Gene Details:
- Gene ID: AT2G39660
- Gene Symbol: BIK1
- Gene Name: botrytis-induced kinase1
- Description: botrytis-induced kinase1;(source:Araport11)
- TAIR Accession:
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Germplasm Phenotype:
- CS71773 — Dwarf, wrinkled leaves, particularly the 4th and newer pair of true leaves. Mild defect in seed production. Moderately elongated and curling petioles. Compromised in diverse flagellin-mediated responses and immunity to nonpathogenic bacterial infection; enhanced resistance to Pst and Psm infection. Brassinosteroid hypersensitive phenotypes and elevated accumulation of salicylic acid.
- bik1 — After A. brassicicola infection, increased disease symptoms and pathogen growth are observed when compared to wild type.
- bik1 — After spraying mutant plants with Botrytis spores, disease symptoms increase rapidly, showing chlorosis, necrosis, and complete plant decay compared with wild type plants.
Function-related keywords:
- shoot axis apex , leaf lamina base , root , shoot system , plant embryo , vascular leaf , stamen , sepal , flower , inflorescence flower pedicel , cotyledon , petiole , hypocotyl , leaf apex , collective leaf structure , pollen
Literature:
- Altered gene expression in three plant species in response to treatment with Nep1, a fungal protein that causes necrosis. DOI: 10.1104/pp.102.019836 ; PMID: 12857840
- Unexpected protein families including cell defense components feature in the N-myristoylome of a higher eukaryote. DOI: 10.1074/jbc.M307321200 ; PMID: 12912986
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- The transcriptional innate immune response to flg22. Interplay and overlap with Avr gene-dependent defense responses and bacterial pathogenesis. DOI: 10.1104/pp.103.036749 ; PMID: 15181213
- Phylogenetic profiling of the Arabidopsis thaliana proteome: what proteins distinguish plants from other organisms? DOI: 10.1186/gb-2004-5-8-r53 ; PMID: 15287975
- High-throughput protein localization in Arabidopsis using Agrobacterium-mediated transient expression of GFP-ORF fusions. DOI: 10.1111/j.1365-313X.2004.02281.x ; PMID: 15610358
- The membrane-anchored BOTRYTIS-INDUCED KINASE1 plays distinct roles in Arabidopsis resistance to necrotrophic and biotrophic pathogens. DOI: 10.1105/tpc.105.035576 ; PMID: 16339855
- CONSTITUTIVELY PHOTOMORPHOGENIC1 is required for the UV-B response in Arabidopsis. DOI: 10.1105/tpc.105.040097 ; PMID: 16829591
- Oviposition by pierid butterflies triggers defense responses in Arabidopsis. DOI: 10.1104/pp.106.090837 ; PMID: 17142483
- Arabidopsis transcriptome changes in response to phloem-feeding silverleaf whitefly nymphs. Similarities and distinctions in responses to aphids. DOI: 10.1104/pp.106.090662 ; PMID: 17189325
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector. DOI: 10.1016/j.chom.2010.03.007 ; PMID: 20413097
