Information report for AT2G27050
Gene Details
|
|
Functional Descriptions
- PO:0000037 — shoot axis apex — ápice del epiblasto (epiblastema) (Spanish, exact), シュート頂、茎頂 (Japanese, exact)
- PO:0008019 — leaf lamina base — base de la lámina de la hoja (Spanish, exact), 葉身基部 (Japanese, exact)
- PO:0009005 — root — raíz (Spanish, exact), radices (exact, plural), radix (exact), 根 (Japanese, exact), aerial root (narrow), climbing root (narrow)
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009025 — vascular leaf — foliage leaf (exact), hoja vascular (Spanish, exact), leaf, vascular (exact), vascular leaves (exact, plural), 維管束のある葉, または維管束植物の葉 (Japanese, exact), crozier (related), macrophyll (related), megaphyll (related), ascidia (narrow), ascidium (narrow), fiddlehead (narrow), frond (narrow), needle-like leaf (narrow), pitcher (narrow), pitcher blade (narrow), pitcher-blade (narrow), scale-like leaf (narrow), sterile frond (narrow), trophophyll (narrow)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009031 — sepal — sépalo (Spanish, exact), がく片 (Japanese, exact)
- PO:0009046 — flower — flor (Spanish, exact), 花 (Japanese, exact), floret (related), Asteraceae floret (narrow), basal flower (narrow), double flower (narrow), hermaphrodite flower (narrow), monoclinous flower (narrow), perfect flower (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0009970 — acts upstream of or within — cellular response to sulfate starvation
- GO:0000976 — enables — transcription cis-regulatory region binding
- GO:0009873 — acts upstream of or within — ethylene-activated signaling pathway
- GO:0042742 — acts upstream of or within — defense response to bacterium
- GO:0005622 — located in — intracellular anatomical structure
- GO:0005515 — enables — protein binding
- GO:0009723 — acts upstream of or within — response to ethylene
- GO:0005634 — located in — nucleus
- GO:0003677 — enables — DNA binding
Functional Keywords
Literature and News
- Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. DOI: 10.1016/s0092-8674(00)80300-1 ; PMID: 9215635
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Cloning of a cDNA encoding EIN3-like protein (DC-EIL1) and decrease in its mRNA level during senescence in carnation flower tissues. DOI: NA ; PMID: 11283184
- Five components of the ethylene-response pathway identified in a screen for weak ethylene-insensitive mutants in Arabidopsis. DOI: 10.1073/pnas.0438070100 ; PMID: 12606727
- Plant responses to ethylene gas are mediated by SCF(EBF1/EBF2)-dependent proteolysis of EIN3 transcription factor. DOI: 10.1016/s0092-8674(03)00969-3 ; PMID: 14675532
- Possible role of light in the maintenance of EIN3/EIL1 stability in Arabidopsis seedlings. DOI: 10.1016/j.bbrc.2006.09.074 ; PMID: 17011517
