Information report for AT3G10800
Gene Details
|
|
Functional Descriptions
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- GO:0006990 — involved in — positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response
- GO:0005634 — located in — nucleus
- GO:0009408 — acts upstream of or within — response to heat
- GO:0048471 — located in — perinuclear region of cytoplasm
- GO:0005789 — is active in — endoplasmic reticulum membrane
- GO:0005654 — located in — nucleoplasm
- GO:0030968 — acts upstream of or within — endoplasmic reticulum unfolded protein response
- GO:0006990 — acts upstream of or within — positive regulation of transcription from RNA polymerase II promoter involved in unfolded protein response
- GO:0034976 — acts upstream of or within — response to endoplasmic reticulum stress
- GO:0006986 — acts upstream of or within — response to unfolded protein
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0005635 — located in — nuclear envelope
- GO:0005634 — is active in — nucleus
- GO:0005783 — located in — endoplasmic reticulum
- GO:0016020 — located in — membrane
- GO:0005737 — located in — cytoplasm
- GO:0005515 — enables — protein binding
- CS73356 — hypersensitivity to endoplasmic reticulum (ER) stress
- SALK_132285C — The transcript levels of three UPR-related genes, BiP1, BiP2, and BiP3, are lower in zip28-2 mutant seedlings than in wild type seedlings following a UPR-inducing treatment with tunicamycin.
- zip28 — Increased sensitivity to ER stress inducers DTT and tunicamycin.
- zip28-1 — The transcript levels of three UPR-related genes, BiP1, BiP2, and BiP3, are lower in zip28-1 mutant seedlings than in wild type seedlings following a UPR-inducing treatment with tunicamycin.
Functional Keywords
Literature and News
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- bZIP transcription factors in Arabidopsis. DOI: 10.1016/s1360-1385(01)02223-3 ; PMID: 11906833
- Resources for targeted insertional and deletional mutagenesis in Arabidopsis. DOI: 10.1023/B:PLAN.0000009271.08420.d9 ; PMID: 14756312
- Dimerization specificity of all 67 B-ZIP motifs in Arabidopsis thaliana: a comparison to Homo sapiens B-ZIP motifs. DOI: 10.1093/nar/gkh653 ; PMID: 15226410
- Cross-species annotation of basic leucine zipper factor interactions: Insight into the evolution of closed interaction networks. DOI: 10.1093/molbev/msl022 ; PMID: 16731568
- An early response regulatory cluster induced by low temperature and hydrogen peroxide in seedlings of chilling-tolerant japonica rice. DOI: 10.1186/1471-2164-8-175 ; PMID: 17577400
- Salt stress responses in Arabidopsis utilize a signal transduction pathway related to endoplasmic reticulum stress signaling. DOI: 10.1111/j.1365-313X.2007.03195.x ; PMID: 17662035
