Information report for AT2G25930
Gene Details
|
|
Functional Descriptions
- PO:0009006 — shoot system — sistema de epiblasto (epiblastema) (Spanish, exact), シュート系、苗条系 (Japanese, exact), Poaceae crown (related), shoot (related), thalli (related), thallus (related), tree crown (narrow)
- PO:0009009 — plant embryo — embrión (Spanish, exact), 植物胚 (Japanese, exact), germ (related), embryo (broad)
- PO:0009029 — stamen — estambre (Spanish, exact), 雄蕊 (Japanese, exact), Poaceae stamen (narrow), Zea stamen (narrow)
- PO:0009052 — inflorescence flower pedicel — 小花柄 (Japanese, related), pedicelo (Spanish, broad)
- PO:0020030 — cotyledon — cotiledón (Spanish, exact), seed leaf (exact), 子葉 (Japanese, exact)
- PO:0020038 — petiole — pecíolo (Spanish, exact), 葉柄 (Japanese, exact)
- PO:0020100 — hypocotyl — hipocótile (Spanish, exact), 胚軸 (Japanese, exact)
- PO:0020137 — leaf apex — ápice de la hoja (Spanish, exact), 葉先 (Japanese, exact), leaf lamina apex (narrow), phyllid apex (narrow)
- PO:0025022 — collective leaf structure — estructura colectiva de hoja (Spanish, exact), leaf series (exact), 葉が集まった構造 (Japanese, exact), leaf whorl (narrow), rosette (narrow), cycle (broad), verticil (broad)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
Functional Keywords
Literature and News
- Independent action of ELF3 and phyB to control hypocotyl elongation and flowering time. DOI: 10.1104/pp.122.4.1149 ; PMID: 10759510
- Isolation of a gene from Arabidopsis thaliana related to nematode feeding structures. DOI: 10.1016/s0378-1119(99)00353-4 ; PMID: 10571046
- Late-flowering genes interact with early-flowering genes to regulate flowering time in Arabidopsis thaliana. DOI: 10.1093/oxfordjournals.pcp.a029596 ; PMID: 10501030
- GIGANTEA: a circadian clock-controlled gene that regulates photoperiodic flowering in Arabidopsis and encodes a protein with several possible membrane-spanning domains. DOI: 10.1093/emboj/18.17.4679 ; PMID: 10469647
- EAF1 regulates vegetative-phase change and flowering time in Arabidopsis. DOI: 10.1104/pp.120.3.675 ; PMID: 10398702
- Circadian dysfunction causes aberrant hypocotyl elongation patterns in Arabidopsis. DOI: 10.1046/j.1365-313x.1999.00353.x ; PMID: 10069068
- FLD interacts with genes that affect different developmental phase transitions to regulate Arabidopsis shoot development. DOI: 10.1046/j.1365-313x.1998.00204.x ; PMID: 9721681
- Conditional circadian dysfunction of the Arabidopsis early-flowering 3 mutant. DOI: 10.1126/science.274.5288.790 ; PMID: 8864121
- The Arabidopsis ELF3 gene regulates vegetative photomorphogenesis and the photoperiodic induction of flowering. DOI: 10.1046/j.1365-313x.1996.10040691.x ; PMID: 8893545
- Genetic regulation of shoot development in Arabidopsis: role of the EMF genes. DOI: 10.1006/dbio.1995.1158 ; PMID: 7781888
- The ELF3 zeitnehmer regulates light signalling to the circadian clock. DOI: 10.1038/35047079 ; PMID: 11130072
- ELF3: a circadian safeguard to buffer effects of light. DOI: 10.1016/s1360-1385(01)02184-7 ; PMID: 11804815
- EARLY FLOWERING3 encodes a novel protein that regulates circadian clock function and flowering in Arabidopsis. DOI: 10.1105/tpc.13.6.1281 ; PMID: 11402160
- ELF3 encodes a circadian clock-regulated nuclear protein that functions in an Arabidopsis PHYB signal transduction pathway. DOI: 10.1105/tpc.13.6.1293 ; PMID: 11402161
- ELF3 modulates resetting of the circadian clock in Arabidopsis. DOI: 10.1105/tpc.13.6.1305 ; PMID: 11402162
- Circadian rhythms confer a higher level of fitness to Arabidopsis plants. DOI: 10.1104/pp.004374 ; PMID: 12068102