- Phosphorylation of receptor-like cytoplasmic kinases by bacterial flagellin. DOI: 10.4161/psb.11500 ; PMID: 20404519
- Bacterial effector HopF2 suppresses arabidopsis innate immunity at the plasma membrane. DOI: 10.1094/MPMI-07-10-0150 ; PMID: 21198360
- Autophosphorylation profiling of Arabidopsis protein kinases using the cell-free system. DOI: 10.1016/j.phytochem.2011.02.029 ; PMID: 21477822
- Biochemical and genetic requirements for function of the immune response regulator BOTRYTIS-INDUCED KINASE1 in plant growth, ethylene signaling, and PAMP-triggered immunity in Arabidopsis. DOI: 10.1105/tpc.111.087122 ; PMID: 21862710
- A Xanthomonas uridine 5'-monophosphate transferase inhibits plant immune kinases. DOI: 10.1038/nature10962 ; PMID: 22504181
- BIK1 interacts with PEPRs to mediate ethylene-induced immunity. DOI: 10.1073/pnas.1215543110 ; PMID: 23431184
- Mutations in FLS2 Ser-938 dissect signaling activation in FLS2-mediated Arabidopsis immunity. DOI: 10.1371/journal.ppat.1003313 ; PMID: 23637603
- Inverse modulation of plant immune and brassinosteroid signaling pathways by the receptor-like cytoplasmic kinase BIK1. DOI: 10.1073/pnas.1302154110 ; PMID: 23818580
- The Pseudomonas syringae effector HopF2 suppresses Arabidopsis immunity by targeting BAK1. DOI: 10.1111/tpj.12381 ; PMID: 24237140
- The plant actin cytoskeleton responds to signals from microbe-associated molecular patterns. DOI: 10.1371/journal.ppat.1003290 ; PMID: 23593000
- xopAC-triggered immunity against Xanthomonas depends on Arabidopsis receptor-like cytoplasmic kinase genes PBL2 and RIPK. DOI: 10.1371/journal.pone.0073469 ; PMID: 23951354
- Identification and functional analysis of phosphorylation residues of the Arabidopsis BOTRYTIS-INDUCED KINASE1. DOI: 10.1007/s13238-013-3053-6 ; PMID: 24104392
- Tyrosine phosphorylation of protein kinase complex BAK1/BIK1 mediates Arabidopsis innate immunity. DOI: 10.1073/pnas.1318817111 ; PMID: 24532660
- The FLS2-associated kinase BIK1 directly phosphorylates the NADPH oxidase RbohD to control plant immunity. DOI: 10.1016/j.chom.2014.02.009 ; PMID: 24629339
- Selective regulation of the chitin-induced defense response by the Arabidopsis receptor-like cytoplasmic kinase PBL27. DOI: 10.1111/tpj.12535 ; PMID: 24750441
- Direct regulation of the NADPH oxidase RBOHD by the PRR-associated kinase BIK1 during plant immunity. DOI: 10.1016/j.molcel.2014.02.021 ; PMID: 24630626
- The calcium-dependent protein kinase CPK28 buffers plant immunity and regulates BIK1 turnover. DOI: 10.1016/j.chom.2014.10.007 ; PMID: 25525792
- Microbe-associated molecular pattern-induced calcium signaling requires the receptor-like cytoplasmic kinases, PBL1 and BIK1. DOI: 10.1186/s12870-014-0374-4 ; PMID: 25522736
