Gene Details:
- Gene ID: AT2G38470
- Gene Symbol: ATWRKY33, WRKY33
- Gene Name: WRKY DNA-BINDING PROTEIN 33, WRKY DNA-binding protein 33
- Description: WRKY DNA-binding protein 33;(source:Araport11)
- TAIR Accession: locus:2057212
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Gene Ontology:
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0009627 — acts upstream of or within — systemic acquired resistance
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0009414 — acts upstream of or within — response to water deprivation
- GO:0010120 — acts upstream of or within — camalexin biosynthetic process
- GO:0006355 — involved in — regulation of DNA-templated transcription
- GO:0005515 — enables — protein binding
- GO:0070370 — acts upstream of or within — cellular heat acclimation
- GO:0034605 — acts upstream of or within — cellular response to heat
- GO:0005634 — located in — nucleus
- GO:0010508 — acts upstream of or within — positive regulation of autophagy
- GO:0050832 — acts upstream of or within — defense response to fungus
- GO:0009408 — acts upstream of or within — response to heat
- GO:0042742 — acts upstream of or within — defense response to bacterium
- GO:0006970 — acts upstream of or within — response to osmotic stress
- GO:0009409 — acts upstream of or within — response to cold
- GO:0009651 — acts upstream of or within — response to salt stress
Germplasm Phenotype:
- SALK_006603 — Homozygotes have a WT phenotype. Root bending and root elongation assays under osmotic and ABA treatments showed no significant difference compared to WT. However, primary root elongation was inhibited by salt stress. Relative electrolyte leakage was significantly higher in salt - stressed plants as compared to WT.
- SALK_064436 — Sensitive to salt.
- wrky25-1; wrky33-1 — Double mutant roots were significantly shorter than WT toots when under salt-stress.
Function-related keywords:
- shoot axis apex , leaf lamina base , root , plant embryo , vascular leaf , stamen , sepal , flower , inflorescence flower pedicel , cotyledon , petiole , hypocotyl , leaf apex , collective leaf structure , pollen
Literature:
- The WRKY superfamily of plant transcription factors. DOI: 10.1016/s1360-1385(00)01600-9 ; PMID: 10785665
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Expression profile analysis of the low-oxygen response in Arabidopsis root cultures. DOI: 10.1105/tpc.004747 ; PMID: 12368499
- The MAP kinase substrate MKS1 is a regulator of plant defense responses. DOI: 10.1038/sj.emboj.7600737 ; PMID: 15990873
- Arabidopsis WRKY33 transcription factor is required for resistance to necrotrophic fungal pathogens. DOI: 10.1111/j.1365-313X.2006.02901.x ; PMID: 17059405
- or PAMP-responsive WRKY transcription factor is regulated by a composite DNA motif containing W box elements. DOI: 10.1094/MPMI-20-4-0420 ; PMID: 17427812
- Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. DOI: 10.1094/MPMI-20-8-0900 ; PMID: 17722694
- Calmodulin-binding transcription activator (CAMTA) 3 mediates biotic defense responses in Arabidopsis. DOI: 10.1016/j.febslet.2008.02.037 ; PMID: 18298954