- The Arabidopsis EIN3 binding F-Box proteins EBF1 and EBF2 have distinct but overlapping roles in ethylene signaling. DOI: 10.1105/tpc.106.048140 ; PMID: 17307926
- Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. DOI: 10.1104/pp.108.121038 ; PMID: 18650403
- Transcriptome analyses show changes in gene expression to accompany pollen germination and tube growth in Arabidopsis. DOI: 10.1104/pp.108.126375 ; PMID: 18775970
- ETHYLENE INSENSITIVE3 and ETHYLENE INSENSITIVE3-LIKE1 repress SALICYLIC ACID INDUCTION DEFICIENT2 expression to negatively regulate plant innate immunity in Arabidopsis. DOI: 10.1105/tpc.108.065193 ; PMID: 19717619
- EIN3/EIL1 cooperate with PIF1 to prevent photo-oxidation and to promote greening of Arabidopsis seedlings. DOI: 10.1073/pnas.0907670106 ; PMID: 19948955
- Ethylene signalling and ethylene-targeted transcription factors are required to balance beneficial and nonbeneficial traits in the symbiosis between the endophytic fungus Piriformospora indica and Arabidopsis thaliana. DOI: 10.1111/j.1469-8137.2009.03149.x ; PMID: 20085621
- Direct transcriptional control of the Arabidopsis immune receptor FLS2 by the ethylene-dependent transcription factors EIN3 and EIL1. DOI: 10.1073/pnas.1003347107 ; PMID: 20663954
- Ethylene-induced stabilization of ETHYLENE INSENSITIVE3 and EIN3-LIKE1 is mediated by proteasomal degradation of EIN3 binding F-box 1 and 2 that requires EIN2 in Arabidopsis. DOI: 10.1105/tpc.110.076588 ; PMID: 20647342
- Ethylene and nitric oxide involvement in the up-regulation of key genes related to iron acquisition and homeostasis in Arabidopsis. DOI: 10.1093/jxb/erq203 ; PMID: 20627899
- Ethylene suppression of sugar-induced anthocyanin pigmentation in Arabidopsis. DOI: 10.1104/pp.110.161869 ; PMID: 20876338
- Interaction between the bHLH transcription factor FIT and ETHYLENE INSENSITIVE3/ETHYLENE INSENSITIVE3-LIKE1 reveals molecular linkage between the regulation of iron acquisition and ethylene signaling in Arabidopsis. DOI: 10.1105/tpc.111.084715 ; PMID: 21586684
- EIN2 regulates salt stress response and interacts with a MA3 domain-containing protein ECIP1 in Arabidopsis. DOI: 10.1111/j.1365-3040.2011.02363.x ; PMID: 21631530
- Derepression of ethylene-stabilized transcription factors (EIN3/EIL1) mediates jasmonate and ethylene signaling synergy in Arabidopsis. DOI: 10.1073/pnas.1103959108 ; PMID: 21737749
- An AP2 domain-containing gene, ESE1, targeted by the ethylene signaling component EIN3 is important for the salt response in Arabidopsis. DOI: 10.1104/pp.111.179028 ; PMID: 21832142
- Coordinated regulation of apical hook development by gibberellins and ethylene in etiolated Arabidopsis seedlings. DOI: 10.1038/cr.2012.29 ; PMID: 22349459
- Arabidopsis RAP2.2 plays an important role in plant resistance to Botrytis cinerea and ethylene responses. DOI: 10.1111/j.1469-8137.2012.04160.x ; PMID: 22530619
