Information report for AT2G41680
Gene Details
|
|
Functional Descriptions
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- GO:0009507 — located in — chloroplast
- GO:0045454 — involved in — cell redox homeostasis
- GO:0009570 — located in — chloroplast stroma
- GO:0010380 — involved in — regulation of chlorophyll biosynthetic process
- GO:0043085 — involved in — positive regulation of catalytic activity
- GO:0042744 — acts upstream of or within — hydrogen peroxide catabolic process
- GO:0005829 — located in — cytosol
- GO:0010581 — involved in — regulation of starch biosynthetic process
- GO:0004791 — enables — thioredoxin-disulfide reductase (NADP) activity
- GO:0005515 — enables — protein binding
- GO:0019430 — involved in — removal of superoxide radicals
- GO:0016671 — enables — oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor
- GO:0008047 — enables — enzyme activator activity
Functional Keywords
Literature and News
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Transcriptional profile of the Arabidopsis root quiescent center. DOI: 10.1105/tpc.105.031724 ; PMID: 15937229
- Rice NTRC is a high-efficiency redox system for chloroplast protection against oxidative damage. DOI: 10.1105/tpc.106.041541 ; PMID: 16891402
- Evolution of redoxin genes in the green lineage. DOI: 10.1007/s11120-006-9095-3 ; PMID: 17031546
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- NTRC links built-in thioredoxin to light and sucrose in regulating starch synthesis in chloroplasts and amyloplasts. DOI: 10.1073/pnas.0903559106 ; PMID: 19470473
- The quaternary structure of NADPH thioredoxin reductase C is redox-sensitive. DOI: 10.1093/mp/ssp011 ; PMID: 19825629
- NADPH Thioredoxin reductase C controls the redox status of chloroplast 2-Cys peroxiredoxins in Arabidopsis thaliana. DOI: 10.1093/mp/ssn082 ; PMID: 19825615
- Functional analysis of the pathways for 2-Cys peroxiredoxin reduction in Arabidopsis thaliana chloroplasts. DOI: 10.1093/jxb/erq218 ; PMID: 20616155
- Thioredoxin-regulated beta-amylase (BAM1) triggers diurnal starch degradation in guard cells, and in mesophyll cells under osmotic stress. DOI: 10.1093/jxb/erq288 ; PMID: 20876336
- Identification of nuclear genes encoding chloroplast-localized proteins required for embryo development in Arabidopsis. DOI: 10.1104/pp.110.168120 ; PMID: 21139083
- A comparative analysis of the NADPH thioredoxin reductase C-2-Cys peroxiredoxin system from plants and cyanobacteria. DOI: 10.1104/pp.110.171082 ; PMID: 21335525
- Microbial volatile-induced accumulation of exceptionally high levels of starch in Arabidopsis leaves is a process involving NTRC and starch synthase classes III and IV. DOI: 10.1094/MPMI-05-11-0112 ; PMID: 21649509
