the CLE40 signal by its putative receptor ACR4? DOI: 10.4161/psb.4.7.8970 ; PMID: 19820344
- Arabidopsis regeneration from multiple tissues occurs via a root development pathway. DOI: 10.1016/j.devcel.2010.02.004 ; PMID: 20230752
- Auxin regulates distal stem cell differentiation in Arabidopsis roots. DOI: 10.1073/pnas.1000672107 ; PMID: 20543136
- TDIF peptide signaling regulates vascular stem cell proliferation via the WOX4 homeobox gene in Arabidopsis. DOI: 10.1105/tpc.110.076083 ; PMID: 20729381
- Genome-wide analysis of WOX gene family in rice, sorghum, maize, Arabidopsis and poplar. DOI: 10.1111/j.1744-7909.2010.00982.x ; PMID: 20977659
- Arabidopsis Tyrosylprotein sulfotransferase acts in the auxin/PLETHORA pathway in regulating postembryonic maintenance of the root stem cell niche. DOI: 10.1105/tpc.110.075721 ; PMID: 21045165
- The role of the acyl modification, palmitoylation, in Arabidopsis stem cell regulation. DOI: 10.4161/psb.5.8.12409 ; PMID: 21460611
- The invention of WUS-like stem cell-promoting functions in plants predates leptosporangiate ferns. DOI: 10.1007/s11103-011-9851-4 ; PMID: 22076631
- Wuschel-related homeobox5 gene expression and interaction of CLE peptides with components of the systemic control add two pieces to the puzzle of autoregulation of nodulation. DOI: 10.1104/pp.111.188078 ; PMID: 22232385
- Mutations in two non-canonical Arabidopsis SWI2/SNF2 chromatin remodeling ATPases cause embryogenesis and stem cell maintenance defects. DOI: 10.1111/tpj.12009 ; PMID: 23062007
- CLE signaling systems during plant development and nematode infection. DOI: 10.1093/pcp/pcs136 ; PMID: 23045524
- Tissue-specific expression of SMALL AUXIN UP RNA41 differentially regulates cell expansion and root meristem patterning in Arabidopsis. DOI: 10.1093/pcp/pct028 ; PMID: 23396598
- WOX5-IAA17 feedback circuit-mediated cellular auxin response is crucial for the patterning of root stem cell niches in Arabidopsis. DOI: 10.1093/mp/sst118 ; PMID: 23939433
- Auxin gradient is crucial for the maintenance of root distal stem cell identity in Arabidopsis. DOI: 10.4161/psb.26429 ; PMID: 24056047
- A CLE-WOX signalling module regulates root meristem maintenance and vascular tissue development in rice. DOI: 10.1093/jxb/ert301 ; PMID: 24043854
- The key players of the primary root growth and development also function in lateral roots in Arabidopsis. DOI: 10.1007/s00299-014-1575-x ; PMID: 24504658
- WOX5 suppresses CYCLIN D activity to establish quiescence at the center of the root stem cell niche. DOI: 10.1016/j.cub.2014.07.019 ; PMID: 25127220
- Precise control of plant stem cell activity through parallel regulatory inputs. DOI: 10.1242/dev.110148 ; PMID: 25256342
- Control of plant stem cell function by conserved interacting transcriptional regulators. DOI: 10.1038/nature13853 ; PMID: 25363783
- ROW1 maintains quiescent centre identity by confining WOX5 expression to specific cells. DOI: 10.1038/ncomms7003 ; PMID: 25631790
- Establishment of embryonic shoot-root axis is involved in auxin and cytokinin response during Arabidopsis somatic embryogenesis. DOI: 10.3389/fpls.2014.00792 ; PMID: 25642237