- Transcriptome analysis of ein3 eil1 mutants in response to iron deficiency. DOI: 10.4161/psb.6.11.17847 ; PMID: 22212120
- Ethylene signaling negatively regulates freezing tolerance by repressing expression of CBF and type-A ARR genes in Arabidopsis. DOI: 10.1105/tpc.112.098640 ; PMID: 22706288
- A survey of dominant mutations in Arabidopsis thaliana. DOI: 10.1016/j.tplants.2012.08.006 ; PMID: 22995285
- The nitrate transporter NRT2.1 functions in the ethylene response to nitrate deficiency in Arabidopsis. DOI: 10.1111/pce.12062 ; PMID: 23305042
- GDSL LIPASE1 modulates plant immunity through feedback regulation of ethylene signaling. DOI: 10.1104/pp.113.225649 ; PMID: 24170202
- The Arabidopsis Mediator subunit MED16 regulates iron homeostasis by associating with EIN3/EIL1 through subunit MED25. DOI: 10.1111/tpj.12440 ; PMID: 24456400
- Interaction between MYC2 and ETHYLENE INSENSITIVE3 modulates antagonism between jasmonate and ethylene signaling in Arabidopsis. DOI: 10.1105/tpc.113.120394 ; PMID: 24399301
- Ethylene plays an essential role in the recovery of Arabidopsis during post-anaerobiosis reoxygenation. DOI: 10.1111/pce.12292 ; PMID: 24506560
- Promoter-based integration in plant defense regulation. DOI: 10.1104/pp.114.248716 ; PMID: 25352272
- Salt-induced stabilization of EIN3/EIL1 confers salinity tolerance by deterring ROS accumulation in Arabidopsis. DOI: 10.1371/journal.pgen.1004664 ; PMID: 25330213
- The Arabidopsis ethylene/jasmonic acid-NRT signaling module coordinates nitrate reallocation and the trade-off between growth and environmental adaptation. DOI: 10.1105/tpc.114.129296 ; PMID: 25326291
- An Arabidopsis gene regulatory network for secondary cell wall synthesis. DOI: 10.1038/nature14099 ; PMID: 25533953
- Arabidopsis ROOT HAIR DEFECTIVE3 is involved in nitrogen starvation-induced anthocyanin accumulation. DOI: 10.1111/jipb.12320 ; PMID: 25494721
- PHYTOCHROME-INTERACTING FACTOR 5 (PIF5) positively regulates dark-induced senescence and chlorophyll degradation in Arabidopsis. DOI: 10.1016/j.plantsci.2015.05.010 ; PMID: 26089152
- EIN3 and ORE1 Accelerate Degreening during Ethylene-Mediated Leaf Senescence by Directly Activating Chlorophyll Catabolic Genes in Arabidopsis. DOI: 10.1371/journal.pgen.1005399 ; PMID: 26218222
- Endogenous Arabidopsis messenger RNAs transported to distant tissues. DOI: 10.1038/nplants.2015.25 ; PMID: 27247031
- Quantitative and Functional Phosphoproteomic Analysis Reveals that Ethylene Regulates Water Transport via the C-Terminal Phosphorylation of Aquaporin PIP2;1 in Arabidopsis. DOI: 10.1016/j.molp.2015.10.001 ; PMID: 26476206
