Information report for AT2G42830
Gene Details
|
|
Functional Descriptions
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- GO:0000978 — enables — RNA polymerase II cis-regulatory region sequence-specific DNA binding
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0048481 — acts upstream of or within — plant ovule development
- GO:0005515 — enables — protein binding
- GO:0048440 — acts upstream of or within — carpel development
- GO:0045944 — involved in — positive regulation of transcription by RNA polymerase II
- GO:0000981 — enables — DNA-binding transcription factor activity, RNA polymerase II-specific
- GO:0005634 — located in — nucleus
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0006357 — involved in — regulation of transcription by RNA polymerase II
- GO:0046983 — enables — protein dimerization activity
- CS3843 — double mutant; produces indehiscent siliques, in which valve margin cells expand at a faster rate after fertilization than valve cells; lignification in valve margin cell is reduced, especially at the fruit base; valve margins are less constricted, resulting in the absence of dehiscence zones in mature siliques.
- CS3844 — double mutant; produces indehiscent siliques, in which valve margin cells expand at a faster rate after fertilization than valve cells; lignification in valve margin cell is reduced, especially at the fruit base; valve margins are less constricted, resulting in the absence of dehiscence zones in mature siliques.
- CS3845 — siliques from shp2-1 single mutant are dehiscent as wt; double shp1-1 shp2-1 mutant produces indehiscent siliques, in which valve margin cells expand at a faster rate after fertilization than valve cells; lignification in valve margin cell is reduced, especially at the fruit base; valve margins are less constricted, resulting in the absence of dehiscence zones in mature siliques
- CS3846 — siliques from shp2-1 single mutant are dehiscent as wt; double shp1-1 shp2-1 mutant produces indehiscent siliques, in which valve margin cells expand at a faster rate after fertilization than valve cells; lignification in valve margin cell is reduced, especially at the fruit base; valve margins are less constricted, resulting in the absence of dehiscence zones in mature siliques
Functional Keywords
Literature and News
- A reverse trend–MADS functions revealed. DOI: 10.1016/s1360-1385(00)01690-3 ; PMID: 10908873
- SHATTERPROOF MADS-box genes control seed dispersal in Arabidopsis. DOI: 10.1038/35008089 ; PMID: 10783890
- Temporal relationship between the transcription of two Arabidopsis MADS box genes and the floral organ identity genes. DOI: 10.1105/tpc.7.6.721 ; PMID: 7647563
- AGL1-AGL6, an Arabidopsis gene family with similarity to floral homeotic and transcription factor genes. DOI: 10.1101/gad.5.3.484 ; PMID: 1672119
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: new openings to the MADS world. DOI: 10.1105/tpc.011544 ; PMID: 12837945
- MADS-box protein complexes control carpel and ovule development in Arabidopsis. DOI: 10.1105/tpc.015123 ; PMID: 14555696