- Aberrant expression of the light-inducible and circadian-regulated APRR9 gene belonging to the circadian-associated APRR1/TOC1 quintet results in the phenotype of early flowering in Arabidopsis thaliana. DOI: 10.1093/pcp/pcf118 ; PMID: 12198185
- Conservation and divergence of circadian clock operation in a stress-inducible Crassulacean acid metabolism species reveals clock compensation against stress. DOI: 10.1104/pp.104.054577 ; PMID: 15734916
- Rapid array mapping of circadian clock and developmental mutations in Arabidopsis. DOI: 10.1104/pp.105.061408 ; PMID: 15908595
- Circadian rhythm of circumnutation in inflorescence stems of Arabidopsis. DOI: 10.1093/pcp/pci127 ; PMID: 15908440
- ELF4 is a phytochrome-regulated component of a negative-feedback loop involving the central oscillator components CCA1 and LHY. DOI: 10.1111/j.1365-313X.2005.02531.x ; PMID: 16212608
- Conserved expression profiles of circadian clock-related genes in two Lemna species showing long-day and short-day photoperiodic flowering responses. DOI: 10.1093/pcp/pcj027 ; PMID: 16524874
- Comparative overviews of clock-associated genes of Arabidopsis thaliana and Oryza sativa. DOI: 10.1093/pcp/pcl043 ; PMID: 17132630
- Functional conservation of clock-related genes in flowering plants: overexpression and RNA interference analyses of the circadian rhythm in the monocotyledon Lemna gibba. DOI: 10.1104/pp.107.114611 ; PMID: 18281417
- Diversification of photoperiodic response patterns in a collection of early-flowering mutants of Arabidopsis. DOI: 10.1104/pp.108.127639 ; PMID: 18799658
- Independent roles for EARLY FLOWERING 3 and ZEITLUPE in the control of circadian timing, hypocotyl length, and flowering time. DOI: 10.1104/pp.105.067173 ; PMID: 16258016
- Possible role of early flowering 3 (ELF3) in clock-dependent floral regulation by short vegetative phase (SVP) in Arabidopsis thaliana. DOI: 10.1111/j.1469-8137.2009.02809.x ; PMID: 19383102
- OsEF3, a homologous gene of Arabidopsis ELF3, has pleiotropic effects in rice. DOI: 10.1111/j.1438-8677.2008.00156.x ; PMID: 19689783
- A complementary role for ELF3 and TFL1 in the regulation of flowering time by ambient temperature. DOI: 10.1111/j.1365-313X.2009.03811.x ; PMID: 19187043
- Ambient temperature response establishes ELF3 as a required component of the core Arabidopsis circadian clock. DOI: 10.1073/pnas.0911006107 ; PMID: 20133619
- Genetic mapping of natural variation in a shade avoidance response: ELF3 is the candidate gene for a QTL in hypocotyl growth regulation. DOI: 10.1093/jxb/erq253 ; PMID: 20713464
- Network analysis identifies ELF3 as a QTL for the shade avoidance response in Arabidopsis. DOI: 10.1371/journal.pgen.1001100 ; PMID: 20838594
- The circadian clock modulates water dynamics and aquaporin expression in Arabidopsis roots. DOI: 10.1093/pcp/pcq198 ; PMID: 21186174
- Temporal repression of core circadian genes is mediated through EARLY FLOWERING 3 in Arabidopsis. DOI: 10.1016/j.cub.2010.12.013 ; PMID: 21236675
- Double loss-of-function mutation in EARLY FLOWERING 3 and CRYPTOCHROME 2 genes delays flowering under continuous light but accelerates it under long days and short days: an important role for Arabidopsis CRY2 to accelerate flowering time in continuous light. DOI: 10.1093/jxb/erq450 ; PMID: 21296763
- The ELF4-ELF3-LUX complex links the circadian clock to diurnal control of hypocotyl growth. DOI: 10.1038/nature10182 ; PMID: 21753751
- FLOWERING LOCUS T regulates stomatal opening. DOI: 10.1016/j.cub.2011.06.025 ; PMID: 21737277