- The role of JAR1 in Jasmonoyl-L: -isoleucine production during Arabidopsis wound response. DOI: 10.1007/s00425-008-0694-4 ; PMID: 18247047
- Arabidopsis MAP kinase 4 regulates gene expression through transcription factor release in the nucleus. DOI: 10.1038/emboj.2008.147 ; PMID: 18650934
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Functional characterization of Arabidopsis NaCl-inducible WRKY25 and WRKY33 transcription factors in abiotic stresses. DOI: 10.1007/s11103-008-9408-3 ; PMID: 18839316
- PEPR2 is a second receptor for the Pep1 and Pep2 peptides and contributes to defense responses in Arabidopsis. DOI: 10.1105/tpc.109.068874 ; PMID: 20179141
- Activation of a mitogen-activated protein kinase pathway in Arabidopsis by chitin. DOI: 10.1111/j.1364-3703.2004.00215.x ; PMID: 20565589
- DPI-ELISA: a fast and versatile method to specify the binding of plant transcription factors to DNA in vitro. DOI: 10.1186/1746-4811-6-25 ; PMID: 21108821
- Ca2+ signaling by plant Arabidopsis thaliana Pep peptides depends on AtPepR1, a receptor with guanylyl cyclase activity, and cGMP-activated Ca2+ channels. DOI: 10.1073/pnas.1000191107 ; PMID: 21088220
- MAMP-responsive MAPK cascades regulate phytoalexin biosynthesis. DOI: 10.4161/psb.5.12.13982 ; PMID: 21150304
- Arabidopsis MKS1 is involved in basal immunity and requires an intact N-terminal domain for proper function. DOI: 10.1371/journal.pone.0014364 ; PMID: 21203436
- Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance. DOI: 10.1007/s00425-011-1375-2 ; PMID: 21336597
- A critical role of autophagy in plant resistance to necrotrophic fungal pathogens. DOI: 10.1111/j.1365-313X.2011.04553.x ; PMID: 21395886
- Phosphorylation of a WRKY transcription factor by two pathogen-responsive MAPKs drives phytoalexin biosynthesis in Arabidopsis. DOI: 10.1105/tpc.111.084996 ; PMID: 21498677
- Constitutive expression of MKS1 confers susceptibility to Botrytis cinerea infection independent of PAD3 expression. DOI: 10.4161/psb.6.10.16759 ; PMID: 21900742
- Arabidopsis sigma factor binding proteins are activators of the WRKY33 transcription factor in plant defense. DOI: 10.1105/tpc.111.090571 ; PMID: 21990940
- Arabidopsis WRKY33 is a key transcriptional regulator of hormonal and metabolic responses toward Botrytis cinerea infection. DOI: 10.1104/pp.111.192641 ; PMID: 22392279
- Structural and functional analysis of VQ motif-containing proteins in Arabidopsis as interacting proteins of WRKY transcription factors. DOI: 10.1104/pp.112.196816 ; PMID: 22535423
- The Arabidopsis ubiquitin ligases ATL31 and ATL6 control the defense response as well as the carbon/nitrogen response. DOI: 10.1007/s11103-012-9907-0 ; PMID: 22481162
- Indole-3-acetaldoxime-derived compounds restrict root colonization in the beneficial interaction between Arabidopsis roots and the endophyte Piriformospora indica. DOI: 10.1094/MPMI-03-12-0071-R ; PMID: 22852809
- Linking ligand perception by PEPR pattern recognition receptors to cytosolic Ca2+ elevation and downstream immune signaling in plants. DOI: 10.1073/pnas.1205448109 ; PMID: 23150556
