Information report for AT2G38310
Gene Details
|
|
Functional Descriptions
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- GO:0005515 — enables — protein binding
- GO:0005737 — is active in — cytoplasm
- GO:0038023 — enables — signaling receptor activity
- GO:0009738 — involved in — abscisic acid-activated signaling pathway
- GO:0042803 — enables — protein homodimerization activity
- GO:0009738 — acts upstream of or within — abscisic acid-activated signaling pathway
- GO:0005886 — located in — plasma membrane
- GO:0004864 — enables — protein phosphatase inhibitor activity
- GO:0005737 — located in — cytoplasm
- GO:0009705 — located in — plant-type vacuole membrane
- GO:0010427 — enables — abscisic acid binding
- GO:0044389 — enables — ubiquitin-like protein ligase binding
- GO:0005634 — located in — nucleus
- GO:0005634 — is active in — nucleus
- CS2109976 — Wilty plant, low stature.
- CS2109977 — Wilty plant, low stature.
- CS2109978 — Wilty plant, low stature.
- CS2109979 — Wilty plant, low stature.
- CS72388 — strong abscisic acid (ABA) insensitivities in seed germination, root growth and ABA-induced gene expression; impaired ABA-induced stomatal closure and ABA inhibition of stomatal opening; delayed elevated-CO2 responses; high basal stomatal conductances at least partially due to significantly higher stomatal index and stomatal density
- CS72389 — abscisic acid (ABA) insensitivity; significantly higher stomatal index and stomatal density
- CS72391 — abscisic acid (ABA) insensitivity; significantly higher stomatal index and stomatal density
- CS72392 — abscisic acid (ABA) insensitivity; strongly reduced darkness-, reduced air humidity-, and O3-induced stomatal closure; altered CO2 response kinetics
Functional Keywords
Literature and News
- Transcriptome changes for Arabidopsis in response to salt, osmotic, and cold stress. DOI: 10.1104/pp.008532 ; PMID: 12481097
- Microarray analysis of E2Fa-DPa-overexpressing plants uncovers a cross-talking genetic network between DNA replication and nitrogen assimilation. DOI: 10.1242/jcs.00715 ; PMID: 12953064
- Inactivation of the chloroplast ATP synthase gamma subunit results in high non-photochemical fluorescence quenching and altered nuclear gene expression in Arabidopsis thaliana. DOI: 10.1074/jbc.M308435200 ; PMID: 14576160
- Regulators of PP2C phosphatase activity function as abscisic acid sensors. DOI: 10.1126/science.1172408 ; PMID: 19407143
- Abscisic acid inhibits type 2C protein phosphatases via the PYR/PYL family of START proteins. DOI: 10.1126/science.1173041 ; PMID: 19407142
- The AoPR10 promoter and certain endogenous PR10 genes respond to oxidative signals in Arabidopsis. DOI: 10.1111/j.1364-3703.2004.00244.x ; PMID: 20565619
- Jasmonate signaling involves the abscisic acid receptor PYL4 to regulate metabolic reprogramming in Arabidopsis and tobacco. DOI: 10.1073/pnas.1103010108 ; PMID: 21436041
- Global gene expression analysis of transgenic, mannitol-producing, and salt-tolerant Arabidopsis thaliana indicates widespread changes in abiotic and biotic stress-related genes. DOI: 10.1093/jxb/err130 ; PMID: 21821598