- An endoplasmic reticulum stress response in Arabidopsis is mediated by proteolytic processing and nuclear relocation of a membrane-associated transcription factor, bZIP28. DOI: 10.1105/tpc.106.050021 ; PMID: 18156219
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Identification of an Arabidopsis transmembrane bZIP transcription factor involved in the endoplasmic reticulum stress response. DOI: 10.1016/j.bbrc.2008.07.021 ; PMID: 18634751
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- A membrane-tethered transcription factor defines a branch of the heat stress response in Arabidopsis thaliana. DOI: 10.1073/pnas.0808463105 ; PMID: 18849477
- bZIP28 and NF-Y transcription factors are activated by ER stress and assemble into a transcriptional complex to regulate stress response genes in Arabidopsis. DOI: 10.1105/tpc.109.072173 ; PMID: 20207753
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Signaling from the endoplasmic reticulum activates brassinosteroid signaling and promotes acclimation to stress in Arabidopsis. DOI: 10.1126/scisignal.2001140 ; PMID: 20876872
- The mutualistic fungus Piriformospora indica colonizes Arabidopsis roots by inducing an endoplasmic reticulum stress-triggered caspase-dependent cell death. DOI: 10.1105/tpc.111.093260 ; PMID: 22337916
- Plant transducers of the endoplasmic reticulum unfolded protein response. DOI: 10.1016/j.tplants.2012.06.014 ; PMID: 22796463
- BINDING PROTEIN is a master regulator of the endoplasmic reticulum stress sensor/transducer bZIP28 in Arabidopsis. DOI: 10.1105/tpc.113.110684 ; PMID: 23624714
- The lumen-facing domain is important for the biological function and organelle-to-organelle movement of bZIP28 during ER stress in Arabidopsis. DOI: 10.1093/mp/sst059 ; PMID: 23558471
- Four distinct types of dehydration stress memory genes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-13-229 ; PMID: 24377444
- Protein kinase and ribonuclease domains of IRE1 confer stress tolerance, vegetative growth, and reproductive development in Arabidopsis. DOI: 10.1073/pnas.1314749110 ; PMID: 24145452
- Exogenous salicylic acid activates two signaling arms of the unfolded protein response in Arabidopsis. DOI: 10.1093/pcp/pcu108 ; PMID: 25138441
- Transcription factor interaction with COMPASS-like complex regulates histone H3K4 trimethylation for specific gene expression in plants. DOI: 10.1073/pnas.1419703112 ; PMID: 25730865
- The THERMOSENSITIVE MALE STERILE 1 Interacts with the BiPs via DnaJ Domain and Stimulates Their ATPase Enzyme Activities in Arabidopsis. DOI: 10.1371/journal.pone.0132500 ; PMID: 26186593