- Regulatory role of BOTRYTIS INDUCED KINASE1 in ETHYLENE INSENSITIVE3-dependent gene expression in Arabidopsis. DOI: 10.1007/s00299-015-1812-y ; PMID: 26021844
- Enhanced aphid detoxification when confronted by a host with elevated ROS production. DOI: 10.1080/15592324.2015.1010936 ; PMID: 25932782
- The calcium-dependent protein kinase CPK28 negatively regulates the BIK1-mediated PAMP-induced calcium burst. DOI: 10.1080/15592324.2015.1018497 ; PMID: 26039480
- The Decoy Substrate of a Pathogen Effector and a Pseudokinase Specify Pathogen-Induced Modified-Self Recognition and Immunity in Plants. DOI: 10.1016/j.chom.2015.08.004 ; PMID: 26355215
- Arabidopsis heterotrimeric G proteins regulate immunity by directly coupling to the FLS2 receptor. DOI: 10.7554/eLife.13568 ; PMID: 27043937
- A Phytophthora sojae effector PsCRN63 forms homo-/hetero-dimers to suppress plant immunity via an inverted association manner. DOI: 10.1038/srep26951 ; PMID: 27243217
- The Arabidopsis Protein Phosphatase PP2C38 Negatively Regulates the Central Immune Kinase BIK1. DOI: 10.1371/journal.ppat.1005811 ; PMID: 27494702
- Arabidopsis Mutant bik1 Exhibits Strong Resistance to Plasmodiophora brassicae. DOI: 10.3389/fphys.2016.00402 ; PMID: 27679580
- Arabidopsis receptor-like cytoplasmic kinase BIK1: purification, crystallization and X-ray diffraction analysis. DOI: 10.1107/S2053230X16013522 ; PMID: 27710938
- BOTRYTIS-INDUCED KINASE1 Modulates Arabidopsis Resistance to Green Peach Aphids via PHYTOALEXIN DEFICIENT4. DOI: 10.1104/pp.114.242206 ; PMID: 24963070
- Assessment of BAK1 activity in different plant receptor-like kinase complexes by quantitative profiling of phosphorylation patterns. DOI: 10.1016/j.jprot.2014.06.009 ; PMID: 24953020
- Induction of Systemic Resistance against Aphids by Endophytic Bacillus velezensis YC7010 via Expressing PHYTOALEXIN DEFICIENT4 in Arabidopsis. DOI: 10.3389/fpls.2017.00211 ; PMID: 28261260
- BOTRYTIS-INDUCED KINASE1, a plasma membrane-localized receptor-like protein kinase, is a negative regulator of phosphate homeostasis in Arabidopsis thaliana. DOI: 10.1186/s12870-016-0841-1 ; PMID: 27389008
- Dynamic G protein alpha signaling in Arabidopsis innate immunity. DOI: 10.1016/j.bbrc.2017.07.040 ; PMID: 28698136
- The Arabidopsis Cysteine-Rich Receptor-Like Kinase CRK36 Regulates Immunity through Interaction with the Cytoplasmic Kinase BIK1. DOI: 10.3389/fpls.2017.01856 ; PMID: 29163585
- A Regulatory Module Controlling Homeostasis of a Plant Immune Kinase. DOI: 10.1016/j.molcel.2017.12.026 ; PMID: 29358080
- Ligand-triggered de-repression of Arabidopsis heterotrimeric G proteins coupled to immune receptor kinases. DOI: 10.1038/s41422-018-0027-5 ; PMID: 29545645
- Conserved Degradation of Orthologous RLCKs Regulates Immune Homeostasis. DOI: 10.1016/j.tplants.2018.05.001 ; PMID: 29776748