- Evidence for intermolecular interactions between the intracellular domains of the arabidopsis receptor-like kinase ACR4, its homologs and the Wox5 transcription factor. DOI: 10.1371/journal.pone.0118861 ; PMID: 25756623
- Ribonuclease J is required for chloroplast and embryo development in Arabidopsis. DOI: 10.1093/jxb/erv010 ; PMID: 25871650
- and CLE40-mediated columella stem cell homeostasis in Arabidopsis. DOI: 10.1093/jxb/erv257 ; PMID: 26019259
- The Arabidopsis thaliana elongator complex subunit 2 epigenetically affects root development. DOI: 10.1093/jxb/erv230 ; PMID: 25998905
- A tetratricopeptide repeat domain-containing protein SSR1 located in mitochondria is involved in root development and auxin polar transport in Arabidopsis. DOI: 10.1111/tpj.12911 ; PMID: 26072661
- Organizer-Derived WOX5 Signal Maintains Root Columella Stem Cells through Chromatin-Mediated Repression of CDF4 Expression. DOI: 10.1016/j.devcel.2015.04.024 ; PMID: 26028217
- Two-Step Functional Innovation of the Stem-Cell Factors WUS/WOX5 during Plant Evolution. DOI: 10.1093/molbev/msw263 ; PMID: 28053005
- Sirtinol, a Sir2 protein inhibitor, affects stem cell maintenance and root development in Arabidopsis thaliana by modulating auxin-cytokinin signaling components. DOI: 10.1038/srep42450 ; PMID: 28195159
- Paracrine brassinosteroid signaling at the stem cell niche controls cellular regeneration. DOI: 10.1242/jcs.204065 ; PMID: 29242230
- GIF Transcriptional Coregulators Control Root Meristem Homeostasis. DOI: 10.1105/tpc.17.00856 ; PMID: 29352064
- Control of auxin-induced callus formation by bZIP59-LBD complex in Arabidopsis regeneration. DOI: 10.1038/s41477-017-0095-4 ; PMID: 29358751
- Impairment of Meristem Proliferation in Plants Lacking the Mitochondrial Protease AtFTSH4. DOI: 10.3390/ijms19030853 ; PMID: 29538317
- Histone chaperones play crucial roles in maintenance of stem cell niche during plant root development. DOI: 10.1111/tpj.13933 ; PMID: 29676825
- The 6xABRE Synthetic Promoter Enables the Spatiotemporal Analysis of ABA-Mediated Transcriptional Regulation. DOI: 10.1104/pp.18.00401 ; PMID: 29884679
- Cytokinin signalling regulates organ identity via the AHK4 receptor in Arabidopsis. DOI: 10.1242/dev.163907 ; PMID: 29967282
- Nα-Acetyltransferases 10 and 15 are Required for the Correct Initiation of Endosperm Cellularization in Arabidopsis. DOI: 10.1093/pcp/pcy135 ; PMID: 30020502
- Epigenetic reprogramming by histone acetyltransferase HAG1/AtGCN5 is required for pluripotency acquisition in Arabidopsis. DOI: 10.15252/embj.201798726 ; PMID: 30061313
- Whole Mount in situ Localization of miRNAs and mRNAs During Somatic Embryogenesis in Arabidopsis. DOI: 10.3389/fpls.2018.01277 ; PMID: 30233621
- Elongator Is Required for Root Stem Cell Maintenance by Regulating SHORTROOT Transcription. DOI: 10.1104/pp.18.00534 ; PMID: 30401723
- Involvement of Pyridoxine/Pyridoxamine 5'-Phosphate Oxidase (PDX3) in Ethylene-Induced Auxin Biosynthesis in the Arabidopsis Root. DOI: 10.14348/molcells.2018.0363 ; PMID: 30453730