- AtWRKY40 and AtWRKY63 modulate the expression of stress-responsive nuclear genes encoding mitochondrial and chloroplast proteins. DOI: 10.1104/pp.113.215996 ; PMID: 23509177
- Functional dissection of the PROPEP2 and PROPEP3 promoters reveals the importance of WRKY factors in mediating microbe-associated molecular pattern-induced expression. DOI: 10.1111/nph.12233 ; PMID: 23496690
- Ethylene Response Factor6 acts as a central regulator of leaf growth under water-limiting conditions in Arabidopsis. DOI: 10.1104/pp.113.216341 ; PMID: 23553636
- The beet cyst nematode Heterodera schachtii modulates the expression of WRKY transcription factors in syncytia to favour its development in Arabidopsis roots. DOI: 10.1371/journal.pone.0102360 ; PMID: 25033038
- Screening for protein-DNA interactions by automatable DNA-protein interaction ELISA. DOI: 10.1371/journal.pone.0075177 ; PMID: 24146751
- Promoter-based integration in plant defense regulation. DOI: 10.1104/pp.114.248716 ; PMID: 25352272
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Characterization of the promoter and extended C-terminal domain of Arabidopsis WRKY33 and functional analysis of tomato WRKY33 homologues in plant stress responses. DOI: 10.1093/jxb/erv221 ; PMID: 25969555
- Negative regulation of ABA signaling by WRKY33 is critical for Arabidopsis immunity towards Botrytis cinerea 2100. DOI: 10.7554/eLife.07295 ; PMID: 26076231
- Sustained exposure to abscisic acid enhances the colonization potential of the mutualist fungus Piriformospora indica on Arabidopsis thaliana roots. DOI: 10.1111/nph.13504 ; PMID: 26075497
- Arabidopsis Elongator subunit 2 positively contributes to resistance to the necrotrophic fungal pathogens Botrytis cinerea and Alternaria brassicicola. DOI: 10.1111/tpj.12946 ; PMID: 26216741
- The Arabidopsis Mediator Complex Subunit16 Is a Key Component of Basal Resistance against the Necrotrophic Fungal Pathogen Sclerotinia sclerotiorum. DOI: 10.1104/pp.15.00351 ; PMID: 26143252
- Glutathione Regulates 1-Aminocyclopropane-1-Carboxylate Synthase Transcription via WRKY33 and 1-Aminocyclopropane-1-Carboxylate Oxidase by Modulating Messenger RNA Stability to Induce Ethylene Synthesis during Stress. DOI: 10.1104/pp.15.01543 ; PMID: 26463088
- Apoplastic Nucleoside Accumulation in Arabidopsis Leads to Reduced Photosynthetic Performance and Increased Susceptibility Against Botrytis cinerea. DOI: 10.3389/fpls.2015.01158 ; PMID: 26779190
- Mutation of the Glucosinolate Biosynthesis Enzyme Cytochrome P450 83A1 Monooxygenase Increases Camalexin Accumulation and Powdery Mildew Resistance. DOI: 10.3389/fpls.2016.00227 ; PMID: 26973671
- Gene expression and functional analyses in brassinosteroid-mediated stress tolerance. DOI: 10.1111/pbi.12396 ; PMID: 25973891
- The WRKY57 Transcription Factor Affects the Expression of Jasmonate ZIM-Domain Genes Transcriptionally to Compromise Botrytis cinerea Resistance. DOI: 10.1104/pp.16.00747 ; PMID: 27268959
- Arabidopsis HOOKLESS1 Regulates Responses to Pathogens and Abscisic Acid through Interaction with MED18 and Acetylation of WRKY33 and ABI5 Chromatin. DOI: 10.1105/tpc.16.00105 ; PMID: 27317674
