Gene Details:
- Gene ID: AT2G31880
- Gene Symbol: EVR, SOBIR1
- Gene Name: EVERSHED, SUPPRESSOR OF BIR1 1
- Description: Leucine-rich repeat protein kinase family protein;(source:Araport11)
- TAIR Accession: locus:2045228
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Plant Ontology Annotations:
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Gene Ontology:
- GO:0006468 — involved in — protein phosphorylation
- GO:0005777 — located in — peroxisome
- GO:0005515 — enables — protein binding
- GO:0005886 — located in — plasma membrane
- GO:0060862 — acts upstream of or within — negative regulation of floral organ abscission
- GO:0016301 — enables — kinase activity
- GO:0004674 — enables — protein serine/threonine kinase activity
- GO:0004713 — enables — protein tyrosine kinase activity
- GO:0004714 — enables — transmembrane receptor protein tyrosine kinase activity
- GO:0043068 — acts upstream of or within — positive regulation of programmed cell death
- GO:0031349 — acts upstream of or within — positive regulation of defense response
Germplasm Phenotype:
- CS2992 — morphological phenotype similar to wt; resistant to kanamycin
- CS69917 — Blocks the effect of the serk1-L326F mutation, and leads to floral organ abscission deficiency.
- CS860327 — No visible phenotype
- sobir1-1 — suppresses cell death and defense responses in bir1-1.
Function-related keywords:
- shoot axis apex , leaf lamina base , root , shoot system , plant embryo , vascular leaf , stamen , sepal , flower , inflorescence flower pedicel , cotyledon , petiole , hypocotyl , leaf apex , collective leaf structure , pollen
Literature:
- Diverse RNA viruses elicit the expression of common sets of genes in susceptible Arabidopsis thaliana plants. DOI: 10.1046/j.1365-313x.2003.01625.x ; PMID: 12535341
- Using mutant alleles to determine the structure and function of leucine-rich repeat receptor-like kinases. DOI: 10.1016/s1369-5266(03)00089-x ; PMID: 12972053
- Comprehensive comparison of auxin-regulated and brassinosteroid-regulated genes in Arabidopsis. DOI: 10.1104/pp.103.034736 ; PMID: 15047898
- Plant body weight-induced secondary growth in Arabidopsis and its transcription phenotype revealed by whole-transcriptome profiling. DOI: 10.1104/pp.104.038844 ; PMID: 15194820
- The transcriptional innate immune response to flg22. Interplay and overlap with Avr gene-dependent defense responses and bacterial pathogenesis. DOI: 10.1104/pp.103.036749 ; PMID: 15181213
- Phylogenetic profiling of the Arabidopsis thaliana proteome: what proteins distinguish plants from other organisms? DOI: 10.1186/gb-2004-5-8-r53 ; PMID: 15287975
- The WRKY70 transcription factor: a node of convergence for jasmonate-mediated and salicylate-mediated signals in plant defense. DOI: 10.1105/tpc.016980 ; PMID: 14742872