- Molecular population genetics of redundant floral-regulatory genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msh261 ; PMID: 15371526
- Evolution in action: following function in duplicated floral homeotic genes. DOI: 10.1016/j.cub.2005.07.063 ; PMID: 16111944
- Functional analysis of MADS-box genes controlling ovule development in Arabidopsis using the ethanol-inducible alc gene-expression system. DOI: 10.1016/j.mod.2006.01.002 ; PMID: 16515858
- Genetic and molecular interactions between BELL1 and MADS box factors support ovule development in Arabidopsis. DOI: 10.1105/tpc.107.051797 ; PMID: 17693535
- NAC transcription factors NST1 and NST3 regulate pod shattering in a partially redundant manner by promoting secondary wall formation after the establishment of tissue identity. DOI: 10.1111/j.1365-313X.2008.03633.x ; PMID: 18657234
- Creation and analysis of a novel chimeric promoter for the complete containment and seed-mediated gene flow. DOI: 10.1007/s00299-008-0522-0 ; PMID: 18317776
- A new role for the SHATTERPROOF genes during Arabidopsis gynoecium development. DOI: 10.1016/j.ydbio.2009.10.043 ; PMID: 19900437
- Fleshy fruit expansion and ripening are regulated by the Tomato SHATTERPROOF gene TAGL1. DOI: 10.1105/tpc.109.066936 ; PMID: 19880793
- VERDANDI is a direct target of the MADS domain ovule identity complex and affects embryo sac differentiation in Arabidopsis. DOI: 10.1105/tpc.109.068627 ; PMID: 20581305
- Functional compensation of primary and secondary metabolites by duplicate genes in Arabidopsis thaliana. DOI: 10.1093/molbev/msq204 ; PMID: 20736450
- Genetic interaction between AINTEGUMENTA (ANT) and the ovule identity genes SEEDSTICK (STK), SHATTERPROOF1 (SHP1) and SHATTERPROOF2 (SHP2). DOI: 10.1007/s00497-009-0130-3 ; PMID: 20041269
- Overexpression of AtCSP4 affects late stages of embryo development in Arabidopsis. DOI: 10.1093/jxb/erq400 ; PMID: 21282328
- Characterization of constricted fruit (ctf) mutant uncovers a role for AtMYB117/LOF1 in ovule and fruit development in Arabidopsis thaliana. DOI: 10.1371/journal.pone.0018760 ; PMID: 21533201
- Evidence that an evolutionary transition from dehiscent to indehiscent fruits in Lepidium (Brassicaceae) was caused by a change in the control of valve margin identity genes. DOI: 10.1111/tpj.12079 ; PMID: 23173897
- Predicting the impact of alternative splicing on plant MADS domain protein function. DOI: 10.1371/journal.pone.0030524 ; PMID: 22295091
- The NTT transcription factor promotes replum development in Arabidopsis fruits. DOI: 10.1111/tpj.12617 ; PMID: 25039392
- Evolution of fruit development genes in flowering plants. DOI: 10.3389/fpls.2014.00300 ; PMID: 25018763
- Seed abscission and fruit dehiscence required for seed dispersal rely on similar genetic networks. DOI: 10.1242/dev.135202 ; PMID: 27510967
- The MADS Box Genes ABS, SHP1, and SHP2 Are Essential for the Coordination of Cell Divisions in Ovule and Seed Coat Development and for Endosperm Formation in Arabidopsis thaliana. DOI: 10.1371/journal.pone.0165075 ; PMID: 27776173
- Redundant CArG Box Cis-motif Activity Mediates SHATTERPROOF2 Transcriptional Regulation during Arabidopsis thaliana Gynoecium Development. DOI: 10.3389/fpls.2017.01712 ; PMID: 29085379