- Establishment of Expression in the SHORTROOT-SCARECROW Transcriptional Cascade through Opposing Activities of Both Activators and Repressors. DOI: 10.1016/j.devcel.2016.09.031 ; PMID: 27923776
- Induced Genome-Wide Binding of Three Arabidopsis WRKY Transcription Factors during Early MAMP-Triggered Immunity. DOI: 10.1105/tpc.16.00681 ; PMID: 28011690
- Overexpression of oligouridylate binding protein 1b results in ABA hypersensitivity. DOI: 10.1080/15592324.2017.1282591 ; PMID: 28112571
- CORRECTION. DOI: 10.1105/tpc.17.00278 ; PMID: 28420747
- Botrytis cinerea B05.10 promotes disease development in Arabidopsis by suppressing WRKY33-mediated host immunity. DOI: 10.1111/pce.13022 ; PMID: 28708934
- Phospholipase C2 Affects MAMP-Triggered Immunity by Modulating ROS Production. DOI: 10.1104/pp.17.00173 ; PMID: 28827453
- Interactions of WRKY15 and WRKY33 transcription factors and their roles in the resistance of oilseed rape to Sclerotinia infection. DOI: 10.1111/pbi.12838 ; PMID: 28929638
- Determination of histone epigenetic marks in Arabidopsis and tomato genes in the early response to Botrytis cinerea. DOI: 10.1007/s00299-017-2218-9 ; PMID: 29119291
- Karrikin-KAI2 signalling provides Arabidopsis seeds with tolerance to abiotic stress and inhibits germination under conditions unfavourable to seedling establishment. DOI: 10.1111/nph.15192 ; PMID: 29726620
- A MPK3/6-WRKY33-ALD1-Pipecolic Acid Regulatory Loop Contributes to Systemic Acquired Resistance. DOI: 10.1105/tpc.18.00547 ; PMID: 30228125
- Mitochondrial function modulates touch signalling in Arabidopsis thaliana. DOI: 10.1111/tpj.14183 ; PMID: 30537160
- Regulation of GDSL Lipase Gene Expression by the MPK3/MPK6 Cascade and Its Downstream WRKY Transcription Factors in Arabidopsis Immunity. DOI: 10.1094/MPMI-06-18-0171-R ; PMID: 30598046
- Arabidopsis Endoplasmic Reticulum-Localized UBAC2 Proteins Interact with PAMP-INDUCED COILED-COIL to Regulate Pathogen-Induced Callose Deposition and Plant Immunity. DOI: 10.1105/tpc.18.00334 ; PMID: 30606781
- Integrated bioinformatics analysis of As, Au, Cd, Pb and Cu heavy metal responsive marker genes through Arabidopsis thaliana GEO datasets. DOI: 10.7717/peerj.6495 ; PMID: 30918749
- CYP707As are effectors of karrikin and strigolactone signalling pathways in Arabidopsis thaliana and parasitic plants. DOI: 10.1111/pce.13594 ; PMID: 31134630
- Expansion of a core regulon by transposable elements promotes Arabidopsis chemical diversity and pathogen defense. DOI: 10.1038/s41467-019-11406-3 ; PMID: 31371717
- Transcriptional regulation of nitrogen-associated metabolism and growth. DOI: 10.1038/s41586-018-0656-3 ; PMID: 30356219
- Novel connections in plant organellar signalling link different stress responses and signalling pathways. DOI: 10.1093/jxb/erw136 ; PMID: 27053718
- Comparison between the Transcriptomes of 'KDML105' Rice and a Salt-Tolerant Chromosome Segment Substitution Line. DOI: 10.3390/genes10100742 ; PMID: 31554292
- Transcriptome-wide identification of indole glucosinolate dependent flg22-response genes in Arabidopsis. DOI: 10.1016/j.bbrc.2019.09.110 ; PMID: 31604523
- Inactivation of UDP-Glucose Sterol Glucosyltransferases Enhances Arabidopsis Resistance to Botrytis cinerea. DOI: 10.3389/fpls.2019.01162 ; PMID: 31611892