- A comprehensive structure-function analysis of Arabidopsis SNI1 defines essential regions and transcriptional repressor activity. DOI: 10.1105/tpc.105.039677 ; PMID: 16766691
- Gibberellin mobilizes distinct DELLA-dependent transcriptomes to regulate seed germination and floral development in Arabidopsis. DOI: 10.1104/pp.106.082289 ; PMID: 16920880
- Exploiting the wild crucifer Thlaspi arvense to identify conserved and novel genes expressed during a plant's response to cold stress. DOI: 10.1007/s11103-006-9080-4 ; PMID: 16972165
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Regulation of cell death and innate immunity by two receptor-like kinases in Arabidopsis. DOI: 10.1016/j.chom.2009.05.019 ; PMID: 19616764
- The EVERSHED receptor-like kinase modulates floral organ shedding in Arabidopsis. DOI: 10.1242/dev.041335 ; PMID: 20081191
- Probing the roles of LRR RLK genes in Arabidopsis thaliana roots using a custom T-DNA insertion set. DOI: 10.1007/s11103-011-9769-x ; PMID: 21431781
- Autophosphorylation profiling of Arabidopsis protein kinases using the cell-free system. DOI: 10.1016/j.phytochem.2011.02.029 ; PMID: 21477822
- CAST AWAY, a membrane-associated receptor-like kinase, inhibits organ abscission in Arabidopsis. DOI: 10.1104/pp.111.175224 ; PMID: 21628627
- Heterotrimeric G proteins serve as a converging point in plant defense signaling activated by multiple receptor-like kinases. DOI: 10.1104/pp.112.212431 ; PMID: 23424249
- Receptor-like kinase SOBIR1/EVR interacts with receptor-like proteins in plant immunity against fungal infection. DOI: 10.1073/pnas.1220015110 ; PMID: 23716655
- Arabidopsis receptor-like protein30 and receptor-like kinase suppressor of BIR1-1/EVERSHED mediate innate immunity to necrotrophic fungi. DOI: 10.1105/tpc.113.117010 ; PMID: 24104566
- Fungal endopolygalacturonases are recognized as microbe-associated molecular patterns by the arabidopsis receptor-like protein RESPONSIVENESS TO BOTRYTIS POLYGALACTURONASES1. DOI: 10.1104/pp.113.230698 ; PMID: 24259685
- Arabidopsis thaliana receptor-like protein AtRLP23 associates with the receptor-like kinase AtSOBIR1. DOI: 10.4161/psb.27937 ; PMID: 24525519
- Regulation of SOBIR1 accumulation and activation of defense responses in bir1-1 by specific components of ER quality control. DOI: 10.1111/tpj.12425 ; PMID: 24498907
- The Brassica napus receptor-like protein RLM2 is encoded by a second allele of the LepR3/Rlm2 blackleg resistance locus. DOI: 10.1111/pbi.12341 ; PMID: 25644479
- ER quality control components UGGT and STT3a are required for activation of defense responses in bir1-1. DOI: 10.1371/journal.pone.0120245 ; PMID: 25775181
- An Overdose of the Arabidopsis Coreceptor BRASSINOSTEROID INSENSITIVE1-ASSOCIATED RECEPTOR KINASE1 or Its Ectodomain Causes Autoimmunity in a SUPPRESSOR OF BIR1-1-Dependent Manner. DOI: 10.1104/pp.15.00537 ; PMID: 25944825