- Unique drought resistance functions of the highly ABA-induced clade A protein phosphatase 2Cs. DOI: 10.1104/pp.112.202408 ; PMID: 22829320
- PYRABACTIN RESISTANCE1-LIKE8 plays an important role for the regulation of abscisic acid signaling in root. DOI: 10.1104/pp.112.208678 ; PMID: 23370718
- The PYL4 A194T mutant uncovers a key role of PYR1-LIKE4/PROTEIN PHOSPHATASE 2CA interaction for abscisic acid signaling and plant drought resistance. DOI: 10.1104/pp.113.224162 ; PMID: 23864556
- channels through reactive oxygen species-mediated activation of Ca2+ channels at the plasma membrane of intact Arabidopsis guard cells. DOI: 10.1104/pp.113.219758 ; PMID: 23899646
- Interactions between soybean ABA receptors and type 2C protein phosphatases. DOI: 10.1007/s11103-013-0114-4 ; PMID: 23934343
- Difference in abscisic acid perception mechanisms between closure induction and opening inhibition of stomata. DOI: 10.1104/pp.113.223826 ; PMID: 23946352
- Targeted degradation of abscisic acid receptors is mediated by the ubiquitin ligase substrate adaptor DDA1 in Arabidopsis. DOI: 10.1105/tpc.113.122234 ; PMID: 24563205
- Constitutive production of nitric oxide leads to enhanced drought stress resistance and extensive transcriptional reprogramming in Arabidopsis. DOI: 10.1093/jxb/eru184 ; PMID: 24868034
- Hydrogen sulfide generated by L-cysteine desulfhydrase acts upstream of nitric oxide to modulate abscisic acid-dependent stomatal closure. DOI: 10.1104/pp.114.245373 ; PMID: 25266633
- C2-domain abscisic acid-related proteins mediate the interaction of PYR/PYL/RCAR abscisic acid receptors with the plasma membrane and regulate abscisic acid sensitivity in Arabidopsis. DOI: 10.1105/tpc.114.129973 ; PMID: 25465408
- Lipoxygenase-derived 9-hydro(pero)xides of linoleoylethanolamide interact with ABA signaling to arrest root development during Arabidopsis seedling establishment. DOI: 10.1111/tpj.12821 ; PMID: 25752187
- A link between magnesium-chelatase H subunit and sucrose nonfermenting 1 (SNF1)-related protein kinase SnRK2.6/OST1 in Arabidopsis guard cell signalling in response to abscisic acid. DOI: 10.1093/jxb/erv341 ; PMID: 26175350
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- A Putative PP2C-Encoding Gene Negatively Regulates ABA Signaling in Populus euphratica. DOI: 10.1371/journal.pone.0139466 ; PMID: 26431530
- Involvement of OST1 Protein Kinase and PYR/PYL/RCAR Receptors in Methyl Jasmonate-Induced Stomatal Closure in Arabidopsis Guard Cells. DOI: 10.1093/pcp/pcw102 ; PMID: 27354421
- FYVE1/FREE1 Interacts with the PYL4 ABA Receptor and Mediates Its Delivery to the Vacuolar Degradation Pathway. DOI: 10.1105/tpc.16.00178 ; PMID: 27495812
- Ubiquitin Ligases RGLG1 and RGLG5 Regulate Abscisic Acid Signaling by Controlling the Turnover of Phosphatase PP2CA. DOI: 10.1105/tpc.16.00364 ; PMID: 27577789
- The single-subunit RING-type E3 ubiquitin ligase RSL1 targets PYL4 and PYR1 ABA receptors in plasma membrane to modulate abscisic acid signaling. DOI: 10.1111/tpj.12708 ; PMID: 25330042
- Arabidopsis Transcription Factors SPL1 and SPL12 Confer Plant Thermotolerance at Reproductive Stage. DOI: 10.1016/j.molp.2017.03.010 ; PMID: 28400323