- Salicylic Acid Affects Root Meristem Patterning via Auxin Distribution in a Concentration-Dependent Manner. DOI: 10.1104/pp.19.00130 ; PMID: 31036755
- SERK Receptor-like Kinases Control Division Patterns of Vascular Precursors and Ground Tissue Stem Cells during Embryo Development in Arabidopsis. DOI: 10.1016/j.molp.2019.04.011 ; PMID: 31059824
- and Cytokinin-Regulated Embryogenesis. DOI: 10.1104/pp.19.00144 ; PMID: 31341004
- AtNSE1 and AtNSE3 are required for embryo pattern formation and maintenance of cell viability during Arabidopsis embryogenesis. DOI: 10.1093/jxb/erz373 ; PMID: 31408172
- Redox-Mediated Endocytosis of a Receptor-Like Kinase during Distal Stem Cell Differentiation Depends on Its Tumor Necrosis Factor Receptor Domain. DOI: 10.1104/pp.19.00616 ; PMID: 31471454
- CLE40 Signaling Regulates Root Stem Cell Fate. DOI: 10.1104/pp.19.00914 ; PMID: 31806736
- Root-knot nematodes induce gall formation by recruiting developmental pathways of post-embryonic organogenesis and regeneration to promote transient pluripotency. DOI: 10.1111/nph.16521 ; PMID: 32129890
- ETHYLENE INSENSITIVE 3 suppresses plant de novo root regeneration from leaf explants and mediates age-regulated regeneration decline. DOI: 10.1242/dev.179457 ; PMID: 32291272
- Mutation of MEDIATOR 18 and chromate trigger twinning of the primary root meristem in Arabidopsis. DOI: 10.1111/pce.13786 ; PMID: 32400913
- Phosphoethanolamine N-methyltransferase 1 contributes to maintenance of root apical meristem by affecting ROS and auxin-regulated cell differentiation in Arabidopsis. DOI: 10.1111/nph.16028 ; PMID: 31246280
- SEUSS integrates transcriptional and epigenetic control of root stem cell organizer specification. DOI: 10.15252/embj.2020105047 ; PMID: 32926464
- The nature of the interaction Azospirillum-Arabidopsis determine the molecular and morphological changes in root and plant growth promotion. DOI: 10.1007/s00709-020-01552-7 ; PMID: 33009649
- A WOX/Auxin Biosynthesis Module Controls Growth to Shape Leaf Form. DOI: 10.1016/j.cub.2020.09.037 ; PMID: 33035489
- Salicylic acid promotes quiescent center cell division through ROS accumulation and down-regulation of PLT1, PLT2, and WOX5. DOI: 10.1111/jipb.13020 ; PMID: 33017089
- Early Low-Fluence Red Light or Darkness Modulates the Shoot Regeneration Capacity of Excised Arabidopsis Roots. DOI: 10.3390/plants9101378 ; PMID: 33081176
- Polar auxin transport May Be responsive to specific features of flavonoid structure. DOI: 10.1016/j.phytochem.2021.112702 ; PMID: 33636576
- Conserved and differentiated functions of CIK receptor kinases in modulating stem cell signaling in Arabidopsis. DOI: 10.1016/j.molp.2021.04.001 ; PMID: 33823234
- N,N-dimethyl-hexadecylamine modulates Arabidopsis root growth through modifying the balance between stem cell niche and jasmonic acid-dependent gene expression. DOI: 10.1016/j.gep.2021.119201 ; PMID: 34329770
- Cadmium affects cell niches maintenance in Arabidopsis thaliana post-embryonic shoot and root apical meristem by altering the expression of WUS/WOX homolog genes and cytokinin accumulation. DOI: 10.1016/j.plaphy.2021.09.014 ; PMID: 34530323