- Roles of Receptor-Like Cytoplasmic Kinase VII Members in Pattern-Triggered Immune Signaling. DOI: 10.1104/pp.18.00486 ; PMID: 29907700
- The MAP4 Kinase SIK1 Ensures Robust Extracellular ROS Burst and Antibacterial Immunity in Plants. DOI: 10.1016/j.chom.2018.08.007 ; PMID: 30212650
- Comparing Arabidopsis receptor kinase and receptor protein-mediated immune signaling reveals BIK1-dependent differences. DOI: 10.1111/nph.15497 ; PMID: 30252144
- SUMO conjugation to the pattern recognition receptor FLS2 triggers intracellular signalling in plant innate immunity. DOI: 10.1038/s41467-018-07696-8 ; PMID: 30518761
- Proteolytic Processing of SERK3/BAK1 Regulates Plant Immunity, Development, and Cell Death. DOI: 10.1104/pp.18.01503 ; PMID: 30782965
- A calmodulin-gated calcium channel links pathogen patterns to plant immunity. DOI: 10.1038/s41586-019-1413-y ; PMID: 31316205
- Exogenous Treatment with Glutamate Induces Immune Responses in Arabidopsis. DOI: 10.1094/MPMI-09-19-0262-R ; PMID: 31721650
- BIK1 and ERECTA Play Opposing Roles in Both Leaf and Inflorescence Development in Arabidopsis. DOI: 10.3389/fpls.2019.01480 ; PMID: 31803215
- Ligand-induced monoubiquitination of BIK1 regulates plant immunity. DOI: 10.1038/s41586-020-2210-3 ; PMID: 32404997
- Arabidopsis Plants Sense Non-self Peptides to Promote Resistance Against Plectosphaerella cucumerina. DOI: 10.3389/fpls.2020.00529 ; PMID: 32536929
- Danger-Associated Peptide Regulates Root Immune Responses and Root Growth by Affecting ROS Formation in Arabidopsis. DOI: 10.3390/ijms21134590 ; PMID: 32605179
- The calcium-permeable channel OSCA1.3 regulates plant stomatal immunity. DOI: 10.1038/s41586-020-2702-1 ; PMID: 32846426
- Differential Ubiquitination of BIK1 Fine-Tunes Plant Immunity. DOI: 10.1016/j.tplants.2020.09.007 ; PMID: 32972847
- A mis-regulated cyclic nucleotide-gated channel mediates cytosolic calcium elevation and activates immunity in Arabidopsis. DOI: 10.1111/nph.17218 ; PMID: 33469907
- Pattern-recognition receptors are required for NLR-mediated plant immunity. DOI: 10.1038/s41586-021-03316-6 ; PMID: 33692546
- Phosphorylation-dependent subfunctionalization of the calcium-dependent protein kinase CPK28. DOI: 10.1073/pnas.2024272118 ; PMID: 33941701
- A Phytophthora capsici RXLR effector targets and inhibits the central immune kinases to suppress plant immunity. DOI: 10.1111/nph.17573 ; PMID: 34157161
- Phosphorylation of BIK1 is critical for interaction with downstream signaling components. DOI: 10.1007/s13258-021-01148-2 ; PMID: 34449065
- The Arabidopsis MIK2 receptor elicits immunity by sensing a conserved signature from phytocytokines and microbes. DOI: 10.1038/s41467-021-25580-w ; PMID: 34535661
- The calcium-dependent protein kinase CPK28 is targeted by the ubiquitin ligases ATL31 and ATL6 for proteasome-mediated degradation to fine-tune immune signaling in Arabidopsis. DOI: 10.1093/plcell/koab242 ; PMID: 34599338