- Synergistic action of histone acetyltransferase GCN5 and receptor CLAVATA1 negatively affects ethylene responses in Arabidopsis thaliana. DOI: 10.1093/jxb/erv503 ; PMID: 26596766
- Activation of HLS1 by Mechanical Stress via Ethylene-Stabilized EIN3 Is Crucial for Seedling Soil Emergence. DOI: 10.3389/fpls.2016.01571 ; PMID: 27822221
- Ethylene Improves Root System Development under Cadmium Stress by Modulating Superoxide Anion Concentration in Arabidopsis thaliana. DOI: 10.3389/fpls.2017.00253 ; PMID: 28286514
- Ethylene promotes root hair growth through coordinated EIN3/EIL1 and RHD6/RSL1 activity in Arabidopsis. DOI: 10.1073/pnas.1711723115 ; PMID: 29233944
- Identification of Transcriptional and Receptor Networks That Control Root Responses to Ethylene. DOI: 10.1104/pp.17.00907 ; PMID: 29259106
- Genome-wide regulation of light-controlled seedling morphogenesis by three families of transcription factors. DOI: 10.1073/pnas.1803861115 ; PMID: 29844157
- ERF72 interacts with ARF6 and BZR1 to regulate hypocotyl elongation in Arabidopsis. DOI: 10.1093/jxb/ery220 ; PMID: 29897568
- Integrated Regulation of Apical Hook Development by Transcriptional Coupling of EIN3/EIL1 and PIFs in Arabidopsis. DOI: 10.1105/tpc.18.00018 ; PMID: 30104405
- Sucrose Signaling Regulates Anthocyanin Biosynthesis Through a MAPK Cascade in Arabidopsis thaliana. DOI: 10.1534/genetics.118.301470 ; PMID: 30143593
- Jasmonate promotes auxin-induced adventitious rooting in dark-grown Arabidopsis thaliana seedlings and stem thin cell layers by a cross-talk with ethylene signalling and a modulation of xylogenesis. DOI: 10.1186/s12870-018-1392-4 ; PMID: 30189848
- Shaping Ethylene Response: The Role of EIN3/EIL1 Transcription Factors. DOI: 10.3389/fpls.2019.01030 ; PMID: 31507622
- Salicylic Acid Suppresses Apical Hook Formation via NPR1-Mediated Repression of EIN3 and EIL1 in Arabidopsis. DOI: 10.1105/tpc.19.00658 ; PMID: 31888966
- ETHYLENE INSENSITIVE 3 suppresses plant de novo root regeneration from leaf explants and mediates age-regulated regeneration decline. DOI: 10.1242/dev.179457 ; PMID: 32291272
- Target of Rapamycin (TOR) Negatively Regulates Ethylene Signals in Arabidopsis. DOI: 10.3390/ijms21082680 ; PMID: 32290539
- Diverse contributions of MYC2 and EIN3 in the regulation of Arabidopsis jasmonate-responsive gene expression. DOI: 10.1002/pld3.15 ; PMID: 31245664
- A Salt-Signaling Network Involving Ethylene, Extracellular ATP, Hydrogen Peroxide, and Calcium Mediates K(+)/Na(+) Homeostasis in Arabidopsis. DOI: 10.3390/ijms21228683 ; PMID: 33213111
- Salicylic acid and ethylene coordinately promote leaf senescence. DOI: 10.1111/jipb.13074 ; PMID: 33501782
- Ethylene and salicylic acid synergistically accelerate leaf senescence in Arabidopsis. DOI: 10.1111/jipb.13075 ; PMID: 33501715