- Bacterial Outer Membrane Vesicles Induce Plant Immune Responses. DOI: 10.1094/MPMI-12-15-0270-R ; PMID: 26926999
- SOBIR1 contributes to non-host resistance to Magnaporthe oryzae in Arabidopsis. DOI: 10.1080/09168451.2016.1164586 ; PMID: 27023441
- An RLP23-SOBIR1-BAK1 complex mediates NLP-triggered immunity. DOI: 10.1038/nplants.2015.140 ; PMID: 27251392
- Loss-of-function of Arabidopsis receptor-like kinase BIR1 activates cell death and defense responses mediated by BAK1 and SOBIR1. DOI: 10.1111/nph.14072 ; PMID: 27400831
- HAESA and HAESA-LIKE2 activate organ abscission downstream of NEVERSHED and EVERSHED in Arabidopsis flowers. DOI: 10.4161/psb.29115 ; PMID: 25763490
- The Bacterial Effector AvrPto Targets the Regulatory Coreceptor SOBIR1 and Suppresses Defense Signaling Mediated by the Receptor-Like Protein Cf-4. DOI: 10.1094/MPMI-08-17-0203-FI ; PMID: 28876174
- Balance between Cytosolic and Chloroplast Translation Affects Leaf Variegation. DOI: 10.1104/pp.17.00673 ; PMID: 29142022
- SOBIR1 and AGB1 independently contribute to nonhost resistance to Pyricularia oryzae (syn. Magnaporthe oryzae) in Arabidopsis thaliana. DOI: 10.1080/09168451.2018.1498727 ; PMID: 30022707
- Kinase activity of SOBIR1 and BAK1 is required for immune signalling. DOI: 10.1111/mpp.12767 ; PMID: 30407725
- and BAK1-dependent recognition of elf18. DOI: 10.1111/mpp.12789 ; PMID: 30938041
- Hypermorphic SERK1 Mutations Function via a SOBIR1 Pathway to Activate Floral Abscission Signaling. DOI: 10.1104/pp.18.01328 ; PMID: 30975695
- Crystal structure of the leucine-rich repeat ectodomain of the plant immune receptor kinase SOBIR1. DOI: 10.1107/S2059798319005291 ; PMID: 31063151
- SOBIR1/EVR prevents precocious initiation of fiber differentiation during wood development through a mechanism involving BP and ERECTA. DOI: 10.1073/pnas.1807863116 ; PMID: 31444299
- Structure-Function Analysis of Immune Receptor AtRLP23 with Its Ligand nlp20 and Coreceptors AtSOBIR1 and AtBAK1. DOI: 10.1094/MPMI-09-18-0263-R ; PMID: 31237473
- The EDS1-PAD4-ADR1 node mediates Arabidopsis pattern-triggered immunity. DOI: 10.1038/s41586-021-03829-0 ; PMID: 34497423
- Genotyping-by-sequencing-based identification of Arabidopsis pattern recognition receptor RLP32 recognizing proteobacterial translation initiation factor IF1. DOI: 10.1038/s41467-022-28887-4 ; PMID: 35277499
- EXTRA LARGE G-PROTEIN2 mediates cell death and hyperimmunity in the chitin elicitor receptor kinase 1-4 mutant. DOI: 10.1093/plphys/kiac214 ; PMID: 35522044
- Structural analysis of receptor-like kinase SOBIR1 reveals mechanisms that regulate its phosphorylation-dependent activation. DOI: 10.1016/j.xplc.2022.100301 ; PMID: 35529948
- The RECEPTOR-LIKE PROTEIN53 immune complex associates with LLG1 to positively regulate plant immunity. DOI: 10.1111/jipb.13327 ; PMID: 35796320