- Abscisic acid signaling is involved in regulating the mitogen-activated protein kinase cascade module, AIK1-MKK5-MPK6. DOI: 10.1080/15592324.2017.1321188 ; PMID: 28494202
- Reciprocal Regulation of the TOR Kinase and ABA Receptor Balances Plant Growth and Stress Response. DOI: 10.1016/j.molcel.2017.12.002 ; PMID: 29290610
- Glucose triggers stomatal closure mediated by basal signaling through HXK1 and PYR/RCAR receptors in Arabidopsis. DOI: 10.1093/jxb/ery024 ; PMID: 29444316
- Salt hypersensitive mutant 9, a nucleolar APUM23 protein, is essential for salt sensitivity in association with the ABA signaling pathway in Arabidopsis. DOI: 10.1186/s12870-018-1255-z ; PMID: 29490615
- Arabidopsis Duodecuple Mutant of PYL ABA Receptors Reveals PYL Repression of ABA-Independent SnRK2 Activity. DOI: 10.1016/j.celrep.2018.05.044 ; PMID: 29898403
- Abscisic Acid Receptors and Coreceptors Modulate Plant Water Use Efficiency and Water Productivity. DOI: 10.1104/pp.18.01238 ; PMID: 30886115
- Young seedlings adapt to stress by retaining starch and retarding growth through ABA-Dependent and -independent pathways in Arabidopsis. DOI: 10.1016/j.bbrc.2019.06.023 ; PMID: 31186142
- Arabidopsis ALIX Regulates Stomatal Aperture and Turnover of Abscisic Acid Receptors. DOI: 10.1105/tpc.19.00399 ; PMID: 31363038
- The role of Arabidopsis ABA receptors from the PYR/PYL/RCAR family in stomatal acclimation and closure signal integration. DOI: 10.1038/s41477-019-0490-0 ; PMID: 31451795
- RBR-Type E3 Ligases and the Ubiquitin-Conjugating Enzyme UBC26 Regulate Abscisic Acid Receptor Levels and Signaling. DOI: 10.1104/pp.19.00898 ; PMID: 31699847
- FRET kinase sensor development reveals SnRK2/OST1 activation by ABA but not by MeJA and high CO(2) during stomatal closure. DOI: 10.7554/eLife.56351 ; PMID: 32463362
- A point-to-point protein-protein interaction assay reveals the signaling interplays among plant hormones and environmental cues. DOI: 10.1002/pld3.228 ; PMID: 32490347
- The effect of ABRE BINDING FACTOR 4-mediated FYVE1 on salt stress tolerance in Arabidopsis. DOI: 10.1016/j.plantsci.2020.110489 ; PMID: 32540007
- Counteraction of ABA-Mediated Inhibition of Seed Germination and Seedling Establishment by ABA Signaling Terminator in Arabidopsis. DOI: 10.1016/j.molp.2020.06.011 ; PMID: 32619606
- CEPR2 phosphorylates and accelerates the degradation of PYR/PYLs in Arabidopsis. DOI: 10.1093/jxb/erz302 ; PMID: 31232446
- SINAT E3 Ubiquitin Ligases Mediate FREE1 and VPS23A Degradation to Modulate Abscisic Acid Signaling. DOI: 10.1105/tpc.20.00267 ; PMID: 32753431
- A ras-related small GTP-binding protein, RabE1c, regulates stomatal movements and drought stress responses by mediating the interaction with ABA receptors. DOI: 10.1016/j.plantsci.2021.110858 ; PMID: 33775364
- BAK1 plays contrasting roles in regulating abscisic acid-induced stomatal closure and abscisic acid-inhibited primary root growth in Arabidopsis. DOI: 10.1111/jipb.13257 ; PMID: 35352463
- AtEAU1 and AtEAU2, Two EAR Motif-Containing ABA Up-Regulated Novel Transcription Repressors Regulate ABA Response in Arabidopsis. DOI: 10.3390/ijms23169053 ; PMID: 36012319