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- The polyamine spermine induces the unfolded protein response via the MAPK cascade in Arabidopsis. DOI: 10.3389/fpls.2015.00687 ; PMID: 26442007
- Unique COPII component AtSar1a/AtSec23a pair is required for the distinct function of protein ER export in Arabidopsis thaliana. DOI: 10.1073/pnas.1519333112 ; PMID: 26578783
- CPR5 modulates salicylic acid and the unfolded protein response to manage tradeoffs between plant growth and stress responses. DOI: 10.1111/tpj.13397 ; PMID: 27747970
- The UPR branch IRE1-bZIP60 in plants plays an essential role in viral infection and is complementary to the only UPR pathway in yeast. DOI: 10.1371/journal.pgen.1005164 ; PMID: 25875739
- Unfolded protein response activation compensates endoplasmic reticulum-associated degradation deficiency in Arabidopsis. DOI: 10.1111/jipb.12544 ; PMID: 28418178
- Tissue-Specific Transcriptomics Reveals an Important Role of the Unfolded Protein Response in Maintaining Fertility upon Heat Stress in Arabidopsis. DOI: 10.1105/tpc.16.00916 ; PMID: 28442596
- The G-Box Transcriptional Regulatory Code in Arabidopsis. DOI: 10.1104/pp.17.01086 ; PMID: 28864470
- Coordination between bZIP28 and HSFA2 in the regulation of heat response signals in Arabidopsis. DOI: 10.1080/15592324.2017.1376159 ; PMID: 28873003
- Recovery from temporary endoplasmic reticulum stress in plants relies on the tissue-specific and largely independent roles of bZIP28 and bZIP60, as well as an antagonizing function of BAX-Inhibitor 1 upon the pro-adaptive signaling mediated by bZIP28. DOI: 10.1111/tpj.13768 ; PMID: 29124827
- ER-Anchored Transcription Factors bZIP17 and bZIP28 Regulate Root Elongation. DOI: 10.1104/pp.17.01414 ; PMID: 29367234
- Arabidopsis GAAP1 and GAAP3 Modulate the Unfolded Protein Response and the Onset of Cell Death in Response to ER Stress. DOI: 10.3389/fpls.2018.00348 ; PMID: 29616060
- WRKY7, -11 and -17 transcription factors are modulators of the bZIP28 branch of the unfolded protein response during PAMP-triggered immunity in Arabidopsis thaliana. DOI: 10.1016/j.plantsci.2018.09.019 ; PMID: 30466590
- Arabidopsis GAAP1 to GAAP3 Play Redundant Role in Cell Death Inhibition by Suppressing the Upregulation of Salicylic Acid Pathway Under Endoplasmic Reticulum Stress. DOI: 10.3389/fpls.2019.01032 ; PMID: 31507623
- Endoplasmic reticulum-mediated unfolded protein response is an integral part of singlet oxygen signalling in plants. DOI: 10.1111/tpj.14700 ; PMID: 31975462
- The Unfolded Protein Response Modulates a Phosphoinositide-Binding Protein through the IRE1-bZIP60 Pathway. DOI: 10.1104/pp.19.01488 ; PMID: 32205450