- NTRC and chloroplast-generated reactive oxygen species regulate Pseudomonas syringae pv. tomato disease development in tomato and Arabidopsis. DOI: 10.1094/MPMI-05-11-0130 ; PMID: 22112219
- Multiple strategies to prevent oxidative stress in Arabidopsis plants lacking the malate valve enzyme NADP-malate dehydrogenase. DOI: 10.1093/jxb/err386 ; PMID: 22140244
- Post-translational redox modification of ADP-glucose pyrophosphorylase in response to light is not a major determinant of fine regulation of transitory starch accumulation in Arabidopsis leaves. DOI: 10.1093/pcp/pcr193 ; PMID: 22210900
- NADPH thioredoxin reductase C is localized in plastids of photosynthetic and nonphotosynthetic tissues and is involved in lateral root formation in Arabidopsis. DOI: 10.1105/tpc.111.092304 ; PMID: 22505729
- Chloroplast redox homeostasis is essential for lateral root formation in Arabidopsis. DOI: 10.4161/psb.21001 ; PMID: 22899086
- New insights into the reduction systems of plastidial thioredoxins point out the unique properties of thioredoxin z from Arabidopsis. DOI: 10.1093/jxb/ers283 ; PMID: 23096001
- Comparative molecular modeling study of Arabidopsis NADPH-dependent thioredoxin reductase and its hybrid protein. DOI: 10.1371/journal.pone.0046279 ; PMID: 23029461
- Thioredoxin reductase type C (NTRC) orchestrates enhanced thermotolerance to Arabidopsis by its redox-dependent holdase chaperone function. DOI: 10.1093/mp/sss105 ; PMID: 23024205
- Posttranslational influence of NADPH-dependent thioredoxin reductase C on enzymes in tetrapyrrole synthesis. DOI: 10.1104/pp.113.217141 ; PMID: 23569108
- Electron transfer pathways and dynamics of chloroplast NADPH-dependent thioredoxin reductase C (NTRC). DOI: 10.1074/jbc.M112.388991 ; PMID: 22833674
- Deletion of chloroplast NADPH-dependent thioredoxin reductase results in inability to regulate starch synthesis and causes stunted growth under short-day photoperiods. DOI: 10.1093/jxb/ert216 ; PMID: 23881397
- Overexpression of chloroplast NADPH-dependent thioredoxin reductase in Arabidopsis enhances leaf growth and elucidates in vivo function of reductase and thioredoxin domains. DOI: 10.3389/fpls.2013.00389 ; PMID: 24115951
- The contribution of NADPH thioredoxin reductase C (NTRC) and sulfiredoxin to 2-Cys peroxiredoxin overoxidation in Arabidopsis thaliana chloroplasts. DOI: 10.1093/jxb/eru512 ; PMID: 25560178
- Overexpression of Arabidopsis NADPH-dependent thioredoxin reductase C (AtNTRC) confers freezing and cold shock tolerance to plants. DOI: 10.1016/j.bbrc.2015.06.089 ; PMID: 26086110
- The Role of Cysteine Residues in Redox Regulation and Protein Stability of Arabidopsis thaliana Starch Synthase 1. DOI: 10.1371/journal.pone.0136997 ; PMID: 26367870
- Thioredoxin f1 and NADPH-Dependent Thioredoxin Reductase C Have Overlapping Functions in Regulating Photosynthetic Metabolism and Plant Growth in Response to Varying Light Conditions. DOI: 10.1104/pp.15.01122 ; PMID: 26338951