- Pluripotency acquisition in the middle cell layer of callus is required for organ regeneration. DOI: 10.1038/s41477-021-01015-8 ; PMID: 34782770
- Early sensing of phosphate deprivation triggers the formation of extra root cap cell layers via SOMBRERO through a process antagonized by auxin signaling. DOI: 10.1007/s11103-021-01224-x ; PMID: 34855067
- Vascular function of the T3/modern clade WUSCHEL-Related HOMEOBOX transcription factor genes predate apical meristem-maintenance function. DOI: 10.1186/s12870-022-03590-0 ; PMID: 35462532
- Phytochrome-interacting factors orchestrate hypocotyl adventitious root initiation in Arabidopsis. DOI: 10.1242/dev.200362 ; PMID: 35502748
- Ectopic expression of WOX5 promotes cytokinin signaling and de novo shoot regeneration. DOI: 10.1007/s00299-022-02932-4 ; PMID: 36219248
- High auxin stimulates callus through SDG8-mediated histone H3K36 methylation in Arabidopsis. DOI: 10.1111/jipb.13387 ; PMID: 36250442
- Plant lineage-specific PIKMIN1 drives APC/CCCS52A2 E3-ligase activity-dependent cell division. DOI: 10.1093/plphys/kiac528 ; PMID: 36423220
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Sequences:
cDNA Sequence
- >AT3G11260.1
ATACTAATATATACACACAAAAACATATGTAAATATAGATGGAACAGAAGCCTAGATAGGTTAGGATAAAGAAAACGATCAAATCTGCAAAGATCAGTCTCTCCCAAATCCCCAAAAAAAACAAAGCATGCATTTCGTAATAAACAACTCATCATAAAACGACACATAACTCGAAAACCTCTCCTCCCGACATTTCATCAATTCATTTCTCTTTTTATTTTCGAAAAGATGAAAACTTAATAAATTATTATGAACAATCTTACTATATATATGGATATATACACAGGCCCTAAAACGTAAAACAGTTGAGGACTTTACATCTGAACATGTCTTTCTCCGTGAAAGGTCGAAGCTTACGTGGCAACAATAACGGAGGAACGGGGACGAAGTGCGGGAGATGGAATCCAACGGTGGAGCAGTTGAAGATATTGACTGATCTGTTTCGAGCCGGTCTTAGAACTCCAACAACTGATCAGATTCAGAAGATCTCTACGGAGCTCAGTTTCTACGGCAAGATAGAGAGCAAGAATGTTTTCTATTGGTTTCAGAATCATAAGGCTAGGGAGAGGCAGAAACGTCGTAAAATCTCCATTGATTTTGATCATCATCATCATCAACCATCAACTAGAGATGTTTTTGAAATAAGCGAAGAAGATTGTCAAGAGGAAGAGAAGGTGATAGAGACATTACAACTCTTTCCGGTGAATTCATTTGAAGACTCCAACTCCAAGGTGGACAAAATGAGAGCTAGAGGCAATAACCAGTACCGTGAATATATTCGAGAGACCACCACGACGTCGTTTTCTCCATACTCATCATGTGGAGCTGAAATGGAACATCCACCGCCATTAGATCTTCGATTAAGCTTTCTTTAAGTCATTGACCACAATAACAAAAGAAAAAAAACAGATGCTTTAGCCTTTAAAATGTTGTTGTATTTTGAATTATGACATATTATCCGATGCATGGTTTATGAGATATTTTCCAATGCATGGTTTATCAAAAAGTTGTCTCATTTTGTTTGATATAAGAATCTATGTTATGGAATGCGT
CDS Sequence
- >AT3G11260.1
ATGTCTTTCTCCGTGAAAGGTCGAAGCTTACGTGGCAACAATAACGGAGGAACGGGGACGAAGTGCGGGAGATGGAATCCAACGGTGGAGCAGTTGAAGATATTGACTGATCTGTTTCGAGCCGGTCTTAGAACTCCAACAACTGATCAGATTCAGAAGATCTCTACGGAGCTCAGTTTCTACGGCAAGATAGAGAGCAAGAATGTTTTCTATTGGTTTCAGAATCATAAGGCTAGGGAGAGGCAGAAACGTCGTAAAATCTCCATTGATTTTGATCATCATCATCATCAACCATCAACTAGAGATGTTTTTGAAATAAGCGAAGAAGATTGTCAAGAGGAAGAGAAGGTGATAGAGACATTACAACTCTTTCCGGTGAATTCATTTGAAGACTCCAACTCCAAGGTGGACAAAATGAGAGCTAGAGGCAATAACCAGTACCGTGAATATATTCGAGAGACCACCACGACGTCGTTTTCTCCATACTCATCATGTGGAGCTGAAATGGAACATCCACCGCCATTAGATCTTCGATTAAGCTTTCTTTAA
Protein Sequence
- >AT3G11260.1
MSFSVKGRSLRGNNNGGTGTKCGRWNPTVEQLKILTDLFRAGLRTPTTDQIQKISTELSFYGKIESKNVFYWFQNHKARERQKRRKISIDFDHHHHQPSTRDVFEISEEDCQEEEKVIETLQLFPVNSFEDSNSKVDKMRARGNNQYREYIRETTTTSFSPYSSCGAEMEHPPPLDLRLSFL