Information report for AT2G42200
Gene Details
|
|
Functional Descriptions
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000017 — vascular leaf primordium — leaf primordium (exact), portion of vascular leaf primordium tissue (exact), primordio de hoja (Spanish, exact), vascular leaf primordia (exact, plural), 葉原基 (Japanese, exact)
- PO:0009015 — portion of vascular tissue — porción de tejido vascular (Spanish, exact), vascular tissue (exact), 維管束細胞の一部 (Japanese, exact), vascular system (related)
- PO:0009105 — inflorescence axillary meristem — meristema lateral de la inflorescencia (Spanish, exact), 花序側部（側方）分裂組織 (Japanese, related)
- GO:0005634 — located in — nucleus
- GO:0000981 — enables — DNA-binding transcription factor activity, RNA polymerase II-specific
- GO:0048653 — acts upstream of or within — anther development
- GO:0048366 — acts upstream of or within — leaf development
- GO:0010228 — acts upstream of or within — vegetative to reproductive phase transition of meristem
- GO:0009409 — involved in — response to cold
- GO:0006355 — acts upstream of or within — regulation of DNA-templated transcription
- GO:2000025 — acts upstream of or within — regulation of leaf formation
- GO:0003700 — enables — DNA-binding transcription factor activity
- CS67865 — Delayed vegetative phase change, increased rate of leaf initiation, increased anthocyanin production, thin inforescence stem.
- CS67866 — Delayed vegetative phase change, increased rate of leaf initiation, increased anthocyanin production
- CS69792 — Delayed vegetative phase change. Increased rate of leaf initiation. Slightly delayed flowering time.
- CS69794 — Delayed vegetative phase change. Increased rate of leaf initiation. Delayed flowering time.
- CS69795 — Delayed vegetative phase change. Increased rate of leaf initiation.
- CS69796 — Delayed vegetative phase change. Increased rate of leaf initiation. Delayed flowering time.
- CS69797 — Delayed vegetative phase change. Increased rate of leaf initiation. Delayed flowering time.
- CS69798 — Delayed vegetative phase change. Increased rate of leaf initiation. Delayed flowering time.
- CS69799 — Delayed vegetative phase change. Increased rate of leaf initiation. More severe vegetative phenotype than 35S::MIR156A (CS67849). Delayed flowering time, equal to 35S::MIR156A.
- spl9-1/spl15-1 — Increased rate of leaf initiation. Reduced apical dominance. Slightly later flowering than normal sibs.
- spl9-2/spl15-2 — Increased rate of leaf initiation. Reduced apical dominance. Slightly later flowering than normal sibs.
Functional Keywords
Literature and News
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- A novel zinc-binding motif revealed by solution structures of DNA-binding domains of Arabidopsis SBP-family transcription factors. DOI: 10.1016/j.jmb.2004.01.015 ; PMID: 15001351