- Suppression of late-flowering and semi-dwarf phenotypes in the Arabidopsis clock mutant lhy-12;cca1-101 by phyB under continuous light. DOI: 10.4161/psb.6.8.16361 ; PMID: 21822060
- A reduced-function allele reveals that EARLY FLOWERING3 repressive action on the circadian clock is modulated by phytochrome signals in Arabidopsis. DOI: 10.1105/tpc.111.088195 ; PMID: 21908721
- CCA1 and ELF3 Interact in the control of hypocotyl length and flowering time in Arabidopsis. DOI: 10.1104/pp.111.189670 ; PMID: 22190341
- Genomic analysis of QTLs and genes altering natural variation in stochastic noise. DOI: 10.1371/journal.pgen.1002295 ; PMID: 21980300
- Induced mutations in circadian clock regulator Mat-a facilitated short-season adaptation and range extension in cultivated barley. DOI: 10.1073/pnas.1113009109 ; PMID: 22371569
- EARLY FLOWERING4 recruitment of EARLY FLOWERING3 in the nucleus sustains the Arabidopsis circadian clock. DOI: 10.1105/tpc.111.093807 ; PMID: 22327739
- Diurnal dependence of growth responses to shade in Arabidopsis: role of hormone, clock, and light signaling. DOI: 10.1093/mp/ssr122 ; PMID: 22311777
- ELF3 recruitment to the PRR9 promoter requires other Evening Complex members in the Arabidopsis circadian clock. DOI: 10.4161/psb.18766 ; PMID: 22307044
- The microRNA156-SQUAMOSA PROMOTER BINDING PROTEIN-LIKE3 module regulates ambient temperature-responsive flowering via FLOWERING LOCUS T in Arabidopsis. DOI: 10.1104/pp.111.192369 ; PMID: 22427344
- Ef7 encodes an ELF3-like protein and promotes rice flowering by negatively and long-day conditions. DOI: 10.1093/pcp/pcs029 ; PMID: 22422935
- Natural variation in Hd17, a homolog of Arabidopsis ELF3 that is involved in rice photoperiodic flowering. DOI: 10.1093/pcp/pcs028 ; PMID: 22399582
- Mutation at the circadian clock gene EARLY MATURITY 8 adapts domesticated barley (Hordeum vulgare) to short growing seasons. DOI: 10.1073/pnas.1120496109 ; PMID: 22566625
- OsELF3-1, an ortholog of Arabidopsis early flowering 3, regulates rice circadian rhythm and photoperiodic flowering. DOI: 10.1371/journal.pone.0043705 ; PMID: 22912900
- OsELF3 is involved in circadian clock regulation for promoting flowering under long-day conditions in rice. DOI: 10.1093/mp/sss062 ; PMID: 22888152
- Background-dependent effects of polyglutamine variation in the Arabidopsis thaliana gene ELF3. DOI: 10.1073/pnas.1211021109 ; PMID: 23129635
- Ambient temperature signal feeds into the circadian clock transcriptional circuitry through the EC night-time repressor in Arabidopsis thaliana. DOI: 10.1093/pcp/pcu030 ; PMID: 24500967
- Natural variation reveals that intracellular distribution of ELF3 protein is associated with function in the circadian clock. DOI: 10.7554/eLife.02206 ; PMID: 24867215
- Light and the circadian clock mediate time-specific changes in sensitivity to UV-B stress under light/dark cycles. DOI: 10.1093/jxb/eru339 ; PMID: 25147271
- ELF3-PIF4 interaction regulates plant growth independently of the Evening Complex. DOI: 10.1016/j.cub.2014.10.070 ; PMID: 25557667
- ELF3 controls thermoresponsive growth in Arabidopsis. DOI: 10.1016/j.cub.2014.10.076 ; PMID: 25557663
- Gibberellin driven growth in elf3 mutants requires PIF4 and PIF5. DOI: 10.4161/15592324.2014.992707 ; PMID: 25738547
- The Transcriptional Regulator BBX19 Promotes Hypocotyl Growth by Facilitating COP1-Mediated EARLY FLOWERING3 Degradation in Arabidopsis. DOI: 10.1105/tpc.15.00044 ; PMID: 25841036
- Quantitative Circadian Phosphoproteomic Analysis of Arabidopsis Reveals Extensive Clock Control of Key Components in Physiological, Metabolic, and Signaling Pathways. DOI: 10.1074/mcp.M114.047183 ; PMID: 26091701