- The Transcription Factor EIL1 Participates in the Regulation of Sulfur-Deficiency Response. DOI: 10.1104/pp.20.01192 ; PMID: 33060195
- The RING E3 ligase SDIR1 destabilizes EBF1/EBF2 and modulates the ethylene response to ambient temperature fluctuations in Arabidopsis. DOI: 10.1073/pnas.2024592118 ; PMID: 33526703
- GENOMES UNCOUPLED1-independent retrograde signaling targets the ethylene pathway to repress photomorphogenesis. DOI: 10.1093/plphys/kiaa015 ; PMID: 33631804
- Tuning self-renewal in the Arabidopsis stomatal lineage by hormone and nutrient regulation of asymmetric cell division. DOI: 10.7554/eLife.63335 ; PMID: 33739283
- Influence of Ethylene Signaling in the Crosstalk Between Fe, S, and P Deficiency Responses in Arabidopsis thaliana. DOI: 10.3389/fpls.2021.643585 ; PMID: 33859661
- Interaction between BZR1 and EIN3 mediates signalling crosstalk between brassinosteroids and ethylene. DOI: 10.1111/nph.17694 ; PMID: 34449890
- Cytokinin regulates apical hook development via the coordinated actions of EIN3/EIL1 and PIF transcription factors in Arabidopsis. DOI: 10.1093/jxb/erab403 ; PMID: 34459884
- Lack of ethylene does not affect reproductive success and synergid cell death in Arabidopsis. DOI: 10.1016/j.molp.2021.11.001 ; PMID: 34740849
- CLE42 delays leaf senescence by antagonizing ethylene pathway in Arabidopsis. DOI: 10.1111/nph.18154 ; PMID: 35396726
- A molecular framework for signaling crosstalk between jasmonate and ethylene in anthocyanin biosynthesis, trichome development, and defenses against insect herbivores in Arabidopsis. DOI: 10.1111/jipb.13319 ; PMID: 35763421
- Ethylene Plays a Dual Role during Infection by Plasmodiophora brassicae of Arabidopsis thaliana. DOI: 10.3390/genes13081299 ; PMID: 35893035
- The C-Terminal Region of SLIM1 Transcription Factor Is Required for Sulfur Deficiency Response. DOI: 10.3390/plants11192595 ; PMID: 36235462
- Ethylene Activates the EIN2-EIN3/EIL1 Signaling Pathway in Tapetum and Disturbs Anther Development in Arabidopsis. DOI: 10.3390/cells11193177 ; PMID: 36231139
- Brassinosteroids promote etiolated apical structures in darkness by amplifying the ethylene response via the EBF-EIN3/PIF3 circuit. DOI: 10.1093/plcell/koac316 ; PMID: 36321994
- The AP2 transcription factors TOE1/TOE2 convey Arabidopsis age information to ethylene signaling in plant de novo root regeneration. DOI: 10.1007/s00425-022-04034-7 ; PMID: 36409377
- ETHYLENE INSENSITIVE3/EIN3-LIKE1 modulate FLOWERING LOCUS C expression via histone demethylase interaction. DOI: 10.1093/plphys/kiad131 ; PMID: 36852894
- Arabidopsis EIN2 represses ABA responses during germination and early seedling growth by inactivating HLS1 protein independently of the canonical ethylene pathway. DOI: 10.1111/tpj.16335 ; PMID: 37269223