- Necrosis and ethylene-inducing-like peptide patterns from crop pathogens induce differential responses within seven brassicaceous species. DOI: 10.1111/ppa.13615 ; PMID: 36605780
- A pair of G-type lectin receptor-like kinases modulates nlp20-mediated immune responses by coupling to the RLP23 receptor complex. DOI: 10.1111/jipb.13449 ; PMID: 36633200
- Botrytis cinerea BcCDI1 protein triggers both plant cell death and immune response. DOI: 10.3389/fpls.2023.1136463 ; PMID: 37180384
- Quantitative phosphoproteomics of early elicitor signaling in Arabidopsis. DOI: 10.1074/mcp.M600429-MCP200 ; PMID: 17317660
- A high content in lipid-modified peripheral proteins and integral receptor kinases features in the arabidopsis plasma membrane proteome. DOI: 10.1074/mcp.M700099-MCP200 ; PMID: 17644812
- A novel class of bacteria-induced small RNAs in Arabidopsis. DOI: 10.1101/gad.1595107 ; PMID: 18003861
Sequences:
cDNA Sequence
- >AT2G31880.1
AGAGTGTAGACTCCGACAACATCCACAAGAAGAAACTTTCTCTAATTAAAATGGCTGTTCCCACGGGAAGCGCCAATCTCTTTCTCCGGCCTCTCATCCTCGCCGTTCTCTCCTTTCTTCTTCTCTCTTCATTCGTCTCCTCTGTTGAGTGGCTCGATATCGATTCCTCAGATCTCAAAGCTCTTCAGGTCATCGAAACAGAGCTCGGAGTCAACAGTCAACGTTCTTCGGCCAGTGATGTCAACCCTTGCGGTCGCCGAGGAGTTTTCTGCGAGAGACGGCACTCTGCCACCACCGGAGAATACGTTCTCCGTGTCACGAGGCTCGTCTACCGATCCAGGAGCTTGACGGGGACTATCTCTCCGGTCATCGGAATGTTGTCGGAGCTCAAGGAACTTACTTTGTCTAATAACCAGTTGGTCAACGCTGTTCCGGTGGATATCTTAAGCTGTAAGCAACTTGAAGTTCTTGATCTTCGGAAAAATAGATTTTCCGGTCAGATTCCGGGAAACTTTTCTAGTTTGAGCCGTCTTCGAATCCTTGATCTCTCTTCGAACAAGTTATCCGGGAACTTGAATTTCTTGAAGAATCTACGCAATCTGGAGAATCTCTCTGTTGCAAACAATCTCTTCTCAGGCAAAATCCCGGAACAAATTGTGTCGTTCCACAATCTCCGGTTCTTTGATTTCTCCGGAAACCGGTATTTGGAAGGTCCGGCTCCGGTTATGAGCAGTATCAAGCTTCAGACATCTCCACATCAAACAAGACACATTCTTGCTGAAACTCCAACTTCAAGTCCCACGAACAAACCCAACAACAGCACTACATCAAAAGCTCCAAAGGGAGCTCCAAAACCAGGGAAGTTGAAGAAGAAGAAGAAGAAGAGCAAGAAGAAGAAAGTAGCGGCATGGATCTTAGGGTTTGTCGTTGGAGCCATAGGAGGAACAATCTCTGGGTTTGTCTTCTCGGTGTTGTTCAAATTGATTATTCAAGCAATAAGAGGATCAGAAAAACCACCAGGTCCTTCCATATTCAGCCCATTGATCAAGAAAGCTGAAGATTTAGCTTTCTTGGAGAATGAAGAAGCGTTAGCTTCTCTGGAGATCATAGGAAGAGGAGGTTGTGGAGAAGTTTTCAAAGCTGAACTACCAGGAAGCAATGGGAAGATCATAGCTGTGAAGAAAGTGATCCAACCGCCTAAAGACGCCGATGAACTAACAGATGAAGATTCCAAGTTTCTGAACAAGAAAATGAGGCAAATTAGATCCGAGATCAACACAGTCGGCCATATCCGGCACCGGAATCTTCTCCCATTGTTAGCACACGTGTCAAGACCCGAGTGCCACTACCTCGTTTACGAGTACATGGAAAAGGGGAGTTTGCAAGATATATTGACTGACGTACAAGCTGGAAATCAAGAACTAATGTGGCCAGCGAGGCACAAGATTGCTTTAGGTATAGCTGCAGGGCTTGAGTACCTTCACATGGATCATAACCCACGAATCATTCACAGAGACTTAAAGCCAGCCAATGTTCTTCTTGATGATGACATGGAAGCCAGAATTTCAGATTTCGGACTGGCAAAGGCAATGCCAGATGCAGTCACACATATTACAACCTCGCATGTTGCAGGTACTGTGGGATACATAGCACCAGAGTTTTATCAAACCCACAAGTTCACAGATAAATGTGATATCTATAGTTTTGGAGTGATTCTTGGGATTCTGGTGATTGGGAAGCTTCCTTCAGATGAGTTTTTTCAGCATACTGACGAGATGAGTCTGATAAAGTGGATGAGGAACATAATAACATCGGAAAATCCTAGCCTTGCGATTGATCCGAAGTTGATGGATCAAGGATTCGATGAACAGATGCTTCTGGTTCTGAAGATCGCCTGTTACTGTACTTTGGATGATCCAAAACAGAGGCCGAACAGTAAAGATGTCAGGACCATGTTGTCCCAGATCAAGCACTAGTGTTTCAATATGTATTGTTTGCTTCTATCTATATTTCCTAGATTCCTGTTGCATACGAAATAACTATGAACACAATCTTGGCAGAAATTTGTAATGGCGACTGTAAAATTTAAATGGATTTCAATTATGATT