- H2Bub1 Regulates RbohD-Dependent Hydrogen Peroxide Signal Pathway in the Defense Responses to Verticillium dahliae Toxins. DOI: 10.1104/pp.19.00913 ; PMID: 31666300
- PAMP-INDUCED SECRETED PEPTIDE 3 modulates immunity in Arabidopsis. DOI: 10.1093/jxb/erz482 ; PMID: 31665431
- Reactive oxygen species dosage in Arabidopsis chloroplasts can improve resistance towards Colletotrichum higginsianum by the induction of WRKY33. DOI: 10.1111/nph.16332 ; PMID: 31749193
- Hierarchical and Dynamic Regulation of Defense-Responsive Specialized Metabolism by WRKY and MYB Transcription Factors. DOI: 10.3389/fpls.2019.01775 ; PMID: 32082343
- Crosstalk between heterotrimeric G protein-coupled signaling pathways and WRKY transcription factors modulating plant responses to suboptimal micronutrient conditions. DOI: 10.1093/jxb/eraa108 ; PMID: 32107545
- Single-stranded oligodeoxynucleotides induce plant defence in Arabidopsis thaliana. DOI: 10.1093/aob/mcaa061 ; PMID: 32266377
- The Arabidopsis CCCH protein C3H14 contributes to basal defense against Botrytis cinerea mainly through the WRKY33-dependent pathway. DOI: 10.1111/pce.13771 ; PMID: 32279333
- Differential Phosphorylation of the Transcription Factor WRKY33 by the Protein Kinases CPK5/CPK6 and MPK3/MPK6 Cooperatively Regulates Camalexin Biosynthesis in Arabidopsis. DOI: 10.1105/tpc.19.00971 ; PMID: 32439826
- WRKY33-PIF4 loop is required for the regulation of H(2)O(2) homeostasis. DOI: 10.1016/j.bbrc.2020.05.041 ; PMID: 32423827
- Induction of γ-aminobutyric acid plays a positive role to Arabidopsis resistance against Pseudomonas syringae. DOI: 10.1111/jipb.12974 ; PMID: 32458527
- The Arabidopsis Pleiotropic Drug Resistance Transporters PEN3 and PDR12 Mediate Camalexin Secretion for Resistance to Botrytis cinerea. DOI: 10.1105/tpc.19.00239 ; PMID: 31239392
- Arabidopsis C-terminal binding protein ANGUSTIFOLIA modulates transcriptional co-regulation of MYB46 and WRKY33. DOI: 10.1111/nph.16826 ; PMID: 32706429
- Regulation of a Cytochrome P450 Gene CYP94B1 by WRKY33 Transcription Factor Controls Apoplastic Barrier Formation in Roots to Confer Salt Tolerance. DOI: 10.1104/pp.20.01054 ; PMID: 32928900
- Regulation of AtKUP2 Expression by bHLH and WRKY Transcription Factors Helps to Confer Increased Salt Tolerance to Arabidopsis thaliana Plants. DOI: 10.3389/fpls.2020.01311 ; PMID: 32983201
- WRKY33 interacts with WRKY12 protein to up-regulate RAP2.2 during submergence induced hypoxia response in Arabidopsis thaliana. DOI: 10.1111/nph.17020 ; PMID: 33098101
- The ubiquitin E3 ligase SR1 modulates the submergence response by degrading phosphorylated WRKY33 in Arabidopsis. DOI: 10.1093/plcell/koab062 ; PMID: 33616649
- SUMO enables substrate selectivity by mitogen-activated protein kinases to regulate immunity in plants. DOI: 10.1073/pnas.2021351118 ; PMID: 33649235
- Unrelated Fungal Rust Candidate Effectors Act on Overlapping Plant Functions. DOI: 10.3390/microorganisms9050996 ; PMID: 34063040
- Roles of Endogenous Melatonin in Resistance to Botrytis cinerea Infection in an Arabidopsis Model. DOI: 10.3389/fpls.2021.683228 ; PMID: 34234798