- Activation of the ethylene gas response pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related proteins. DOI: 10.1016/s0092-8674(00)80300-1 ; PMID: 9215635
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Five components of the ethylene-response pathway identified in a screen for weak ethylene-insensitive mutants in Arabidopsis. DOI: 10.1073/pnas.0438070100 ; PMID: 12606727
- Expression pattern shifts following duplication indicative of subfunctionalization and neofunctionalization in regulatory genes of Arabidopsis. DOI: 10.1093/molbev/msj051 ; PMID: 16280546
Gene Resources
Homologs
- Brassica napus GSBRNA2T00066199001, GSBRNA2T00138800001
- Brassica oleracea XP_013629560.1, XP_013629559.1, XP_013629558.1
- Brassica rapa XP_009133918.1, XP_009133916.1, XP_009133915.1, XP_009133914.1
- Raphanus raphanistrum RrC18987_p1
Sequences
cDNA Sequence
- >AT2G27050.1
TGCTCATTTATTTATTATATATTTTGGAAAAAAGTGAGAAAAAACTGAAACGGTGCGACGTTATTAAATCTTTTAAATCCCCCCACCAAAGCATCTGCTTCTTCCTCTTGTCTCTCTCTCTCTCTCTCTCTCTTTCATCTTCAAACTCTACAAACCCAGAAACCACCACACAGTAATTAATGTCTCTTTCTTTCTTCCCATGTGATCTTTAACAGACTTTTCTTCTTATTCTCCATCTCTGAAGTTGTGGGGATTCATCAAGACTTCCTTATCTGTTTCTTTTATAAAACAAGAGAGAGATACCACTTTTGGTGTTCTTTATTTGCAACTCTTTCAGGTTAAAGAAATCGATAGGCTCTGTTCTTGATTGTGGTGGAAGAGACATGATGATGTTTAACGAGATGGGAATGTATGGAAACATGGATTTCTTCTCTTCCTCCACATCTCTCGATGTGTGTCCATTACCACAAGCTGAACAAGAACCTGTAGTTGAAGATGTCGACTACACCGATGATGAGATGGATGTGGATGAGCTTGAGAAGAGGATGTGGAGAGACAAAATGCGTTTGAAACGTCTCAAGGAGCAACAGAGTAAGTGTAAAGAAGGCGTCGATGGTTCGAAACAGAGGCAGTCGCAAGAGCAAGCTAGGAGGAAGAAAATGTCTAGAGCCCAAGATGGGATCTTGAAGTATATGTTGAAGATGATGGAAGTTTGTAAAGCTCAAGGCTTTGTTTATGGTATTATTCCTGAGAAGGGTAAGCCTGTGACTGGTGCTTCGGATAATTTGAGGGAATGGTGGAAAGATAAGGTTAGGTTTGATCGTAATGGTCCAGCTGCTATTGCTAAGTATCAGTCAGAGAATAATATTTCTGGAGGGAGTAATGATTGTAACAGCTTGGTTGGTCCAACACCGCATACGCTTCAGGAGCTTCAGGACACGACTCTTGGTTCGCTTTTATCGGCTTTGATGCAACATTGTGATCCACCGCAGAGACGGTTTCCTTTGGAGAAAGGAGTTTCTCCACCTTGGTGGCCTAATGGGAATGAAGAGTGGTGGCCTCAGCTTGGTTTACCAAATGAGCAAGGTCCTCCTCCTTATAAGAAGCCTCATGATTTGAAGAAAGCTTGGAAAGTCGGTGTTTTAACTGCGGTGATCAAGCATATGTCGCCGGATATTGCGAAGATCCGTAAGCTTGTGAGGCAATCAAAATGCTTGCAGGATAAGATGACGGCGAAAGAGAGTGCTACTTGGCTTGCCATTATTAACCAAGAAGAGGTTGTGGCTCGGGAGCTTTATCCCGAGTCATGCCCTCCTCTTTCTTCTTCTTCATCATTAGGAAGCGGGTCGCTTCTCATTAATGATTGTAGCGAGTATGACGTTGAAGGTTTCGAGAAGGAACAACATGGTTTCGATGTGGAAGAGCGGAAACCAGAGATAGTGATGATGCATCCTCTAGCAAGCTTTGGGGTTGCTAAAATGCAACATTTTCCCATAAAGGAGGAGGTCGCCACCACGGTAAACTTAGAGTTCACGAGAAAGAGGAAGCAGAACAATGATATGAATGTTATGGTAATGGACAGATCAGCAGGTTACACTTGTGAGAATGGTCAGTGTCCTCACAGCAAAATGAATCTTGGATTTCAAGACAGGAGTTCAAGGGACAACCACCAGATGGTTTGTCCATATAGAGACAATCGTTTAGCGTATGGAGCATCCAAGTTTCATATGGGTGGAATGAAACTAGTAGTTCCTCAGCAACCAGTCCAACCGATCGACCTATCGGGCGTTGGAGTTCCGGAAAACGGGCAGAAGATGATCACCGAGCTTATGGCCATGTACGACAGAAATGTCCAAAGCAACCAAACGCCTCCTACTTTGATGGAAAACCAAAGCATGGTCATTGATGCAAAAGCAGCTCAGAATCAGCAGCTGAATTTCAACAGTGGCAATCAAATGTTTATGCAACAAGGGACGAACAACGGGGTTAACAATCGGTTCCAGATGGTGTTTGATTCGACACCATTCGATATGGCAGCATTCGATTACAGAGATGATTGGCAAACCGGAGCAATGGAAGGAATGGGGAAGCAGCAGCAGCAGCAGCAGCAGCAGCAAGATGTATCAATATGGTTCTGAATATTACACAATCTCTGTAACATTCATTCTTTCATAATAACTCTGTTACCTACTTACCTGACTTGGGTATGTATTCTATTGGCACCAAACACTCATCTATATTGTTGATGATGATGAAGCCATCTATTTTTTTTGTGTCTGAAAGTCATTTAACTCGCTTCATTGTTTTAATAATGTCACTATCCATTGAACATCATTCTCATGCTACAAGTTTGATTCTTTGAG