- Natural variants of ELF3 affect thermomorphogenesis by transcriptionally modulating PIF4-dependent auxin response genes. DOI: 10.1186/s12870-015-0566-6 ; PMID: 26269119
- Quantitative Variation in Responses to Root Spatial Constraint within Arabidopsis thaliana. DOI: 10.1105/tpc.15.00335 ; PMID: 26243313
- Identification of Evening Complex Associated Proteins in Arabidopsis by Affinity Purification and Mass Spectrometry. DOI: 10.1074/mcp.M115.054064 ; PMID: 26545401
- Exploring potential new floral organ morphogenesis genes of Arabidopsis thaliana using systems biology approach. DOI: 10.3389/fpls.2015.00829 ; PMID: 26528302
- Data on the identification of protein interactors with the Evening Complex and PCH1 in Arabidopsis using tandem affinity purification and mass spectrometry (TAP-MS). DOI: 10.1016/j.dib.2016.05.014 ; PMID: 27274533
- Mutation of Rice Early Flowering3.1 (OsELF3.1) delays leaf senescence in rice. DOI: 10.1007/s11103-016-0507-2 ; PMID: 27380315
- PIF4 and ELF3 Act Independently in Arabidopsis thaliana Thermoresponsive Flowering. DOI: 10.1371/journal.pone.0161791 ; PMID: 27564448
- Alternative splicing and nonsense-mediated decay of circadian clock genes under environmental stress conditions in Arabidopsis. DOI: 10.1186/1471-2229-14-136 ; PMID: 24885185
- Variability in a Short Tandem Repeat Mediates Complex Epistatic Interactions in Arabidopsis thaliana. DOI: 10.1534/genetics.116.193359 ; PMID: 27866166
- Natural variation at the soybean J locus improves adaptation to the tropics and enhances yield. DOI: 10.1038/ng.3819 ; PMID: 28319089
- Cellulose Synthesis and Cell Expansion Are Regulated by Different Mechanisms in Growing Arabidopsis Hypocotyls. DOI: 10.1105/tpc.16.00782 ; PMID: 28550150
- The evening complex coordinates environmental and endogenous signals in Arabidopsis. DOI: 10.1038/nplants.2017.87 ; PMID: 28650433
- Shining a light on the Arabidopsis circadian clock. DOI: 10.1111/pce.13033 ; PMID: 28732105
- SPF45-related splicing factor for phytochrome signaling promotes photomorphogenesis by regulating pre-mRNA splicing in Arabidopsis. DOI: 10.1073/pnas.1706379114 ; PMID: 28760995
- The Chickpea Early Flowering 1 (Efl1) Locus Is an Ortholog of Arabidopsis ELF3. DOI: 10.1104/pp.17.00082 ; PMID: 28818860
- Arabidopsis EARLY FLOWERING3 increases salt tolerance by suppressing salt stress response pathways. DOI: 10.1111/tpj.13747 ; PMID: 29032592
- Circadian control of ORE1 by PRR9 positively regulates leaf senescence in Arabidopsis. DOI: 10.1073/pnas.1722407115 ; PMID: 30065116
- Multiple circadian clock outputs regulate diel turnover of carbon and nitrogen reserves. DOI: 10.1111/pce.13440 ; PMID: 30184255
- Molecular basis of flowering under natural long-day conditions in Arabidopsis. DOI: 10.1038/s41477-018-0253-3 ; PMID: 30250277
- Two B-Box Domain Proteins, BBX18 and BBX23, Interact with ELF3 and Regulate Thermomorphogenesis in Arabidopsis. DOI: 10.1016/j.celrep.2018.10.060 ; PMID: 30428343
- HOS15 Interacts with the Histone Deacetylase HDA9 and the Evening Complex to Epigenetically Regulate the Floral Activator GIGANTEA. DOI: 10.1105/tpc.18.00721 ; PMID: 30606777
- Arabidopsis JMJD5/JMJ30 Acts Independently of LUX ARRHYTHMO Within the Plant Circadian Clock to Enable Temperature Compensation. DOI: 10.3389/fpls.2019.00057 ; PMID: 30774641
- The EC-HDA9 complex rhythmically regulates histone acetylation at the TOC1 promoter in Arabidopsis. DOI: 10.1038/s42003-019-0377-7 ; PMID: 31044168
- Luciferase-Based Screen for Post-translational Control Factors in the Regulation of the Pseudo-Response Regulator PRR7. DOI: 10.3389/fpls.2019.00667 ; PMID: 31191580