- Genome-wide ORFeome cloning and analysis of Arabidopsis transcription factor genes. DOI: 10.1104/pp.104.042176 ; PMID: 15208423
- Genome-wide reprogramming of primary and secondary metabolism, protein synthesis, cellular growth processes, and the regulatory infrastructure of Arabidopsis in response to nitrogen. DOI: 10.1104/pp.104.047019 ; PMID: 15375205
- A systemic small RNA signaling system in plants. DOI: 10.1105/tpc.104.023614 ; PMID: 15258266
- The microRNA regulated SBP-box genes SPL9 and SPL15 control shoot maturation in Arabidopsis. DOI: 10.1007/s11103-008-9310-z ; PMID: 18278578
- Dual effects of miR156-targeted SPL genes and CYP78A5/KLUH on plastochron length and organ size in Arabidopsis thaliana. DOI: 10.1105/tpc.108.058180 ; PMID: 18492871
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- The sequential action of miR156 and miR172 regulates developmental timing in Arabidopsis. DOI: 10.1016/j.cell.2009.06.031 ; PMID: 19703400
- Temporal control of trichome distribution by microRNA156-targeted SPL genes in Arabidopsis thaliana. DOI: 10.1105/tpc.109.072579 ; PMID: 20622149
- SQUAMOSA promoter-binding protein-like transcription factors: star players for plant growth and development. DOI: 10.1111/j.1744-7909.2010.00987.x ; PMID: 20977652
- miR156-targeted and nontargeted SBP-box transcription factors act in concert to secure male fertility in Arabidopsis. DOI: 10.1105/tpc.110.079343 ; PMID: 21177480
- Negative regulation of anthocyanin biosynthesis in Arabidopsis by a miR156-targeted SPL transcription factor. DOI: 10.1105/tpc.111.084525 ; PMID: 21487097
- HYL1 controls the miR156-mediated juvenile phase of vegetative growth. DOI: 10.1093/jxb/err465 ; PMID: 22268150
- Gibberellin regulates the Arabidopsis floral transition through miR156-targeted SQUAMOSA promoter binding-like transcription factors. DOI: 10.1105/tpc.112.101014 ; PMID: 22942378
- Arabidopsis miR156 Regulates Tolerance to Recurring Environmental Stress through SPL Transcription Factors. DOI: 10.1105/tpc.114.123851 ; PMID: 24769482
- Interaction between two timing microRNAs controls trichome distribution in Arabidopsis. DOI: 10.1371/journal.pgen.1004266 ; PMID: 24699192
- Progressive Regulation of Sesquiterpene Biosynthesis in Arabidopsis and Patchouli (Pogostemon cablin) by the miR156-Targeted SPL Transcription Factors. DOI: 10.1093/mp/ssu127 ; PMID: 25355059
- The miR156-SPL9-DFR pathway coordinates the relationship between development and abiotic stress tolerance in plants. DOI: 10.1111/tpj.12712 ; PMID: 25345491
- The role of miR156/SPLs modules in Arabidopsis lateral root development. DOI: 10.1111/tpj.12919 ; PMID: 26096676
- Functional and evolutionary analyses of the miR156 and miR529 families in land plants. DOI: 10.1186/s12870-016-0716-5 ; PMID: 26841873
- Multi-layered Regulation of SPL15 and Cooperation with SOC1 Integrate Endogenous Flowering Pathways at the Arabidopsis Shoot Meristem. DOI: 10.1016/j.devcel.2016.04.001 ; PMID: 27134142