- Multiple ER-to-nucleus stress signaling pathways are activated during Plantago asiatica mosaic virus and Turnip mosaic virus infection in Arabidopsis thaliana. DOI: 10.1111/tpj.14798 ; PMID: 32390256
- An ER-Golgi Tethering Factor SLOH4/MIP3 Is Involved in Long-Term Heat Tolerance of Arabidopsis. DOI: 10.1093/pcp/pcaa157 ; PMID: 33367686
- Arabidopsis Defense against the Pathogenic Fungus Drechslera gigantea Is Dependent on the Integrity of the Unfolded Protein Response. DOI: 10.3390/biom11020240 ; PMID: 33567651
- Susceptibility factor RTP1 negatively regulates Phytophthora parasitica resistance via modulating UPR regulators bZIP60 and bZIP28. DOI: 10.1093/plphys/kiab126 ; PMID: 33720348
- Two γ-zeins induce the unfolded protein response. DOI: 10.1093/plphys/kiab367 ; PMID: 34618077
- Stress response proteins NRP1 and NRP2 are pro-survival factors that inhibit cell death during ER stress. DOI: 10.1093/plphys/kiab335 ; PMID: 34618053
- Constitutive Photomorphogenic 1 Enhances ER Stress Tolerance in Arabidopsis. DOI: 10.3390/ijms221910772 ; PMID: 34639112
- Advanced genomics identifies growth effectors for proteotoxic ER stress recovery in Arabidopsis thaliana. DOI: 10.1038/s42003-021-02964-8 ; PMID: 35017639
- Arabidopsis TBP-ASSOCIATED FACTOR 12 ortholog NOBIRO6 controls root elongation with unfolded protein response cofactor activity. DOI: 10.1073/pnas.2120219119 ; PMID: 35115407
- Expression Characterization of AtPDI11 and Functional Analysis of AtPDI11 D Domain in Oxidative Protein Folding. DOI: 10.3390/ijms23031409 ; PMID: 35163331
- Phytochrome B Positively Regulates Red Light-Mediated ER Stress Response in Arabidopsis. DOI: 10.3389/fpls.2022.846294 ; PMID: 35283886
- bZIP17 regulates heat stress tolerance at reproductive stage in Arabidopsis. DOI: 10.1007/s42994-021-00062-1 ; PMID: 36304196
- The role of protein phosphatase 2A (PP2A) in the unfolded protein response (UPR) of plants. DOI: 10.1016/j.bbrc.2023.05.106 ; PMID: 37290287
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- bZIP transcription factors in Arabidopsis. DOI: 10.1016/s1360-1385(01)02223-3 ; PMID: 11906833
Gene Resources
- UniProt: A0A178VDM1
- EMBL: LUHQ01000003
- AlphaFoldDB: A0A178VDM1
- EnsemblPlants: AT3G10800.1
- Gramene: AT3G10800.1
- KEGG: ath:AT3G10800
- Orthologous matrix: HGERDSC
- ExpressionAtlas: AT3G10800
- InterPro: IPR004827, IPR046347
- PANTHER: PTHR47416, PTHR47416:SF9
- SUPFAM: SSF57959
- PROSITE: PS50217
- Gene3D: 1.20.5.170
- SWISS-MODEL: A0A178VDM1
- Conserved Domain Database: cd14704
Homologs
- Brassica napus GSBRNA2T00061319001, GSBRNA2T00060242001
- Brassica oleracea XP_013635480.1
- Brassica rapa XP_009114935.1, XP_009122597.1
- Cucumis melo MELO3C009730P1