- Transcription Factor WRKY33 Mediates the Phosphate Deficiency-Induced Remodeling of Root Architecture by Modulating Iron Homeostasis in Arabidopsis Roots. DOI: 10.3390/ijms22179275 ; PMID: 34502184
- MPK3/MPK6-mediated phosphorylation of ERF72 positively regulates resistance to Botrytis cinerea through directly and indirectly activating the transcription of camalexin biosynthesis enzymes. DOI: 10.1093/jxb/erab415 ; PMID: 34499162
- A network of stress-related genes regulates hypocotyl elongation downstream of selective auxin perception. DOI: 10.1093/plphys/kiab269 ; PMID: 34618142
- Genome-wide dynamic network analysis reveals the potential genes for MeJA-induced growth-to-defense transition. DOI: 10.1186/s12870-021-03185-1 ; PMID: 34615468
- Root-specific CLE3 expression is required for WRKY33 activation in Arabidopsis shoots. DOI: 10.1007/s11103-021-01234-9 ; PMID: 35038066
- WRKY33-mediated indolic glucosinolate metabolic pathway confers resistance against Alternaria brassicicola in Arabidopsis and Brassica crops. DOI: 10.1111/jipb.13245 ; PMID: 35257500
- Phytocytokine signalling reopens stomata in plant immunity and water loss. DOI: 10.1038/s41586-022-04684-3 ; PMID: 35508659
- Multilayered synergistic regulation of phytoalexin biosynthesis by ethylene, jasmonate, and MAPK signaling pathways in Arabidopsis. DOI: 10.1093/plcell/koac139 ; PMID: 35543483
- New insights on the regulatory network of drought-responsive key genes in Arabidopsis thaliana. DOI: 10.1007/s10709-022-00177-3 ; PMID: 36474134
- Regulatory module WRKY33-ATL31-IRT1 mediates cadmium tolerance in Arabidopsis. DOI: 10.1111/pce.14558 ; PMID: 36738191
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- or PAMP-responsive WRKY transcription factor is regulated by a composite DNA motif containing W box elements. DOI: 10.1094/MPMI-20-4-0420 ; PMID: 17427812
- Identification of 118 Arabidopsis transcription factor and 30 ubiquitin-ligase genes responding to chitin, a plant-defense elicitor. DOI: 10.1094/MPMI-20-8-0900 ; PMID: 17722694
Sequences:
cDNA Sequence
- >AT2G38470.1
CTCTTCTTCATATGTGACCCTAAAAATAAAAACGAACAATTAAACAAAATTTTAAAATAATATAATATTCACCAATCAGACGTGCAATATGTTTTATATATTCAGACATAACCAACAAATATACAGAAACAAGAAGAAGAACAAGAACCATCACTTCTCTCATTTTCTTCTTCTCCAAGCCCCCCTCCTTTCTATATATATCTGAAATTGGTCTTTTATAAAACAAACTTCCATTTTTCGTATGGCTGCTTCTTTTCTTACAATGGACAATAGCAGAACCAGACAAAACATGAATGGTTCTGCTAATTGGTCACAACAATCCGGAAGAACATCTACTTCCTCTTTGGAAGATCTTGAGATACCAAAGTTCAGATCTTTTGCTCCTTCTTCAATCTCTATCTCTCCTTCTCTTGTCTCTCCTTCCACTTGTTTCAGTCCCTCTCTTTTTCTCGATTCCCCTGCTTTTGTCTCCTCCTCTGCTAACGTTCTAGCTTCTCCAACCACAGGAGCTTTAATCACAAACGTAACTAACCAGAAAGGTATAAATGAAGGAGACAAGAGCAACAACAACAACTTTAACTTATTCGATTTCTCATTCCACACACAATCATCAGGAGTTTCTGCTCCGACCACAACTACAACTACAACTACAACTACAACAACAACAAACAGTTCTATCTTTCAATCTCAGGAACAACAGAAGAAGAACCAGTCAGAACAATGGAGCCAAACCGAGACTCGTCCAAACAATCAAGCTGTATCTTACAATGGAAGAGAGCAAAGGAAAGGAGAGGATGGTTACAATTGGAGAAAGTACGGACAAAAACAGGTGAAAGGAAGTGAGAATCCTCGGAGTTACTATAAGTGTACTTTCCCTAATTGTCCAACGAAGAAGAAAGTGGAGAGATCTTTGGAAGGTCAGATCACAGAGATTGTGTATAAAGGAAGCCACAACCATCCTAAACCTCAGTCTACTAGAAGATCTTCTTCGTCTTCTTCGACTTTTCATTCAGCTGTGTACAATGCCAGTTTGGATCATAATCGTCAAGCTTCTTCTGATCAGCCTAATTCCAATAATAGCTTTCATCAGTCTGATTCCTTTGGGATGCAACAAGAGGATAATACTACTTCTGATTCTGTTGGTGACGATGAGTTCGAACAAGGCTCATCGATTGTCAGCAGAGACGAAGAAGATTGTGGGAGTGAACCTGAAGCAAAGAGATGGAAAGGGGACAATGAAACAAATGGTGGGAATGGTGGTGGAAGCAAGACAGTGAGAGAGCCGAGAATCGTAGTGCAGACAACGAGTGATATTGACATTCTTGACGACGGTTACAGATGGAGAAAATACGGCCAGAAAGTCGTTAAGGGAAACCCAAATCCAAGAAGCTACTACAAGTGCACAACCATCGGTTGTCCAGTGAGGAAACATGTGGAGAGAGCATCACACGACATGAGAGCAGTAATCACAACCTACGAAGGGAAACACAACCACGATGTTCCTGCAGCTCGTGGTAGCGGTTACGCCACAAACAGAGCACCACAGGATTCGTCTTCAGTCCCGATTAGACCAGCTGCTATTGCTGGTCACTCCAACTACACTACTTCTTCTCAAGCACCATATACACTTCAGATGCTGCACAACAACAACACTAATACCGGGCCTTTTGGTTACGCCATGAACAACAATAACAACAACAGCAACCTTCAAACGCAACAAAACTTTGTTGGTGGTGGATTCTCTAGAGCAAAGGAAGAACCAAACGAGGAGACCTCATTTTTCGATTCGTTTATGCCCTGAAGAAAAAAGGAACCAGTTGTTCCTTTTTTATGTTCCTTTTGTACATTTCTGCCACCAAAGGATTTTACTACTTACTAGTTATCCTGCAGGATAGTAAGTCAGACTTCTATAGTCCATAGAGAAATTTTTTCATTTGTTTTTTCACACGCCTGTAATATGTTTAATGTTTGTACTTTGTACCATAGAACTAGAACACGGAATAAAACCAATCAATTTTCAGTTTCTTC
CDS Sequence
- >AT2G38470.1
ATGGCTGCTTCTTTTCTTACAATGGACAATAGCAGAACCAGACAAAACATGAATGGTTCTGCTAATTGGTCACAACAATCCGGAAGAACATCTACTTCCTCTTTGGAAGATCTTGAGATACCAAAGTTCAGATCTTTTGCTCCTTCTTCAATCTCTATCTCTCCTTCTCTTGTCTCTCCTTCCACTTGTTTCAGTCCCTCTCTTTTTCTCGATTCCCCTGCTTTTGTCTCCTCCTCTGCTAACGTTCTAGCTTCTCCAACCACAGGAGCTTTAATCACAAACGTAACTAACCAGAAAGGTATAAATGAAGGAGACAAGAGCAACAACAACAACTTTAACTTATTCGATTTCTCATTCCACACACAATCATCAGGAGTTTCTGCTCCGACCACAACTACAACTACAACTACAACTACAACAACAACAAACAGTTCTATCTTTCAATCTCAGGAACAACAGAAGAAGAACCAGTCAGAACAATGGAGCCAAACCGAGACTCGTCCAAACAATCAAGCTGTATCTTACAATGGAAGAGAGCAAAGGAAAGGAGAGGATGGTTACAATTGGAGAAAGTACGGACAAAAACAGGTGAAAGGAAGTGAGAATCCTCGGAGTTACTATAAGTGTACTTTCCCTAATTGTCCAACGAAGAAGAAAGTGGAGAGATCTTTGGAAGGTCAGATCACAGAGATTGTGTATAAAGGAAGCCACAACCATCCTAAACCTCAGTCTACTAGAAGATCTTCTTCGTCTTCTTCGACTTTTCATTCAGCTGTGTACAATGCCAGTTTGGATCATAATCGTCAAGCTTCTTCTGATCAGCCTAATTCCAATAATAGCTTTCATCAGTCTGATTCCTTTGGGATGCAACAAGAGGATAATACTACTTCTGATTCTGTTGGTGACGATGAGTTCGAACAAGGCTCATCGATTGTCAGCAGAGACGAAGAAGATTGTGGGAGTGAACCTGAAGCAAAGAGATGGAAAGGGGACAATGAAACAAATGGTGGGAATGGTGGTGGAAGCAAGACAGTGAGAGAGCCGAGAATCGTAGTGCAGACAACGAGTGATATTGACATTCTTGACGACGGTTACAGATGGAGAAAATACGGCCAGAAAGTCGTTAAGGGAAACCCAAATCCAAGAAGCTACTACAAGTGCACAACCATCGGTTGTCCAGTGAGGAAACATGTGGAGAGAGCATCACACGACATGAGAGCAGTAATCACAACCTACGAAGGGAAACACAACCACGATGTTCCTGCAGCTCGTGGTAGCGGTTACGCCACAAACAGAGCACCACAGGATTCGTCTTCAGTCCCGATTAGACCAGCTGCTATTGCTGGTCACTCCAACTACACTACTTCTTCTCAAGCACCATATACACTTCAGATGCTGCACAACAACAACACTAATACCGGGCCTTTTGGTTACGCCATGAACAACAATAACAACAACAGCAACCTTCAAACGCAACAAAACTTTGTTGGTGGTGGATTCTCTAGAGCAAAGGAAGAACCAAACGAGGAGACCTCATTTTTCGATTCGTTTATGCCCTGA
Protein Sequence
- >AT2G38470.1
MAASFLTMDNSRTRQNMNGSANWSQQSGRTSTSSLEDLEIPKFRSFAPSSISISPSLVSPSTCFSPSLFLDSPAFVSSSANVLASPTTGALITNVTNQKGINEGDKSNNNNFNLFDFSFHTQSSGVSAPTTTTTTTTTTTTTNSSIFQSQEQQKKNQSEQWSQTETRPNNQAVSYNGREQRKGEDGYNWRKYGQKQVKGSENPRSYYKCTFPNCPTKKKVERSLEGQITEIVYKGSHNHPKPQSTRRSSSSSSTFHSAVYNASLDHNRQASSDQPNSNNSFHQSDSFGMQQEDNTTSDSVGDDEFEQGSSIVSRDEEDCGSEPEAKRWKGDNETNGGNGGGSKTVREPRIVVQTTSDIDILDDGYRWRKYGQKVVKGNPNPRSYYKCTTIGCPVRKHVERASHDMRAVITTYEGKHNHDVPAARGSGYATNRAPQDSSSVPIRPAAIAGHSNYTTSSQAPYTLQMLHNNNTNTGPFGYAMNNNNNNSNLQTQQNFVGGGFSRAKEEPNEETSFFDSFMP