- Cell type-specific proteomics uncovers a RAF15-SnRK2.6/OST1 kinase cascade in guard cells. DOI: 10.1111/jipb.13536 ; PMID: 37226855
- BIC2, a Cryptochrome Function Inhibitor, Is Involved in the Regulation of ABA Responses in Arabidopsis. DOI: 10.3390/plants12112220 ; PMID: 37299199
Gene Resources
- UniProt: A0A654F1B1
- EMBL: CACRSJ010000105, CACSHJ010000088, LR881467
- AlphaFoldDB: A0A654F1B1
- EnsemblPlants: AT2G38310.1
- Gramene: AT2G38310.1
- KEGG: ath:AT2G38310
- Orthologous matrix: AHVMSPN
- ExpressionAtlas: AT2G38310
- InterPro: IPR019587, IPR023393, IPR050279
- PANTHER: PTHR31213, PTHR31213:SF119
- SUPFAM: SSF55961
- Gene3D: 3.30.530.20
- OrthoDB: A0A654F1B1
- SWISS-MODEL: A0A654F1B1
- Conserved Domain Database: cd07821
Homologs
Sequences
cDNA Sequence
- >AT2G38310.1
CCCAATTAAAAATATCGTGTATAGAAAACAGTCAAGTCAACAACTATAGCAAGGGGCAAAACCGTAATTTCACAACAAGCAACTTGCTCGGTTTTTTCGTTATCACCACTCACATGAACTCTGCATTAAAAACTCTATCTCTCTCAAATCGAAAGGCACAGCCCAACTTTTCGCAAGTCGCTGTAAAGTTTGATTTGCTTCTTTTTATATACACACATACTTCTCCTCCATACACTTTCCTCTTCAATCCTCAGTTTTTTTTCTAAGCCCTAATACCATCTCAAAGAAGAGATCAAGATTTGAAATCAAGAAGACACCATTACTCAGATCAACATGCTTGCCGTTCACCGTCCTTCTTCCGCCGTATCAGACGGAGATTCCGTTCAGATTCCGATGATGATCGCGTCGTTTCAAAAACGTTTTCCTTCTCTCTCACGCGACTCCACGGCCGCTCGTTTTCACACACACGAGGTTGGTCCTAATCAGTGTTGCTCCGCCGTTATTCAAGAGATCTCCGCTCCAATCTCCACCGTTTGGTCCGTCGTACGCCGCTTTGATAACCCACAAGCTTACAAACACTTTCTCAAAAGCTGTAGCGTCATCGGCGGAGACGGCGATAACGTTGGTAGCCTCCGTCAAGTCCACGTCGTCTCTGGTCTCCCCGCCGCTAGCTCCACCGAGAGACTCGATATCCTCGACGACGAACGCCACGTCATCAGCTTCAGCGTTGTTGGTGGTGACCACCGGCTCTCTAACTACCGATCCGTAACGACCCTTCACCCTTCTCCGATCTCCGGGACCGTCGTTGTCGAGTCTTACGTCGTTGATGTTCCTCCAGGCAACACAAAGGAAGAGACTTGTGACTTCGTTGACGTTATCGTACGATGCAATCTTCAATCTCTTGCGAAAATAGCCGAGAATACTGCGGCTGAGAGCAAGAAGAAGATGTCTCTGTGATGAGTCTTTGTCGTTGTCGGGTAGTTTCGTTAGATCCGACGTCGTTTTCTAGATTTTTAGCCGTCGTGTGATCTATGTTTTTTCGGCTTATGTGTGAAAAAAAAGTTACATTAGTGAATTAATCTCTCATGCATATCATAATCCTTCTTTTAATTTTTGTATTTTACATATCCCATAAAGAACCGATTTGGATAGCCCTATTCCGGCTTTCACCACCCAAAGATAATAATATTCAAACTGAAAGAATGTGGTTGTGTTGTCCGCTAATTAAAAGTGTGATTTTCAAGTTTAATTAATCTTGTTTTTCTATAGTTTCATCAGAAAAAGCGTAAATGAAATGGTACAATATGATGTTCGACTCGGATGTATATTAACTCGTTACATTGAGTTGTTGGCCATCTAATGTGTGTAGATAAATTTACGTACGTATAAACAGCTTTTGTGAAATTCGACGATTTTTCTTAAAGGCAACTTTAAATTTG
CDS Sequence
- >AT2G38310.1
ATGCTTGCCGTTCACCGTCCTTCTTCCGCCGTATCAGACGGAGATTCCGTTCAGATTCCGATGATGATCGCGTCGTTTCAAAAACGTTTTCCTTCTCTCTCACGCGACTCCACGGCCGCTCGTTTTCACACACACGAGGTTGGTCCTAATCAGTGTTGCTCCGCCGTTATTCAAGAGATCTCCGCTCCAATCTCCACCGTTTGGTCCGTCGTACGCCGCTTTGATAACCCACAAGCTTACAAACACTTTCTCAAAAGCTGTAGCGTCATCGGCGGAGACGGCGATAACGTTGGTAGCCTCCGTCAAGTCCACGTCGTCTCTGGTCTCCCCGCCGCTAGCTCCACCGAGAGACTCGATATCCTCGACGACGAACGCCACGTCATCAGCTTCAGCGTTGTTGGTGGTGACCACCGGCTCTCTAACTACCGATCCGTAACGACCCTTCACCCTTCTCCGATCTCCGGGACCGTCGTTGTCGAGTCTTACGTCGTTGATGTTCCTCCAGGCAACACAAAGGAAGAGACTTGTGACTTCGTTGACGTTATCGTACGATGCAATCTTCAATCTCTTGCGAAAATAGCCGAGAATACTGCGGCTGAGAGCAAGAAGAAGATGTCTCTGTGA
Protein Sequence
- >AT2G38310.1
MLAVHRPSSAVSDGDSVQIPMMIASFQKRFPSLSRDSTAARFHTHEVGPNQCCSAVIQEISAPISTVWSVVRRFDNPQAYKHFLKSCSVIGGDGDNVGSLRQVHVVSGLPAASSTERLDILDDERHVISFSVVGGDHRLSNYRSVTTLHPSPISGTVVVESYVVDVPPGNTKEETCDFVDVIVRCNLQSLAKIAENTAAESKKKMSL