Gene Details:
- Gene ID: AT2G26320
- Gene Symbol: AGL33
- Gene Name: AGAMOUS-like 33
- Description: AGAMOUS-like 33;(source:Araport11)
- TAIR Accession: locus:2057741
- Genome: Araport11_genome_release
- Species: Arabidopsis thaliana
Transcripts:
Gene Ontology:
- GO:0003700 — enables — DNA-binding transcription factor activity
- GO:0000978 — enables — RNA polymerase II cis-regulatory region sequence-specific DNA binding
- GO:0006355 — acts upstream of or within — regulation of DNA-templated transcription
- GO:0006357 — involved in — regulation of transcription by RNA polymerase II
- GO:0045944 — involved in — positive regulation of transcription by RNA polymerase II
- GO:0000981 — enables — DNA-binding transcription factor activity, RNA polymerase II-specific
- GO:0046983 — enables — protein dimerization activity
- GO:0005634 — located in — nucleus
Literature:
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
- Genomewide structural annotation and evolutionary analysis of the type I MADS-box genes in plants. DOI: 10.1007/s00239-002-2426-x ; PMID: 12698294
- Molecular and phylogenetic analyses of the complete MADS-box transcription factor family in Arabidopsis: new openings to the MADS world. DOI: 10.1105/tpc.011544 ; PMID: 12837945
- Evolution and divergence of the MADS-box gene family based on genome-wide expression analyses. DOI: 10.1093/molbev/msg216 ; PMID: 12949148
- Comprehensive interaction map of the Arabidopsis MADS Box transcription factors. DOI: 10.1105/tpc.105.031831 ; PMID: 15805477
- Gene family analysis of the Arabidopsis pollen transcriptome reveals biological implications for cell growth, division control, and gene expression regulation. DOI: 10.1104/pp.104.057935 ; PMID: 15908605
- And then there were many: MADS goes genomic. DOI: 10.1016/j.tplants.2003.09.006 ; PMID: 14557044
- Transcriptome analysis of proliferating Arabidopsis endosperm reveals biological implications for the control of syncytial division, cytokinin signaling, and gene expression regulation. DOI: 10.1104/pp.108.128108 ; PMID: 18923020
- FERTILIZATION-INDEPENDENT SEED-Polycomb Repressive Complex 2 Plays a Dual Role in Regulating Type I MADS-Box Genes in Early Endosperm Development. DOI: 10.1104/pp.17.00534 ; PMID: 29523711
- Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. DOI: 10.1126/science.290.5499.2105 ; PMID: 11118137
Sequences:
cDNA Sequence
- >AT2G26320.1
ATGAAGAGAACAATCAAAAATAAAAATAAACAAATAGTTAAAGAAAATATGGGGAGGAAAAAACTAAAATTGAAGAGAATAGAGTCCCTAAAAGAGAGAAGTAGCAAATTTTCAAAACGTAAAAAAGGTCTTTTTAAAAAGGCAGAAGAAGTAGCATTGTTATGCGACTCGGATATAATGTTAATTGTTGTTTCTCCCACCGAGAAGCCTACAGTTTTTAACACTCGTTCTAGATCATTCCATACAATCCTTGAGAGGTTTTGCATGCTTTCATTACAAGAACGGGAAGAGAGGTGTGATCTTTCATATTTTTATATAATTATTACATAA
CDS Sequence
- >AT2G26320.1
ATGAAGAGAACAATCAAAAATAAAAATAAACAAATAGTTAAAGAAAATATGGGGAGGAAAAAACTAAAATTGAAGAGAATAGAGTCCCTAAAAGAGAGAAGTAGCAAATTTTCAAAACGTAAAAAAGGTCTTTTTAAAAAGGCAGAAGAAGTAGCATTGTTATGCGACTCGGATATAATGTTAATTGTTGTTTCTCCCACCGAGAAGCCTACAGTTTTTAACACTCGTTCTAGATCATTCCATACAATCCTTGAGAGGTTTTGCATGCTTTCATTACAAGAACGGGAAGAGAGGTGTGATCTTTCATATTTTTATATAATTATTACATAA
Protein Sequence
- >AT2G26320.1
MKRTIKNKNKQIVKENMGRKKLKLKRIESLKERSSKFSKRKKGLFKKAEEVALLCDSDIMLIVVSPTEKPTVFNTRSRSFHTILERFCMLSLQEREERCDLSYFYIIIT