CDS Sequence
- >AT2G31880.1
ATGGCTGTTCCCACGGGAAGCGCCAATCTCTTTCTCCGGCCTCTCATCCTCGCCGTTCTCTCCTTTCTTCTTCTCTCTTCATTCGTCTCCTCTGTTGAGTGGCTCGATATCGATTCCTCAGATCTCAAAGCTCTTCAGGTCATCGAAACAGAGCTCGGAGTCAACAGTCAACGTTCTTCGGCCAGTGATGTCAACCCTTGCGGTCGCCGAGGAGTTTTCTGCGAGAGACGGCACTCTGCCACCACCGGAGAATACGTTCTCCGTGTCACGAGGCTCGTCTACCGATCCAGGAGCTTGACGGGGACTATCTCTCCGGTCATCGGAATGTTGTCGGAGCTCAAGGAACTTACTTTGTCTAATAACCAGTTGGTCAACGCTGTTCCGGTGGATATCTTAAGCTGTAAGCAACTTGAAGTTCTTGATCTTCGGAAAAATAGATTTTCCGGTCAGATTCCGGGAAACTTTTCTAGTTTGAGCCGTCTTCGAATCCTTGATCTCTCTTCGAACAAGTTATCCGGGAACTTGAATTTCTTGAAGAATCTACGCAATCTGGAGAATCTCTCTGTTGCAAACAATCTCTTCTCAGGCAAAATCCCGGAACAAATTGTGTCGTTCCACAATCTCCGGTTCTTTGATTTCTCCGGAAACCGGTATTTGGAAGGTCCGGCTCCGGTTATGAGCAGTATCAAGCTTCAGACATCTCCACATCAAACAAGACACATTCTTGCTGAAACTCCAACTTCAAGTCCCACGAACAAACCCAACAACAGCACTACATCAAAAGCTCCAAAGGGAGCTCCAAAACCAGGGAAGTTGAAGAAGAAGAAGAAGAAGAGCAAGAAGAAGAAAGTAGCGGCATGGATCTTAGGGTTTGTCGTTGGAGCCATAGGAGGAACAATCTCTGGGTTTGTCTTCTCGGTGTTGTTCAAATTGATTATTCAAGCAATAAGAGGATCAGAAAAACCACCAGGTCCTTCCATATTCAGCCCATTGATCAAGAAAGCTGAAGATTTAGCTTTCTTGGAGAATGAAGAAGCGTTAGCTTCTCTGGAGATCATAGGAAGAGGAGGTTGTGGAGAAGTTTTCAAAGCTGAACTACCAGGAAGCAATGGGAAGATCATAGCTGTGAAGAAAGTGATCCAACCGCCTAAAGACGCCGATGAACTAACAGATGAAGATTCCAAGTTTCTGAACAAGAAAATGAGGCAAATTAGATCCGAGATCAACACAGTCGGCCATATCCGGCACCGGAATCTTCTCCCATTGTTAGCACACGTGTCAAGACCCGAGTGCCACTACCTCGTTTACGAGTACATGGAAAAGGGGAGTTTGCAAGATATATTGACTGACGTACAAGCTGGAAATCAAGAACTAATGTGGCCAGCGAGGCACAAGATTGCTTTAGGTATAGCTGCAGGGCTTGAGTACCTTCACATGGATCATAACCCACGAATCATTCACAGAGACTTAAAGCCAGCCAATGTTCTTCTTGATGATGACATGGAAGCCAGAATTTCAGATTTCGGACTGGCAAAGGCAATGCCAGATGCAGTCACACATATTACAACCTCGCATGTTGCAGGTACTGTGGGATACATAGCACCAGAGTTTTATCAAACCCACAAGTTCACAGATAAATGTGATATCTATAGTTTTGGAGTGATTCTTGGGATTCTGGTGATTGGGAAGCTTCCTTCAGATGAGTTTTTTCAGCATACTGACGAGATGAGTCTGATAAAGTGGATGAGGAACATAATAACATCGGAAAATCCTAGCCTTGCGATTGATCCGAAGTTGATGGATCAAGGATTCGATGAACAGATGCTTCTGGTTCTGAAGATCGCCTGTTACTGTACTTTGGATGATCCAAAACAGAGGCCGAACAGTAAAGATGTCAGGACCATGTTGTCCCAGATCAAGCACTAG
Protein Sequence
- >AT2G31880.1
MAVPTGSANLFLRPLILAVLSFLLLSSFVSSVEWLDIDSSDLKALQVIETELGVNSQRSSASDVNPCGRRGVFCERRHSATTGEYVLRVTRLVYRSRSLTGTISPVIGMLSELKELTLSNNQLVNAVPVDILSCKQLEVLDLRKNRFSGQIPGNFSSLSRLRILDLSSNKLSGNLNFLKNLRNLENLSVANNLFSGKIPEQIVSFHNLRFFDFSGNRYLEGPAPVMSSIKLQTSPHQTRHILAETPTSSPTNKPNNSTTSKAPKGAPKPGKLKKKKKKSKKKKVAAWILGFVVGAIGGTISGFVFSVLFKLIIQAIRGSEKPPGPSIFSPLIKKAEDLAFLENEEALASLEIIGRGGCGEVFKAELPGSNGKIIAVKKVIQPPKDADELTDEDSKFLNKKMRQIRSEINTVGHIRHRNLLPLLAHVSRPECHYLVYEYMEKGSLQDILTDVQAGNQELMWPARHKIALGIAAGLEYLHMDHNPRIIHRDLKPANVLLDDDMEARISDFGLAKAMPDAVTHITTSHVAGTVGYIAPEFYQTHKFTDKCDIYSFGVILGILVIGKLPSDEFFQHTDEMSLIKWMRNIITSENPSLAIDPKLMDQGFDEQMLLVLKIACYCTLDDPKQRPNSKDVRTMLSQIKH