- The chloroplast NADPH thioredoxin reductase C, NTRC, controls non-photochemical quenching of light energy and photosynthetic electron transport in Arabidopsis. DOI: 10.1111/pce.12652 ; PMID: 26476233
- Crosstalk between chloroplast thioredoxin systems in regulation of photosynthesis. DOI: 10.1111/pce.12718 ; PMID: 26831830
- NADPH-dependent thioredoxin reductase C plays a role in nonhost disease resistance against Pseudomonas syringae pathogens by regulating chloroplast-generated reactive oxygen species. DOI: 10.7717/peerj.1938 ; PMID: 27168965
- Multi-level regulation of the chloroplast ATP synthase: the chloroplast NADPH thioredoxin reductase C (NTRC) is required for redox modulation specifically under low irradiance. DOI: 10.1111/tpj.13226 ; PMID: 27233821
- The Thiol Reductase Activity of YUCCA6 Mediates Delayed Leaf Senescence by Regulating Genes Involved in Auxin Redistribution. DOI: 10.3389/fpls.2016.00626 ; PMID: 27242830
- Two distinct redox cascades cooperatively regulate chloroplast functions and sustain plant viability. DOI: 10.1073/pnas.1604101113 ; PMID: 27335455
- Molecular recognition in the interaction of chloroplast 2-Cys peroxiredoxin with NADPH-thioredoxin reductase C (NTRC) and thioredoxin x. DOI: 10.1016/j.febslet.2014.09.044 ; PMID: 25448674
- Thioredoxins Play a Crucial Role in Dynamic Acclimation of Photosynthesis in Fluctuating Light. DOI: 10.1016/j.molp.2016.11.012 ; PMID: 27940305
- An event of alternative splicing affects the expression of the NTRC gene, encoding NADPH-thioredoxin reductase C, in seed plants. DOI: 10.1016/j.plantsci.2017.02.001 ; PMID: 28330560
- NADPH Thioredoxin Reductase C and Thioredoxins Act Concertedly in Seedling Development. DOI: 10.1104/pp.17.00481 ; PMID: 28500266
- Photosynthetic activity of cotyledons is critical during post-germinative growth and seedling establishment. DOI: 10.1080/15592324.2017.1347244 ; PMID: 28692378
- Thioredoxin and NADPH-Dependent Thioredoxin Reductase C Regulation of Tetrapyrrole Biosynthesis. DOI: 10.1104/pp.16.01500 ; PMID: 28827456
- NTRC-dependent redox balance of 2-Cys peroxiredoxins is needed for optimal function of the photosynthetic apparatus. DOI: 10.1073/pnas.1706003114 ; PMID: 29078290
- The NADPH-Dependent Thioredoxin Reductase C-2-Cys Peroxiredoxin Redox System Modulates the Activity of Thioredoxin x in Arabidopsis Chloroplasts. DOI: 10.1093/pcp/pcy134 ; PMID: 30011001
- 2-Cys Peroxiredoxins Participate in the Oxidation of Chloroplast Enzymes in the Dark. DOI: 10.1016/j.molp.2018.09.005 ; PMID: 30292682
- Towards Initial Indications for a Thiol-Based Redox Control of Arabidopsis 5-Aminolevulinic Acid Dehydratase. DOI: 10.3390/antiox7110152 ; PMID: 30384439