- Floral homeotic proteins modulate the genetic program for leaf development to suppress trichome formation in flowers. DOI: 10.1242/dev.157784 ; PMID: 29361563
- Insights into the role of transcription factors controlling mucilage production in the Arabidopsis seed coat. DOI: 10.1016/j.plantsci.2018.04.021 ; PMID: 29807590
- INCURVATA11 and CUPULIFORMIS2 Are Redundant Genes That Encode Epigenetic Machinery Components in Arabidopsis. DOI: 10.1105/tpc.18.00300 ; PMID: 29915151
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- Dissection of the Arabidopsis HUA-PEP gene activity reveals that ovule fate specification requires restriction of the floral A-function. DOI: 10.1111/nph.16589 ; PMID: 32259283
- The Relationship between AGAMOUS and Cytokinin Signaling in the Establishment of Carpeloid Features. DOI: 10.3390/plants10050827 ; PMID: 33919177
- AGPs as molecular determinants of reproductive development. DOI: 10.1093/aob/mcad046 ; PMID: 36945741
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
Gene Resources
- UniProt: Q5XXG9
- EMBL: AY727646, AY727647, AY727648
- AlphaFoldDB: Q5XXG9
- EnsemblPlants: AT2G42830.1
- Gramene: AT2G42830.1
- KEGG: ath:AT2G42830
- Orthologous matrix: HDEMVAP
- ExpressionAtlas: AT2G42830
Homologs
- Brassica napus GSBRNA2T00132708001
- Brassica oleracea XP_013632207.1, XP_013632206.1, XP_013632205.1, XP_013632204.1, XP_013632203.1, XP_013632202.1, XP_013632201.1, XP_013632200.1
- Brassica rapa XP_009142872.1, XP_009142871.1, XP_009142870.1, XP_009142869.1, XP_009142867.1, XP_009142866.1
Sequences
cDNA Sequence
- >AT2G42830.1
AAATGTTAGAAGTAATGGTCCATGTTCTTTCTTTCTTTTTCCTTCTATAACACTTCAGTTTGAAAAAAAACTACCAAACCTTCTGTTTTCTGCAAATGGGTTTTTAAATACTTCCAAAGAAATATTCCTCTAAAAGAAATTATAAACCAAAACAGAAACCAAAAACAAAAAATAAAGTTGAAGCAGCAGTTAAGTGGTACTGAGATAATAAGAATAGTATCTTTAGGCCAATGAACAAATTAACTCTCTCATAATTCATCTTCCCATCCTCACTTCTCTTTCTTTCTGATCATAATTAATCTTGCTAAGCCAGCTAGGGCTTATAGAAATGGAGGGTGGTGCGAGTAATGAAGTAGCAGAGAGCAGCAAGAAGATAGGGAGAGGGAAGATAGAGATAAAGAGGATAGAGAACACTACGAATCGTCAAGTCACTTTCTGCAAACGACGCAATGGTTTACTCAAGAAAGCTTATGAGCTCTCTGTCTTGTGTGACGCTGAGGTTGCTCTTGTCATCTTCTCCACTCGAGGCCGTCTCTACGAGTACGCCAACAACAGTGTGAGAGGAACAATAGAAAGGTACAAGAAAGCTTGCTCCGACGCCGTTAACCCTCCGACCATCACCGAAGCTAATACTCAGTACTATCAGCAAGAGGCGTCTAAACTCCGGAGACAGATTCGGGACATTCAGAATTTGAACAGACACATTCTTGGTGAATCTCTTGGTTCCTTGAACTTTAAGGAACTCAAGAACCTTGAAAGTAGGCTTGAGAAAGGAATCAGTCGTGTCCGATCCAAGAAGCACGAGATGTTAGTTGCAGAGATTGAATACATGCAAAAAAGGGAAATCGAGCTGCAAAACGATAACATGTATCTCCGCTCCAAGATTACTGAAAGAACAGGTCTACAGCAACAAGAATCGAGTGTGATACATCAAGGGACAGTTTACGAGTCGGGTGTTACTTCTTCTCACCAGTCGGGGCAGTATAACCGGAATTATATTGCGGTTAACCTTCTTGAACCGAATCAGAATTCCTCCAACCAAGACCAACCACCTCTGCAACTTGTTTGATTCAGTCTAACATAAGCTTCTTTCCTCAGCCTGAGATCGATCTTATGCATATATATATTCATGTTACACTTACTGTCAAAAAACTTAAAATGCAGATGGTAACGATTTGAGAGGGACCTAATAATTTACATATATCTTGATTATGTAAGTTAAGGCTAAGACAAGAGATCCAAAAATAAAATGGGATTTATTGCTAGTTAGTGTTGC - >AT2G42830.2