- Developmental Functions of miR156-Regulated SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL) Genes in Arabidopsis thaliana. DOI: 10.1371/journal.pgen.1006263 ; PMID: 27541584
- The Arabidopsis Transcription Factor ANAC032 Represses Anthocyanin Biosynthesis in Response to High Sucrose and Oxidative and Abiotic Stresses. DOI: 10.3389/fpls.2016.01548 ; PMID: 27790239
- Jasmonate response decay and defense metabolite accumulation contributes to age-regulated dynamics of plant insect resistance. DOI: 10.1038/ncomms13925 ; PMID: 28067238
- ALKBH10B Is an RNA N(6)-Methyladenosine Demethylase Affecting Arabidopsis Floral Transition. DOI: 10.1105/tpc.16.00912 ; PMID: 29180595
- UV-B radiation delays flowering time through changes in the PRC2 complex activity and miR156 levels in Arabidopsis thaliana. DOI: 10.1111/pce.13166 ; PMID: 29447428
- Threshold-dependent repression of SPL gene expression by miR156/miR157 controls vegetative phase change in Arabidopsis thaliana. DOI: 10.1371/journal.pgen.1007337 ; PMID: 29672610
- Alterations of plant architecture and phase transition by the phytoplasma virulence factor SAP11. DOI: 10.1093/jxb/ery318 ; PMID: 30165491
- miR156/SPL9 Regulates Reactive Oxygen Species Accumulation and Immune Response in Arabidopsis thaliana. DOI: 10.1094/PHYTO-08-18-0306-R ; PMID: 30526361
- The nuclear localization signal is required for the function of squamosa promoter binding protein-like gene 9 to promote vegetative phase change in Arabidopsis. DOI: 10.1007/s11103-019-00863-5 ; PMID: 30953277
- Floral regulators FLC and SOC1 directly regulate expression of the B3-type transcription factor TARGET OF FLC AND SVP 1 at the Arabidopsis shoot apex via antagonistic chromatin modifications. DOI: 10.1371/journal.pgen.1008065 ; PMID: 30946745
- Gibberellin repression of axillary bud formation in Arabidopsis by modulation of DELLA-SPL9 complex activity. DOI: 10.1111/jipb.12818 ; PMID: 31001922
- Diurnal Regulation of Plant Epidermal Wax Synthesis through Antagonistic Roles of the Transcription Factors SPL9 and DEWAX. DOI: 10.1105/tpc.19.00233 ; PMID: 31484683
- ALTERED MERISTEM PROGRAM1 regulates leaf identity independently of miR156-mediated translational repression. DOI: 10.1242/dev.186874 ; PMID: 32198155
- Arabidopsis FHY3 and FAR1 integrate light and strigolactone signaling to regulate branching. DOI: 10.1038/s41467-020-15893-7 ; PMID: 32327664
- Arabidopsis NUCLEAR FACTOR Y A8 inhibits the juvenile-to-adult transition by activating transcription of MIR156s. DOI: 10.1093/jxb/eraa197 ; PMID: 32445333
- Differential submergence tolerance between juvenile and adult Arabidopsis plants involves the ANAC017 transcription factor. DOI: 10.1111/tpj.14975 ; PMID: 32860440
- and sucrose-signaling modules regulate the Arabidopsis juvenile-to-adult phase transition. DOI: 10.1016/j.celrep.2021.109348 ; PMID: 34260932