- Insights into the function of NADPH thioredoxin reductase C (NTRC) based on identification of NTRC-interacting proteins in vivo. DOI: 10.1093/jxb/erz326 ; PMID: 31294455
- Dissecting the interaction of photosynthetic electron transfer with mitochondrial signalling and hypoxic response in the Arabidopsis rcd1 mutant. DOI: 10.1098/rstb.2019.0413 ; PMID: 32362253
- Regulation of cyclic electron flow by chloroplast NADPH-dependent thioredoxin system. DOI: 10.1002/pld3.93 ; PMID: 31245694
- Thiol Redox Regulation of Plant β-Carbonic Anhydrase. DOI: 10.3390/biom10081125 ; PMID: 32751472
- Two chloroplast thioredoxin systems differentially modulate photosynthesis in Arabidopsis depending on light intensity and leaf age. DOI: 10.1111/tpj.14959 ; PMID: 32772439
- Exploring the Functional Relationship between y-Type Thioredoxins and 2-Cys Peroxiredoxins in Arabidopsis Chloroplasts. DOI: 10.3390/antiox9111072 ; PMID: 33142810
- Arabidopsis thimet oligopeptidases are redox-sensitive enzymes active in the local and systemic plant immune response. DOI: 10.1016/j.jbc.2021.100695 ; PMID: 33894200
- Regulation of plasmodesmata in Arabidopsis leaves: ATP, NADPH and chlorophyll b levels matter. DOI: 10.1093/jxb/erab205 ; PMID: 33974689
- NTRC Effects on Non-Photochemical Quenching Depends on PGR5. DOI: 10.3390/antiox10060900 ; PMID: 34204867
- Two plastid POLLUX ion channel-like proteins are required for stress-triggered stromal Ca2+release. DOI: 10.1093/plphys/kiab424 ; PMID: 34618095
- Maintaining the Chloroplast Redox Balance through the PGR5-Dependent Pathway and the Trx System Is Required for Light-Dependent Activation of Photosynthetic Reactions. DOI: 10.1093/pcp/pcab148 ; PMID: 34623443
- A chloroplast redox relay adapts plastid metabolism to light and affects cytosolic protein quality control. DOI: 10.1093/plphys/kiab246 ; PMID: 34618130
- Cystathionine-β-synthase X proteins negatively regulate NADPH-thioredoxin reductase C activity. DOI: 10.1016/j.bbrc.2023.02.055 ; PMID: 36857899
- Plastid 2-Cys peroxiredoxins are essential for embryogenesis in Arabidopsis. DOI: 10.1016/j.redox.2023.102645 ; PMID: 36898225
- The contribution of glutathione peroxidases to chloroplast redox homeostasis in Arabidopsis. DOI: 10.1016/j.redox.2023.102731 ; PMID: 37245286
- The Functional Relationship between NADPH Thioredoxin Reductase C, 2-Cys Peroxiredoxins, and m-Type Thioredoxins in the Regulation of Calvin-Benson Cycle and Malate-Valve Enzymes in Arabidopsis. DOI: 10.3390/antiox12051041 ; PMID: 37237907
- Plant NADPH-dependent thioredoxin reductases are crucial for the metabolism of sink leaves and plant acclimation to elevated CO(2). DOI: 10.1111/pce.14631 ; PMID: 37267089
- The Arabidopsis thaliana chloroplast proteome reveals pathway abundance and novel protein functions. DOI: 10.1016/j.cub.2004.02.039 ; PMID: 15028209