CDS Sequence
- >AT2G27050.1
ATGATGATGTTTAACGAGATGGGAATGTATGGAAACATGGATTTCTTCTCTTCCTCCACATCTCTCGATGTGTGTCCATTACCACAAGCTGAACAAGAACCTGTAGTTGAAGATGTCGACTACACCGATGATGAGATGGATGTGGATGAGCTTGAGAAGAGGATGTGGAGAGACAAAATGCGTTTGAAACGTCTCAAGGAGCAACAGAGTAAGTGTAAAGAAGGCGTCGATGGTTCGAAACAGAGGCAGTCGCAAGAGCAAGCTAGGAGGAAGAAAATGTCTAGAGCCCAAGATGGGATCTTGAAGTATATGTTGAAGATGATGGAAGTTTGTAAAGCTCAAGGCTTTGTTTATGGTATTATTCCTGAGAAGGGTAAGCCTGTGACTGGTGCTTCGGATAATTTGAGGGAATGGTGGAAAGATAAGGTTAGGTTTGATCGTAATGGTCCAGCTGCTATTGCTAAGTATCAGTCAGAGAATAATATTTCTGGAGGGAGTAATGATTGTAACAGCTTGGTTGGTCCAACACCGCATACGCTTCAGGAGCTTCAGGACACGACTCTTGGTTCGCTTTTATCGGCTTTGATGCAACATTGTGATCCACCGCAGAGACGGTTTCCTTTGGAGAAAGGAGTTTCTCCACCTTGGTGGCCTAATGGGAATGAAGAGTGGTGGCCTCAGCTTGGTTTACCAAATGAGCAAGGTCCTCCTCCTTATAAGAAGCCTCATGATTTGAAGAAAGCTTGGAAAGTCGGTGTTTTAACTGCGGTGATCAAGCATATGTCGCCGGATATTGCGAAGATCCGTAAGCTTGTGAGGCAATCAAAATGCTTGCAGGATAAGATGACGGCGAAAGAGAGTGCTACTTGGCTTGCCATTATTAACCAAGAAGAGGTTGTGGCTCGGGAGCTTTATCCCGAGTCATGCCCTCCTCTTTCTTCTTCTTCATCATTAGGAAGCGGGTCGCTTCTCATTAATGATTGTAGCGAGTATGACGTTGAAGGTTTCGAGAAGGAACAACATGGTTTCGATGTGGAAGAGCGGAAACCAGAGATAGTGATGATGCATCCTCTAGCAAGCTTTGGGGTTGCTAAAATGCAACATTTTCCCATAAAGGAGGAGGTCGCCACCACGGTAAACTTAGAGTTCACGAGAAAGAGGAAGCAGAACAATGATATGAATGTTATGGTAATGGACAGATCAGCAGGTTACACTTGTGAGAATGGTCAGTGTCCTCACAGCAAAATGAATCTTGGATTTCAAGACAGGAGTTCAAGGGACAACCACCAGATGGTTTGTCCATATAGAGACAATCGTTTAGCGTATGGAGCATCCAAGTTTCATATGGGTGGAATGAAACTAGTAGTTCCTCAGCAACCAGTCCAACCGATCGACCTATCGGGCGTTGGAGTTCCGGAAAACGGGCAGAAGATGATCACCGAGCTTATGGCCATGTACGACAGAAATGTCCAAAGCAACCAAACGCCTCCTACTTTGATGGAAAACCAAAGCATGGTCATTGATGCAAAAGCAGCTCAGAATCAGCAGCTGAATTTCAACAGTGGCAATCAAATGTTTATGCAACAAGGGACGAACAACGGGGTTAACAATCGGTTCCAGATGGTGTTTGATTCGACACCATTCGATATGGCAGCATTCGATTACAGAGATGATTGGCAAACCGGAGCAATGGAAGGAATGGGGAAGCAGCAGCAGCAGCAGCAGCAGCAGCAAGATGTATCAATATGGTTCTGA
Protein Sequence
- >AT2G27050.1
MMMFNEMGMYGNMDFFSSSTSLDVCPLPQAEQEPVVEDVDYTDDEMDVDELEKRMWRDKMRLKRLKEQQSKCKEGVDGSKQRQSQEQARRKKMSRAQDGILKYMLKMMEVCKAQGFVYGIIPEKGKPVTGASDNLREWWKDKVRFDRNGPAAIAKYQSENNISGGSNDCNSLVGPTPHTLQELQDTTLGSLLSALMQHCDPPQRRFPLEKGVSPPWWPNGNEEWWPQLGLPNEQGPPPYKKPHDLKKAWKVGVLTAVIKHMSPDIAKIRKLVRQSKCLQDKMTAKESATWLAIINQEEVVARELYPESCPPLSSSSSLGSGSLLINDCSEYDVEGFEKEQHGFDVEERKPEIVMMHPLASFGVAKMQHFPIKEEVATTVNLEFTRKRKQNNDMNVMVMDRSAGYTCENGQCPHSKMNLGFQDRSSRDNHQMVCPYRDNRLAYGASKFHMGGMKLVVPQQPVQPIDLSGVGVPENGQKMITELMAMYDRNVQSNQTPPTLMENQSMVIDAKAAQNQQLNFNSGNQMFMQQGTNNGVNNRFQMVFDSTPFDMAAFDYRDDWQTGAMEGMGKQQQQQQQQQDVSIWF