- Cucumis sativus Cucsa.337510.1
- Gossypium arboreum Cotton_A_20550_BGI-A2_v1.0
- Gossypium hirsutum Gh_D13G0009, Gh_A13G2071
- Ricinus communis 29940.m000398
- Vitis vinifera GSVIVT01025788001
Sequences
cDNA Sequence
- >AT3G10800.1
CACGTGTTCGGAGTTTGATGTACACGCGCTGACTGCGCGTGGATGTAATATAATCTTAATTCTTAAGTATATTCGTCGACGTTGCCTTGTTCCAAAGTTATAAACCGTGTGGAACCATCGAGAAGCGAAGCCAGAATAAATTTTCGAATCCTCCGACGATGACGGAATCAACATCCGTGGTTGCTCCTCCGCCGGAGATACCTAATCTGAACCCTAGCATGTTTTCTGAGTCCGATTTGTTTTCTATTCCGCCGCTAGATCCTCTTTTCCTATCTGATTCTGATCCGATTTCAATGGATGCGCCAATCTCCGATCTCGACTTCTTACTCGACGATGAGAACGGAGATTTCGCTGATTTTGATTTCTCGTTTGATAATTCTGATGATTTCTTCGATTTCGATTTATCGGAGCCCGCGGTGGTGATCCCTGAGGAGATCGGTAACAATCGTTCGAATTTGGACTCATCGGAAAACAGAAGCGGCGATGGAGGTTTAGAAGGAAGATCTGAGTCTGTTCATTCACAGGTTTCATCTCAAGGCTCCAAGACTTTTGTGTCCGACACCGTTGACGCATCATCCTCCCCTGAATCAAGCAATCACCAGAAATCTTCTGTTAGCAAGAGGAAGAAGGAAAATGGAGACTCCAGTGGCGAATTAAGGAGCTGCAAGTACCAAAAGTCCGATGATAAATCAGTCGCTACGAACAACGAAGGTGATGATGACGACGACAAGAGGAAGTTGATAAGGCAGATTAGGAACCGTGAAAGTGCTCAGCTTTCGAGGTTGAGGAAGAAGCAACAAACTGAGGAGCTTGAAAGAAAAGTGAAGAGTATGAATGCTACCATTGCTGAATTGAATGGTAAGATTGCTTATGTTATGGCTGAGAATGTCGCTTTAAGGCAACAAATGGCTGTTGCTTCTGGTGCTCCTCCTATGAATCCTTATATGGCTGCCCCGCCTTTACCGTATCAATGGATGCCGTATCCGCCGTATCCTGTTAGGGGATATGGATCACAGACACCTTTGGTTCCCATTCCTAAGTTAAATCCTAAGCCTGTCTCGAGTTGTAGACCGAAGAAGGCAGAGAGTAAGAAGAATGAGGGTAAAAGTAAGCTCAAGAAGGTTGCTAGTATTAGTTTTATTGGAATTCTCTTCTTTGTCTTCTTGTTTGGTACATTGGTTCCTTTTATGAATGTAAATTTTGGAGGAGAACGTGGAAGCTTTGGCGGTTTGTCTAAATATGATGGCCACCGGTATTACGATGAACATAAGGGGAGGGTTTTAATGGTCGGCGATGGTTCTGATGTTAGAAGAAATAGTGGAATTTCTGAAGGAAATATCCATTCTAGTAGGATTAGTCATGGTGAGAGAGATAGTTGTGGAGGAGTAGATTATAATGCTCATCCGAAAGTAGAAGGACGACCAAGTTCGTTGAGCAATGCCAGTGATCCTCTCTTTGCTTCTCTCTATGTCCCAAGAAACGATGGGCTTGTGAAGATCGATGGGAACTTGATAATTCACTCTGTTTTGGCGAGCGAGAAAGCAAGGGGTTTAGGAAAGAAGAATATCACTGAAACAGTAAAAACTAAAGAACCGGATTTGACCATTCCTGGTGCACTGTCTTCTGCATTAGCTGTTCCGGGGGTAAGAGGAAATGCAGCAATGCTTCCGCATTCAACAGCTCTCTCTTCTGAAGGGAAAAGACTTCACCAATGGTTTCATGAAGGTGGCTCAGGGCCACTAATGGATTACAGCATGTGCACCGAGGTTTTCCAGTTTGATATTGCTCCTGGTGCTATAGTCCCGTCATCAGTCTCCAGCATTTCTGCGGAGCATCTCCAAAATGTCACTACCCACGGCAAGAGAATGAAGAACAGGAGAATCCTTGAGGGACTTCCTGTTTCACTTGTGGCGTCAGAGCTCAATATCACCGGAACCCAGCCAAACAAAGACGCTCAAAATAAGACCTTTAATGGAAACACTAACAAACCCACATCATCATCCTCCATGGTTGTCTCAGTGTTACTTGATCCAAGAGAGGTCGTTGACTCTGAAACCGACAGAGTGGTTCCCCCAAACCCAAAATCACTTTCCCGGATCTTTGTGGTGGTGCTTCTTGACAGTGTCAAGTACGTTACCTACTCATGCGTTCTTCCTCGATCGGGTCTCCATCTCGTAGCCACCTGATTTGAGCTACTCAGATCTTGACCTTAAGTAGGCGAACATTGACTTGTTTATACATACAGACCTTGTTGACTTTTTTTCCCTGTGTTGTATAACTCTTATGTTCTAAGGTTTTGGATTTTAATTTTGAGATAAGCATAAAGTGGAATCCTTGTTTTAAAGGCATTTCCAATAGCTTTAGGCTGTATAATACA
CDS Sequence
- >AT3G10800.1