AAATGTTAGAAGTAATGGTCCATGTTCTTTCTTTCTTTTTCCTTCTATAACACTTCAGTTTGAAAAAAAACTACCAAACCTTCTGTTTTCTGCAAATGGGTTTTTAAATACTTCCAAAGAAATATTCCTCTAAAAGAAATTATAAACCAAAACAGAAACCAAAAACAAAAAATAAAGTTGAAGCAGCAGTTAAGTGGTACTGAGATAATAAGAATAGTATCTTTAGGCCAATGAACAAATTAACTCTCTCATAATTCATCTTCCCATCCTCACTTCTCTTTCTTTCTGATCATAATTAATCTTGCTAAGCCAGCTAGGGCTTATAGAAATGGAGGGTGGTGCGAGTAATGAAGTAGCAGAGAGCAGCAAGAAGATAGGGAGAGGGAAGATAGAGATAAAGAGGATAGAGAACACTACGAATCGTCAAGTCACTTTCTGCAAACGACGCAATGGTTTACTCAAGAAAGCTTATGAGCTCTCTGTCTTGTGTGACGCTGAGGTTGCTCTTGTCATCTTCTCCACTCGAGGCCGTCTCTACGAGTACGCCAACAACAGTGTGAGAGGAACAATAGAAAGGTACAAGAAAGCTTGCTCCGACGCCGTTAACCCTCCGACCATCACCGAAGCTAATACTCAGTACTATCAGCAAGAGGCGTCTAAACTCCGGAGACAGATTCGGGACATTCAGAATTTGAACAGACACATTCTTGGTGAATCTCTTGGTTCCTTGAACTTTAAGGAACTCAAGAACCTTGAAAGTAGGCTTGAGAAAGGAATCAGTCGTGTCCGATCCAAGAAGCACGAGATGTTAGTTGCAGAGATTGAATACATGCAAAAAAGGGAAATCGAGCTGCAAAACGATAACATGTATCTCCGCTCCAAGATTACTGAAAGAACAGGTCTACAGCAACAAGAATCGAGTGTGATACATCAAGGGACAGTTTACGAGTCGGGTGTTACTTCTTCTCACCAGTCGGGGCAGTATAACCGGAATTATATTGCGGTTAACCTTCTTGAACCGAATCAGAATTCCTCCAACCAAGACCAACCACCTCTGCAACTTGTTTGATTCAGTCTAACATAAGCTTCTTTCCTCAGCCTGAGATCGATCTTATGCATATATATATTCATGTTACACTTACTGTCAAAAAACTTAAAATGCAGATGGTAACGATTTGAGAGGGACCTAATAATTTACATATATCTTGATTATGTAAGTTAAGGCTAAGACAAGAGATCCAAAAATAAAATGGGATTTATTGCTAGTTAGTGTTGC
CDS Sequence
- >AT2G42830.1
ATGGAGGGTGGTGCGAGTAATGAAGTAGCAGAGAGCAGCAAGAAGATAGGGAGAGGGAAGATAGAGATAAAGAGGATAGAGAACACTACGAATCGTCAAGTCACTTTCTGCAAACGACGCAATGGTTTACTCAAGAAAGCTTATGAGCTCTCTGTCTTGTGTGACGCTGAGGTTGCTCTTGTCATCTTCTCCACTCGAGGCCGTCTCTACGAGTACGCCAACAACAGTGTGAGAGGAACAATAGAAAGGTACAAGAAAGCTTGCTCCGACGCCGTTAACCCTCCGACCATCACCGAAGCTAATACTCAGTACTATCAGCAAGAGGCGTCTAAACTCCGGAGACAGATTCGGGACATTCAGAATTTGAACAGACACATTCTTGGTGAATCTCTTGGTTCCTTGAACTTTAAGGAACTCAAGAACCTTGAAAGTAGGCTTGAGAAAGGAATCAGTCGTGTCCGATCCAAGAAGCACGAGATGTTAGTTGCAGAGATTGAATACATGCAAAAAAGGGAAATCGAGCTGCAAAACGATAACATGTATCTCCGCTCCAAGATTACTGAAAGAACAGGTCTACAGCAACAAGAATCGAGTGTGATACATCAAGGGACAGTTTACGAGTCGGGTGTTACTTCTTCTCACCAGTCGGGGCAGTATAACCGGAATTATATTGCGGTTAACCTTCTTGAACCGAATCAGAATTCCTCCAACCAAGACCAACCACCTCTGCAACTTGTTTGA - >AT2G42830.2
ATGGAGGGTGGTGCGAGTAATGAAGTAGCAGAGAGCAGCAAGAAGATAGGGAGAGGGAAGATAGAGATAAAGAGGATAGAGAACACTACGAATCGTCAAGTCACTTTCTGCAAACGACGCAATGGTTTACTCAAGAAAGCTTATGAGCTCTCTGTCTTGTGTGACGCTGAGGTTGCTCTTGTCATCTTCTCCACTCGAGGCCGTCTCTACGAGTACGCCAACAACAGTGTGAGAGGAACAATAGAAAGGTACAAGAAAGCTTGCTCCGACGCCGTTAACCCTCCGACCATCACCGAAGCTAATACTCAGTACTATCAGCAAGAGGCGTCTAAACTCCGGAGACAGATTCGGGACATTCAGAATTTGAACAGACACATTCTTGGTGAATCTCTTGGTTCCTTGAACTTTAAGGAACTCAAGAACCTTGAAAGTAGGCTTGAGAAAGGAATCAGTCGTGTCCGATCCAAGAAGCACGAGATGTTAGTTGCAGAGATTGAATACATGCAAAAAAGGGAAATCGAGCTGCAAAACGATAACATGTATCTCCGCTCCAAGATTACTGAAAGAACAGGTCTACAGCAACAAGAATCGAGTGTGATACATCAAGGGACAGTTTACGAGTCGGGTGTTACTTCTTCTCACCAGTCGGGGCAGTATAACCGGAATTATATTGCGGTTAACCTTCTTGAACCGAATCAGAATTCCTCCAACCAAGACCAACCACCTCTGCAACTTGTTTGA
Protein Sequence
- >AT2G42830.1
MEGGASNEVAESSKKIGRGKIEIKRIENTTNRQVTFCKRRNGLLKKAYELSVLCDAEVALVIFSTRGRLYEYANNSVRGTIERYKKACSDAVNPPTITEANTQYYQQEASKLRRQIRDIQNLNRHILGESLGSLNFKELKNLESRLEKGISRVRSKKHEMLVAEIEYMQKREIELQNDNMYLRSKITERTGLQQQESSVIHQGTVYESGVTSSHQSGQYNRNYIAVNLLEPNQNSSNQDQPPLQLV - >AT2G42830.2
MEGGASNEVAESSKKIGRGKIEIKRIENTTNRQVTFCKRRNGLLKKAYELSVLCDAEVALVIFSTRGRLYEYANNSVRGTIERYKKACSDAVNPPTITEANTQYYQQEASKLRRQIRDIQNLNRHILGESLGSLNFKELKNLESRLEKGISRVRSKKHEMLVAEIEYMQKREIELQNDNMYLRSKITERTGLQQQESSVIHQGTVYESGVTSSHQSGQYNRNYIAVNLLEPNQNSSNQDQPPLQLV