- A novel NADPH thioredoxin reductase, localized in the chloroplast, which deficiency causes hypersensitivity to abiotic stress in Arabidopsis thaliana. DOI: 10.1074/jbc.M404696200 ; PMID: 15292215
- Rice NTRC is a high-efficiency redox system for chloroplast protection against oxidative damage. DOI: 10.1105/tpc.106.041541 ; PMID: 16891402
- Sorting signals, N-terminal modifications and abundance of the chloroplast proteome. DOI: 10.1371/journal.pone.0001994 ; PMID: 18431481
- Quantitative proteomics of a chloroplast SRP54 sorting mutant and its genetic interactions with CLPC1 in Arabidopsis. DOI: 10.1104/pp.108.124545 ; PMID: 18633119
- NADPH-dependent thioredoxin reductase and 2-Cys peroxiredoxins are needed for the protection of Mg-protoporphyrin monomethyl ester cyclase. DOI: 10.1016/j.febslet.2008.07.006 ; PMID: 18625226
- Analysis of protein complexes in Arabidopsis leaves using size exclusion chromatography and label-free protein correlation profiling. DOI: 10.1016/j.jprot.2017.06.004 ; PMID: 28627464
Gene Resources
- UniProt: A0A178VZE7
- EMBL: CACRSJ010000105, CACSHJ010000088, LUHQ01000002
- AlphaFoldDB: A0A178VZE7
- EnsemblPlants: AT2G41680.1
- Gramene: AT2G41680.1
- KEGG: ath:AT2G41680
- Orthologous matrix: QPHTEEV
- ExpressionAtlas: AT2G41680
- InterPro: IPR005982, IPR008255, IPR013766
- PANTHER: PTHR48105
- SUPFAM: SSF51905, SSF52833
- PROSITE: PS00194, PS00573, PS51352
- Gene3D: 3.40.30.10, 3.50.50.60
- OrthoDB: A0A178VZE7
- SWISS-MODEL: A0A178VZE7
- Conserved Domain Database: cd02949
Homologs
- Oryza sativa NTRC, NTRB, NTRA, OsTrx23;OsTRXh1, Ostrxm
Sequences
cDNA Sequence
- >AT2G41680.1
CTCTGGTAAAGGTAAGGCAATCAAAAAAAATATGGCTGCGTCTCCCAAGATAGGCATCGGTATTGCCTCCGTCTCATCGCCTCACCGTGTCTCCGCCGCCTCATCCGCTCTTTCTCCTCCTCCTCATCTCTTCTTTCTCACTACTACTACTACCACACGTCACGGCGGCTCCTATCTCCTCCGTCAACCAACCCGAACTCGCTCTTCTGATTCCCTCCGCCTCAGAGTCTCCGCCACCGCCAATTCTCCGTCTTCTTCTTCTTCAGGAGGCGAGATTATCGAGAATGTAGTGATTATAGGCTCCGGTCCCGCCGGTTATACGGCGGCGATATATGCAGCGCGCGCCAATTTGAAGCCGGTGGTTTTTGAAGGGTATCAGATGGGCGGAGTTCCCGGTGGACAGTTGATGACAACTACTGAAGTTGAGAATTTTCCGGGATTCCCAGACGGTATCACGGGTCCCGATTTAATGGAGAAAATGAGAAAGCAAGCAGAGAGGTGGGGAGCAGAGTTGTATCCAGAAGATGTTGAATCTCTTAGTGTCACAACTGCTCCTTTTACTGTGCAAACTAGTGAACGTAAGGTCAAGTGCCATAGTATTATATATGCCACTGGCGCTACAGCAAGGAGGTTAAGGTTACCTCGAGAGGAAGAATTCTGGAGTAGGGGGATAAGTGCTTGTGCTATCTGTGATGGAGCTTCGCCTTTATTTAAGGGGCAAGTACTTGCCGTGGTTGGAGGAGGAGATACGGCTACAGAGGAAGCCTTGTATCTCACGAAATATGCCCGTCATGTTCATTTGCTTGTTCGCAGAGATCAGTTGAGAGCTTCCAAGGCTATGCAAGATAGAGTGATCAACAATCCAAACATCACAGTGCATTACAACACGGAAACCGTGGACGTATTGAGCAACACCAAGGGACAGATGTCTGGCATTCTACTCAGAAGACTTGATACGGGTGAAGAAACTGAGCTGGAGGCAAAAGGATTGTTTTATGGAATAGGGCATTCGCCAAACAGTCAGTTATTGGAAGGCCAAGTCGAACTCGACAGCTCCGGGTACGTCTTGGTTCGGGAAGGAACATCAAATACATCAGTTGAAGGTGTATTTGCTGCAGGAGATGTGCAGGACCACGAATGGAGACAAGCTGTAACTGCTGCTGGATCAGGATGCATAGCTGCTTTGTCAGCCGAGAGATACCTCACAAGTAACAATCTTCTTGTTGAATTTCACCAGCCTCAAACTGAAGAGGCCAAGAAAGAATTCACACAACGGGATGTCCAAGAAAAGTTTGACATCACTCTTACAAAGCACAAGGGACAGTATGCTCTTAGAAAACTATACCATGAGAGTCCAAGAGTTATATTGGTACTATACACTTCACCAACATGTGGCCCCTGTAGGACTCTGAAGCCTATTTTGAACAAGGTGGTCGATGAGTATAACCATGATGTGCATTTTGTTGAGATTGACATCGAGGAAGATCAAGAAATTGCTGAAGCAGCTGGAATTATGGGAACCCCATGTGTGCAGTTCTTCAAGAACAAGGAAATGCTCAGGACTATATCGGGTGTGAAGATGAAGAAAGAGTACCGAGAATTCATTGAGGCCAATAAATGAGGACACCAGATAGATATTGTTTCTGGCAGATGCCAAATCTTATCATGATTCAATTTTGTTCATTCAAATACTTTGGAGTTACTGGAGCAACGCCATTGAATCTCAAATGTAAACAAATAGAATCATCATCTTAAGCTGCACGCATAATGTGGTACAATTTGCTTTAAGATTTTACAAAACAACTACCCGTTTTG
CDS Sequence
- >AT2G41680.1
ATGGCTGCGTCTCCCAAGATAGGCATCGGTATTGCCTCCGTCTCATCGCCTCACCGTGTCTCCGCCGCCTCATCCGCTCTTTCTCCTCCTCCTCATCTCTTCTTTCTCACTACTACTACTACCACACGTCACGGCGGCTCCTATCTCCTCCGTCAACCAACCCGAACTCGCTCTTCTGATTCCCTCCGCCTCAGAGTCTCCGCCACCGCCAATTCTCCGTCTTCTTCTTCTTCAGGAGGCGAGATTATCGAGAATGTAGTGATTATAGGCTCCGGTCCCGCCGGTTATACGGCGGCGATATATGCAGCGCGCGCCAATTTGAAGCCGGTGGTTTTTGAAGGGTATCAGATGGGCGGAGTTCCCGGTGGACAGTTGATGACAACTACTGAAGTTGAGAATTTTCCGGGATTCCCAGACGGTATCACGGGTCCCGATTTAATGGAGAAAATGAGAAAGCAAGCAGAGAGGTGGGGAGCAGAGTTGTATCCAGAAGATGTTGAATCTCTTAGTGTCACAACTGCTCCTTTTACTGTGCAAACTAGTGAACGTAAGGTCAAGTGCCATAGTATTATATATGCCACTGGCGCTACAGCAAGGAGGTTAAGGTTACCTCGAGAGGAAGAATTCTGGAGTAGGGGGATAAGTGCTTGTGCTATCTGTGATGGAGCTTCGCCTTTATTTAAGGGGCAAGTACTTGCCGTGGTTGGAGGAGGAGATACGGCTACAGAGGAAGCCTTGTATCTCACGAAATATGCCCGTCATGTTCATTTGCTTGTTCGCAGAGATCAGTTGAGAGCTTCCAAGGCTATGCAAGATAGAGTGATCAACAATCCAAACATCACAGTGCATTACAACACGGAAACCGTGGACGTATTGAGCAACACCAAGGGACAGATGTCTGGCATTCTACTCAGAAGACTTGATACGGGTGAAGAAACTGAGCTGGAGGCAAAAGGATTGTTTTATGGAATAGGGCATTCGCCAAACAGTCAGTTATTGGAAGGCCAAGTCGAACTCGACAGCTCCGGGTACGTCTTGGTTCGGGAAGGAACATCAAATACATCAGTTGAAGGTGTATTTGCTGCAGGAGATGTGCAGGACCACGAATGGAGACAAGCTGTAACTGCTGCTGGATCAGGATGCATAGCTGCTTTGTCAGCCGAGAGATACCTCACAAGTAACAATCTTCTTGTTGAATTTCACCAGCCTCAAACTGAAGAGGCCAAGAAAGAATTCACACAACGGGATGTCCAAGAAAAGTTTGACATCACTCTTACAAAGCACAAGGGACAGTATGCTCTTAGAAAACTATACCATGAGAGTCCAAGAGTTATATTGGTACTATACACTTCACCAACATGTGGCCCCTGTAGGACTCTGAAGCCTATTTTGAACAAGGTGGTCGATGAGTATAACCATGATGTGCATTTTGTTGAGATTGACATCGAGGAAGATCAAGAAATTGCTGAAGCAGCTGGAATTATGGGAACCCCATGTGTGCAGTTCTTCAAGAACAAGGAAATGCTCAGGACTATATCGGGTGTGAAGATGAAGAAAGAGTACCGAGAATTCATTGAGGCCAATAAATGA
Protein Sequence
- >AT2G41680.1
MAASPKIGIGIASVSSPHRVSAASSALSPPPHLFFLTTTTTTRHGGSYLLRQPTRTRSSDSLRLRVSATANSPSSSSSGGEIIENVVIIGSGPAGYTAAIYAARANLKPVVFEGYQMGGVPGGQLMTTTEVENFPGFPDGITGPDLMEKMRKQAERWGAELYPEDVESLSVTTAPFTVQTSERKVKCHSIIYATGATARRLRLPREEEFWSRGISACAICDGASPLFKGQVLAVVGGGDTATEEALYLTKYARHVHLLVRRDQLRASKAMQDRVINNPNITVHYNTETVDVLSNTKGQMSGILLRRLDTGEETELEAKGLFYGIGHSPNSQLLEGQVELDSSGYVLVREGTSNTSVEGVFAAGDVQDHEWRQAVTAAGSGCIAALSAERYLTSNNLLVEFHQPQTEEAKKEFTQRDVQEKFDITLTKHKGQYALRKLYHESPRVILVLYTSPTCGPCRTLKPILNKVVDEYNHDVHFVEIDIEEDQEIAEAAGIMGTPCVQFFKNKEMLRTISGVKMKKEYREFIEANK