ATGACGGAATCAACATCCGTGGTTGCTCCTCCGCCGGAGATACCTAATCTGAACCCTAGCATGTTTTCTGAGTCCGATTTGTTTTCTATTCCGCCGCTAGATCCTCTTTTCCTATCTGATTCTGATCCGATTTCAATGGATGCGCCAATCTCCGATCTCGACTTCTTACTCGACGATGAGAACGGAGATTTCGCTGATTTTGATTTCTCGTTTGATAATTCTGATGATTTCTTCGATTTCGATTTATCGGAGCCCGCGGTGGTGATCCCTGAGGAGATCGGTAACAATCGTTCGAATTTGGACTCATCGGAAAACAGAAGCGGCGATGGAGGTTTAGAAGGAAGATCTGAGTCTGTTCATTCACAGGTTTCATCTCAAGGCTCCAAGACTTTTGTGTCCGACACCGTTGACGCATCATCCTCCCCTGAATCAAGCAATCACCAGAAATCTTCTGTTAGCAAGAGGAAGAAGGAAAATGGAGACTCCAGTGGCGAATTAAGGAGCTGCAAGTACCAAAAGTCCGATGATAAATCAGTCGCTACGAACAACGAAGGTGATGATGACGACGACAAGAGGAAGTTGATAAGGCAGATTAGGAACCGTGAAAGTGCTCAGCTTTCGAGGTTGAGGAAGAAGCAACAAACTGAGGAGCTTGAAAGAAAAGTGAAGAGTATGAATGCTACCATTGCTGAATTGAATGGTAAGATTGCTTATGTTATGGCTGAGAATGTCGCTTTAAGGCAACAAATGGCTGTTGCTTCTGGTGCTCCTCCTATGAATCCTTATATGGCTGCCCCGCCTTTACCGTATCAATGGATGCCGTATCCGCCGTATCCTGTTAGGGGATATGGATCACAGACACCTTTGGTTCCCATTCCTAAGTTAAATCCTAAGCCTGTCTCGAGTTGTAGACCGAAGAAGGCAGAGAGTAAGAAGAATGAGGGTAAAAGTAAGCTCAAGAAGGTTGCTAGTATTAGTTTTATTGGAATTCTCTTCTTTGTCTTCTTGTTTGGTACATTGGTTCCTTTTATGAATGTAAATTTTGGAGGAGAACGTGGAAGCTTTGGCGGTTTGTCTAAATATGATGGCCACCGGTATTACGATGAACATAAGGGGAGGGTTTTAATGGTCGGCGATGGTTCTGATGTTAGAAGAAATAGTGGAATTTCTGAAGGAAATATCCATTCTAGTAGGATTAGTCATGGTGAGAGAGATAGTTGTGGAGGAGTAGATTATAATGCTCATCCGAAAGTAGAAGGACGACCAAGTTCGTTGAGCAATGCCAGTGATCCTCTCTTTGCTTCTCTCTATGTCCCAAGAAACGATGGGCTTGTGAAGATCGATGGGAACTTGATAATTCACTCTGTTTTGGCGAGCGAGAAAGCAAGGGGTTTAGGAAAGAAGAATATCACTGAAACAGTAAAAACTAAAGAACCGGATTTGACCATTCCTGGTGCACTGTCTTCTGCATTAGCTGTTCCGGGGGTAAGAGGAAATGCAGCAATGCTTCCGCATTCAACAGCTCTCTCTTCTGAAGGGAAAAGACTTCACCAATGGTTTCATGAAGGTGGCTCAGGGCCACTAATGGATTACAGCATGTGCACCGAGGTTTTCCAGTTTGATATTGCTCCTGGTGCTATAGTCCCGTCATCAGTCTCCAGCATTTCTGCGGAGCATCTCCAAAATGTCACTACCCACGGCAAGAGAATGAAGAACAGGAGAATCCTTGAGGGACTTCCTGTTTCACTTGTGGCGTCAGAGCTCAATATCACCGGAACCCAGCCAAACAAAGACGCTCAAAATAAGACCTTTAATGGAAACACTAACAAACCCACATCATCATCCTCCATGGTTGTCTCAGTGTTACTTGATCCAAGAGAGGTCGTTGACTCTGAAACCGACAGAGTGGTTCCCCCAAACCCAAAATCACTTTCCCGGATCTTTGTGGTGGTGCTTCTTGACAGTGTCAAGTACGTTACCTACTCATGCGTTCTTCCTCGATCGGGTCTCCATCTCGTAGCCACCTGA
Protein Sequence
- >AT3G10800.1
MTESTSVVAPPPEIPNLNPSMFSESDLFSIPPLDPLFLSDSDPISMDAPISDLDFLLDDENGDFADFDFSFDNSDDFFDFDLSEPAVVIPEEIGNNRSNLDSSENRSGDGGLEGRSESVHSQVSSQGSKTFVSDTVDASSSPESSNHQKSSVSKRKKENGDSSGELRSCKYQKSDDKSVATNNEGDDDDDKRKLIRQIRNRESAQLSRLRKKQQTEELERKVKSMNATIAELNGKIAYVMAENVALRQQMAVASGAPPMNPYMAAPPLPYQWMPYPPYPVRGYGSQTPLVPIPKLNPKPVSSCRPKKAESKKNEGKSKLKKVASISFIGILFFVFLFGTLVPFMNVNFGGERGSFGGLSKYDGHRYYDEHKGRVLMVGDGSDVRRNSGISEGNIHSSRISHGERDSCGGVDYNAHPKVEGRPSSLSNASDPLFASLYVPRNDGLVKIDGNLIIHSVLASEKARGLGKKNITETVKTKEPDLTIPGALSSALAVPGVRGNAAMLPHSTALSSEGKRLHQWFHEGGSGPLMDYSMCTEVFQFDIAPGAIVPSSVSSISAEHLQNVTTHGKRMKNRRILEGLPVSLVASELNITGTQPNKDAQNKTFNGNTNKPTSSSSMVVSVLLDPREVVDSETDRVVPPNPKSLSRIFVVVLLDSVKYVTYSCVLPRSGLHLVAT