- and Damage-Associated Molecular Patterns by Leucine-Rich Repeat Pattern Recognition Receptor Kinases Confers Salt Tolerance in Plants. DOI: 10.1094/MPMI-07-21-0185-FI ; PMID: 34726476
- A receptor-like cytoplasmic kinase PCRK2 undergoes ubiquitination and proteasomal degradation. DOI: 10.1016/j.bbrc.2021.11.094 ; PMID: 34871998
- Phytocytokine signalling reopens stomata in plant immunity and water loss. DOI: 10.1038/s41586-022-04684-3 ; PMID: 35508659
- Activation and turnover of the plant immune signaling kinase BIK1: a fine balance. DOI: 10.1042/EBC20210071 ; PMID: 35575190
- DIACYLGLYCEROL KINASE 5 participates in flagellin-induced signaling in Arabidopsis. DOI: 10.1093/plphys/kiac354 ; PMID: 35900211
- Phosphorylation status of CPK28 affects its ubiquitination and protein stability. DOI: 10.1111/nph.18596 ; PMID: 36333900
- The Arabidopsis E3 ubiquitin ligase PUB4 regulates BIK1 and is targeted by a bacterial type-III effector. DOI: 10.15252/embj.2020107257 ; PMID: 36314733
- Organelle-targeted biosensors reveal distinct oxidative events during pattern-triggered immune responses. DOI: 10.1093/plphys/kiac603 ; PMID: 36582183
- SUMO/deSUMOylation of the BRI1 brassinosteroid receptor modulates plant growth responses to temperature. DOI: 10.1073/pnas.2217255120 ; PMID: 36652487
- Conservation of the PBL-RBOH immune module in land plants. DOI: 10.1016/j.cub.2023.01.050 ; PMID: 36796360
- Conservation and divergence of flg22, pep1 and nlp20 in activation of immune response and inhibition of root development. DOI: 10.1016/j.plantsci.2023.111686 ; PMID: 36963637
- Danger-associate peptide regulates root immunity in Arabidopsis. DOI: 10.1016/j.bbrc.2023.04.091 ; PMID: 37121126
- Unexpected protein families including cell defense components feature in the N-myristoylome of a higher eukaryote. DOI: 10.1074/jbc.M307321200 ; PMID: 12912986
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
Sequences:
cDNA Sequence
- >AT2G39660.1
AAAAACTTTAGGATATATTGCCAAAAGATCTTAAAAATGGGTCATATCATTTTGATCATATAGAATCCAACGACCTTTATCTTTTCGCCGAACTATACTTTTTTGTGTCCATTTGTTTGACTTTCTTTCACACACACATCCACAAAGAAAAAAGGACCATTCTTCTCCTTCTTCTAGTCACCCCTCGTGCCTCTCTTTAACACCAAACCCAAAACTCCCTTCTCTTTCTTCCTTCCTCTCCGATCTCCGTTCACATCTCTCTCTCATCTTTATCTTCTTCTTTTTTTGCCTTGTGGGTTGAAAGTTTCTATATTTTCTCTTTCTCTTCTGTTTACATAATCCATTTTCAGCTCAAGCAGCTGAAGAATAACGATCAAGAACCAAAAAAGAAGAAAACGAATCTGTTCTTAGCTTTGATGGGTTCTTGCTTCAGTTCTCGAGTCAAAGCAGACATCTTCCACAATGGTAAGAGCAGCGATCTTTATGGTCTAAGTCTCTCAAGTCGGAAATCGTCTTCGACTGTAGCGGCGGCTCAGAAGACGGAAGGGGAGATATTGAGTTCGACCCCTGTCAAAAGCTTCACCTTTAACGAACTCAAACTCGCCACAAGAAACTTCAGACCAGATAGTGTGATCGGAGAAGGTGGCTTTGGTTGTGTCTTTAAAGGCTGGTTAGATGAGTCCACTCTCACTCCGACTAAACCTGGAACCGGTTTGGTCATCGCCGTTAAAAAGCTTAACCAAGAAGGTTTTCAAGGTCACCGTGAATGGCTGACAGAGATCAATTACTTGGGGCAACTGAGTCACCCAAATCTAGTTAAACTGATCGGTTATTGCTTAGAAGATGAACACCGTCTTCTAGTCTACGAGTTTATGCAAAAAGGAAGTCTTGAGAATCATCTATTCAGAAGAGGTGCATATTTTAAGCCACTCCCATGGTTTCTACGGGTCAATGTTGCGCTTGATGCAGCAAAGGGGCTTGCTTTTCTTCACAGCGATCCCGTCAAAGTGATATACCGAGACATTAAAGCCTCGAACATCTTACTTGATGCGGACTACAACGCAAAACTTTCTGACTTTGGACTAGCTAGAGACGGTCCAATGGGTGATTTGAGTTATGTTAGTACAAGGGTCATGGGTACTTATGGGTACGCCGCGCCTGAGTACATGTCATCAGGTCACTTGAATGCAAGAAGCGATGTGTACAGTTTCGGAGTTTTGCTTCTAGAGATTTTATCTGGTAAGCGAGCGTTGGATCATAACAGACCGGCTAAAGAAGAAAACCTTGTGGATTGGGCTCGACCGTACCTCACAAGCAAACGTAAGGTTCTCCTAATCGTGGACAATCGGCTAGACACACAGTACCTACCTGAAGAAGCCGTGAGAATGGCAAGCGTGGCGGTGCAGTGTCTCTCATTTGAACCCAAGTCGCGCCCGACCATGGACCAAGTGGTCCGTGCCTTACAACAACTTCAGGACAACTTGGGAAAACCGAGTCAGACCAATCCGGTTAAGGATACCAAGAAACTTGGTTTTAAAACTGGTACTACTAAGTCATCCGAAAAACGGTTTACACAAAAACCTTTTGGCAGGCACCTTGTGTAGGTCAAGTTGATAACTGAATTCCAGGATGGACATTTTTCCGGCGGTTTACTTGAAACTGCCGATATCCGTTTTCGACGGATTGAATGCGGTTCTGGACAAACCGTGCAGGTCAAGACTAATAAAGGATACATTAAATTTTCCGGTTACATGTCCCATACCCAACCTTAGAGAACATGTGTAGCCTTTAGCTTAGGCTTCCTTGTGTGCTGTTATATTGAGTATATATGAGGTAATTTTTGCCTCTTGTGTTGTAACACTTGTATTTTTGTTCCTTTAACATTTGATGTAGAGATTTTTCCTATATCTTCAGTTTTGAAACCCAAATTTATTGCAAGTCAAAATATGAAAATTCTAATCAATGTGCAATGAATAACACAAATCCGAA
CDS Sequence
- >AT2G39660.1
ATGGGTTCTTGCTTCAGTTCTCGAGTCAAAGCAGACATCTTCCACAATGGTAAGAGCAGCGATCTTTATGGTCTAAGTCTCTCAAGTCGGAAATCGTCTTCGACTGTAGCGGCGGCTCAGAAGACGGAAGGGGAGATATTGAGTTCGACCCCTGTCAAAAGCTTCACCTTTAACGAACTCAAACTCGCCACAAGAAACTTCAGACCAGATAGTGTGATCGGAGAAGGTGGCTTTGGTTGTGTCTTTAAAGGCTGGTTAGATGAGTCCACTCTCACTCCGACTAAACCTGGAACCGGTTTGGTCATCGCCGTTAAAAAGCTTAACCAAGAAGGTTTTCAAGGTCACCGTGAATGGCTGACAGAGATCAATTACTTGGGGCAACTGAGTCACCCAAATCTAGTTAAACTGATCGGTTATTGCTTAGAAGATGAACACCGTCTTCTAGTCTACGAGTTTATGCAAAAAGGAAGTCTTGAGAATCATCTATTCAGAAGAGGTGCATATTTTAAGCCACTCCCATGGTTTCTACGGGTCAATGTTGCGCTTGATGCAGCAAAGGGGCTTGCTTTTCTTCACAGCGATCCCGTCAAAGTGATATACCGAGACATTAAAGCCTCGAACATCTTACTTGATGCGGACTACAACGCAAAACTTTCTGACTTTGGACTAGCTAGAGACGGTCCAATGGGTGATTTGAGTTATGTTAGTACAAGGGTCATGGGTACTTATGGGTACGCCGCGCCTGAGTACATGTCATCAGGTCACTTGAATGCAAGAAGCGATGTGTACAGTTTCGGAGTTTTGCTTCTAGAGATTTTATCTGGTAAGCGAGCGTTGGATCATAACAGACCGGCTAAAGAAGAAAACCTTGTGGATTGGGCTCGACCGTACCTCACAAGCAAACGTAAGGTTCTCCTAATCGTGGACAATCGGCTAGACACACAGTACCTACCTGAAGAAGCCGTGAGAATGGCAAGCGTGGCGGTGCAGTGTCTCTCATTTGAACCCAAGTCGCGCCCGACCATGGACCAAGTGGTCCGTGCCTTACAACAACTTCAGGACAACTTGGGAAAACCGAGTCAGACCAATCCGGTTAAGGATACCAAGAAACTTGGTTTTAAAACTGGTACTACTAAGTCATCCGAAAAACGGTTTACACAAAAACCTTTTGGCAGGCACCTTGTGTAG
Protein Sequence
- >AT2G39660.1
MGSCFSSRVKADIFHNGKSSDLYGLSLSSRKSSSTVAAAQKTEGEILSSTPVKSFTFNELKLATRNFRPDSVIGEGGFGCVFKGWLDESTLTPTKPGTGLVIAVKKLNQEGFQGHREWLTEINYLGQLSHPNLVKLIGYCLEDEHRLLVYEFMQKGSLENHLFRRGAYFKPLPWFLRVNVALDAAKGLAFLHSDPVKVIYRDIKASNILLDADYNAKLSDFGLARDGPMGDLSYVSTRVMGTYGYAAPEYMSSGHLNARSDVYSFGVLLLEILSGKRALDHNRPAKEENLVDWARPYLTSKRKVLLIVDNRLDTQYLPEEAVRMASVAVQCLSFEPKSRPTMDQVVRALQQLQDNLGKPSQTNPVKDTKKLGFKTGTTKSSEKRFTQKPFGRHLV