- MIR156-Targeted SPL9 Is Phosphorylated by SnRK2s and Interacts With ABI5 to Enhance ABA Responses in Arabidopsis. DOI: 10.3389/fpls.2021.708573 ; PMID: 34367226
- Low light intensity delays vegetative phase change. DOI: 10.1093/plphys/kiab243 ; PMID: 34618024
- BZR1 Physically Interacts with SPL9 to Regulate the Vegetative Phase Change and Cell Elongation in Arabidopsis. DOI: 10.3390/ijms221910415 ; PMID: 34638756
- PIL transcription factors directly interact with SPLs and repress tillering/branching in plants. DOI: 10.1111/nph.17872 ; PMID: 34800046
- SPL9 mediates freezing tolerance by directly regulating the expression of CBF2 in Arabidopsis thaliana. DOI: 10.1186/s12870-022-03445-8 ; PMID: 35109794
- miR172 Regulates WUS during Somatic Embryogenesis in Arabidopsis via AP2. DOI: 10.3390/cells11040718 ; PMID: 35203367
- SQUINT Positively Regulates Resistance to the Pathogen Botrytis cinerea via miR156-SPL9 Module in Arabidopsis. DOI: 10.1093/pcp/pcac042 ; PMID: 35445272
- TRY intron2 determined its expression in inflorescence activated by SPL9 and MADS-box genes in Arabidopsis. DOI: 10.1016/j.plantsci.2022.111311 ; PMID: 35696911
- Two Arabidopsis MYB-SHAQKYF transcription repressors regulate leaf wax biosynthesis via transcriptional suppression on DEWAX. DOI: 10.1111/nph.18498 ; PMID: 36110041
- SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 9 and 13 repress BLADE-ON-PETIOLE 1 and 2 directly to promote adult leaf morphology in Arabidopsis. DOI: 10.1093/jxb/erad017 ; PMID: 36629519
- MicroRNA156 conditions auxin sensitivity to enable growth plasticity in response to environmental changes in Arabidopsis. DOI: 10.1038/s41467-023-36774-9 ; PMID: 36949101
- Coordinated regulation of vegetative phase change by brassinosteroids and the age pathway in Arabidopsis. DOI: 10.1038/s41467-023-38207-z ; PMID: 37147280
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
Gene Resources
- UniProt: A0A178VM51
- EMBL: LUHQ01000002
- AlphaFoldDB: A0A178VM51
- ExpressionAtlas: AT2G42200
- InterPro: IPR004333, IPR036893, IPR044817
- PANTHER: PTHR31251, PTHR31251:SF140
- SUPFAM: SSF103612
- PROSITE: PS51141
- Gene3D: 4.10.1100.10
Homologs
- Brassica napus BnaC04G0586600ZS, BnaA05G0029400ZS, BnaC04G0031900ZS, BnaA04G0269100ZS, BnaC06G0209700ZS, BnaA07G0201200ZS
- Brassica oleracea Bo4g191350, Bo4g015800, Bo6g073290
- Brassica rapa Bra016891, Bra004674, Bra003305
- Vitis vinifera VIT_08s0007g06270
Sequences
cDNA Sequence
- >AT2G42200.1
AATAATTGCAAGGAAAAACTCTATAAAAAGATAGAAATGTGAACAGTATAAAGTAAATAAAGAAATATGTGTACATGAAAGACCTCTCCAATGTTCACTTGCTCCAGTTTCTCCAAGATTAGAAACTGCTACGTCTCTCTCTATAGCTCCCTCGTTTTGCTATGTGGTAATTAACAACAGACAACAGTTTTTGTTTGTCCGTACCGTTTTACTTACTCTCTCACTGTCTTTGTCTATTACCACTCTCGTCTCTTTCTTTTTTCCTTCTGTTCTGTTTCTCTCTCTAAACCCAAAACAGTCAAAATCAGGGAAGCCGAAATTTTCTTTGCTTTCTTCTCCTTTGGTCCTTTCTTTAAACCCGAGACAGTTAGGTTTGTGTGAGAGAGAGAATGATGAGTAAAACCCTTTCTGTCTGAGTAAGAGGAAACCAACATGGAGATGGGTTCCAACTCGGGTCCGGGTCATGGTCCGGGTCAGGCAGAGTCGGGTGGTTCCTCCACTGAGTCATCCTCTTTCAGTGGAGGGCTCATGTTTGGCCAGAAGATCTACTTCGAGGACGGTGGTGGTGGATCCGGGTCTTCTTCCTCAGGTGGTCGTTCAAACAGACGTGTCCGTGGAGGCGGGTCGGGTCAGTCGGGTCAGATACCAAGGTGCCAAGTGGAAGGTTGTGGGATGGATCTAACCAATGCAAAAGGTTATTACTCGAGACACCGAGTTTGTGGAGTGCACTCTAAAACACCTAAAGTCACTGTGGCTGGTATCGAACAGAGGTTTTGTCAACAGTGCAGCAGGTTTCATCAGCTTCCGGAATTTGACCTAGAGAAAAGGAGTTGCCGCAGGAGACTCGCTGGTCATAATGAGCGACGAAGGAAGCCACAGCCTGCGTCTCTCTCTGTGTTAGCTTCTCGTTACGGGAGGATCGCACCTTCGCTTTACGAAAATGGTGATGCTGGAATGAATGGAAGCTTTCTTGGGAACCAAGAGATAGGATGGCCAAGTTCAAGAACATTGGATACAAGAGTGATGAGGCGGCCAGTGTCGTCACCGTCATGGCAGATCAATCCAATGAATGTATTTAGTCAAGGTTCAGTTGGTGGAGGAGGGACAAGCTTCTCATCTCCAGAGATTATGGACACTAAACTAGAGAGCTACAAGGGAATTGGCGACTCAAACTGTGCTCTCTCTCTTCTGTCAAATCCACATCAACCACATGACAACAACAACAACAACAACAACAACAACAACAACAACAACAATACATGGCGAGCTTCTTCAGGTTTTGGCCCGATGACGGTTACAATGGCTCAACCACCACCTGCACCTAGCCAGCATCAGTATCTGAACCCGCCTTGGGTATTCAAGGACAATGATAATGATATGTCTCCTGTTTTGAATTTAGGTCGATACACCGAGCCAGATAATTGTCAGATAAGTAGTGGCACGGCAATGGGTGAGTTCGAGTTATCTGATCACCATCATCAAAGTAGGAGACAGTACATGGAAGATGAGAACACAAGGGCTTATGACTCTTCTTCTCACCATACCAACTGGTCTCTCTGACTTGTCTTTGCATCAGAGAATCTTCTTACAATGAACGATTCTGCAATATCTTATCTTTTTGCTTCTTTGTTTATTCTGTTATCTGCTATCAATAAACCAGACAATTGTTGCCAGATAATGGCTTTTGATTTTGATTTGTTGTTTTATCTCCATGAAAATCCAAGTTATGAGATCAGATTGATTTCTTTAGCACATCAAGGTTCCATATAATGAATCTATA
CDS Sequence
- >AT2G42200.1
ATGGAGATGGGTTCCAACTCGGGTCCGGGTCATGGTCCGGGTCAGGCAGAGTCGGGTGGTTCCTCCACTGAGTCATCCTCTTTCAGTGGAGGGCTCATGTTTGGCCAGAAGATCTACTTCGAGGACGGTGGTGGTGGATCCGGGTCTTCTTCCTCAGGTGGTCGTTCAAACAGACGTGTCCGTGGAGGCGGGTCGGGTCAGTCGGGTCAGATACCAAGGTGCCAAGTGGAAGGTTGTGGGATGGATCTAACCAATGCAAAAGGTTATTACTCGAGACACCGAGTTTGTGGAGTGCACTCTAAAACACCTAAAGTCACTGTGGCTGGTATCGAACAGAGGTTTTGTCAACAGTGCAGCAGGTTTCATCAGCTTCCGGAATTTGACCTAGAGAAAAGGAGTTGCCGCAGGAGACTCGCTGGTCATAATGAGCGACGAAGGAAGCCACAGCCTGCGTCTCTCTCTGTGTTAGCTTCTCGTTACGGGAGGATCGCACCTTCGCTTTACGAAAATGGTGATGCTGGAATGAATGGAAGCTTTCTTGGGAACCAAGAGATAGGATGGCCAAGTTCAAGAACATTGGATACAAGAGTGATGAGGCGGCCAGTGTCGTCACCGTCATGGCAGATCAATCCAATGAATGTATTTAGTCAAGGTTCAGTTGGTGGAGGAGGGACAAGCTTCTCATCTCCAGAGATTATGGACACTAAACTAGAGAGCTACAAGGGAATTGGCGACTCAAACTGTGCTCTCTCTCTTCTGTCAAATCCACATCAACCACATGACAACAACAACAACAACAACAACAACAACAACAACAACAACAATACATGGCGAGCTTCTTCAGGTTTTGGCCCGATGACGGTTACAATGGCTCAACCACCACCTGCACCTAGCCAGCATCAGTATCTGAACCCGCCTTGGGTATTCAAGGACAATGATAATGATATGTCTCCTGTTTTGAATTTAGGTCGATACACCGAGCCAGATAATTGTCAGATAAGTAGTGGCACGGCAATGGGTGAGTTCGAGTTATCTGATCACCATCATCAAAGTAGGAGACAGTACATGGAAGATGAGAACACAAGGGCTTATGACTCTTCTTCTCACCATACCAACTGGTCTCTCTGA
Protein Sequence
- >AT2G42200.1
MEMGSNSGPGHGPGQAESGGSSTESSSFSGGLMFGQKIYFEDGGGGSGSSSSGGRSNRRVRGGGSGQSGQIPRCQVEGCGMDLTNAKGYYSRHRVCGVHSKTPKVTVAGIEQRFCQQCSRFHQLPEFDLEKRSCRRRLAGHNERRRKPQPASLSVLASRYGRIAPSLYENGDAGMNGSFLGNQEIGWPSSRTLDTRVMRRPVSSPSWQINPMNVFSQGSVGGGGTSFSSPEIMDTKLESYKGIGDSNCALSLLSNPHQPHDNNNNNNNNNNNNNNTWRASSGFGPMTVTMAQPPPAPSQHQYLNPPWVFKDNDNDMSPVLNLGRYTEPDNCQISSGTAMGEFELSDHHHQSRRQYMEDENTRAYDSSSHHTNWSL