- Density effects on late flowering mutants of Arabidopsis thaliana under continuous light. DOI: 10.5511/plantbiotechnology.16.0622a ; PMID: 31274994
- Photoperiod sensing of the circadian clock is controlled by EARLY FLOWERING 3 and GIGANTEA. DOI: 10.1111/tpj.14604 ; PMID: 31694066
- The Evening Complex Establishes Repressive Chromatin Domains Via H2A.Z Deposition. DOI: 10.1104/pp.19.00881 ; PMID: 31712305
- Monitoring single-cell bioluminescence of Arabidopsis leaves to quantitatively evaluate the efficiency of a transiently introduced CRISPR/Cas9 system targeting the circadian clock gene ELF3. DOI: 10.5511/plantbiotechnology.19.0531a ; PMID: 31768121
- The ELF3-PIF7 Interaction Mediates the Circadian Gating of the Shade Response in Arabidopsis. DOI: 10.1016/j.isci.2019.11.029 ; PMID: 31805433
- Molecular mechanisms of Evening Complex activity in Arabidopsis. DOI: 10.1073/pnas.1920972117 ; PMID: 32165537
- The Circadian Clock Influences the Long-Term Water Use Efficiency of Arabidopsis. DOI: 10.1104/pp.20.00030 ; PMID: 32179629
- The evening complex is central to the difference between the circadian clocks of Arabidopsis thaliana shoots and roots. DOI: 10.1111/ppl.13108 ; PMID: 32303120
- Global transcriptome analysis reveals circadian control of splicing events in Arabidopsis thaliana. DOI: 10.1111/tpj.14776 ; PMID: 32314836
- Cross-species complementation reveals conserved functions for EARLY FLOWERING 3 between monocots and dicots. DOI: 10.1002/pld3.18 ; PMID: 31245666
- The diverse and unanticipated roles of histone deacetylase 9 in coordinating plant development and environmental acclimation. DOI: 10.1093/jxb/eraa335 ; PMID: 32687569
- High Ambient Temperature Accelerates Leaf Senescence via PHYTOCHROME-INTERACTING FACTOR 4 and 5 in Arabidopsis. DOI: 10.14348/molcells.2020.0117 ; PMID: 32732458
- A prion-like domain in ELF3 functions as a thermosensor in Arabidopsis. DOI: 10.1038/s41586-020-2644-7 ; PMID: 32848244
- Hot topic: Thermosensing in plants. DOI: 10.1111/pce.13979 ; PMID: 33314270
- The Evening Complex and the Chromatin-Remodeling Factor PICKLE Coordinately Control Seed Dormancy by Directly Repressing DOG1 in Arabidopsis. DOI: 10.1016/j.xplc.2019.100011 ; PMID: 33404551
- Molecular and functional dissection of EARLY-FLOWERING 3 (ELF3) and ELF4 in Arabidopsis. DOI: 10.1016/j.plantsci.2020.110786 ; PMID: 33487361
- Identification of a consensus DNA-binding site for the TCP domain transcription factor TCP2 and its important roles in the growth and development of Arabidopsis. DOI: 10.1007/s11033-021-06233-z ; PMID: 33689093
- DELLA degradation by gibberellin promotes flowering via GAF1-TPR-dependent repression of floral repressors in Arabidopsis. DOI: 10.1093/plcell/koab102 ; PMID: 33822231
- The Arabidopsis JMJ29 Protein Controls Circadian Oscillation through Diurnal Histone Demethylation at the CCA1 and PRR9 Loci. DOI: 10.3390/genes12040529 ; PMID: 33916408
- The E3 ligase XBAT35 mediates thermoresponsive hypocotyl growth by targeting ELF3 for degradation in Arabidopsis. DOI: 10.1111/jipb.13107 ; PMID: 33963671
- XBAT31 regulates thermoresponsive hypocotyl growth through mediating degradation of the thermosensor ELF3 in Arabidopsis. DOI: 10.1126/sciadv.abf4427 ; PMID: 33962946
- Phytochrome A elevates plant circadian-clock components to suppress shade avoidance in deep-canopy shade. DOI: 10.1073/pnas.2108176118 ; PMID: 34187900
- Exploring PIF4 's contribution to early flowering in plants under daily variable temperature and its tissue-specific flowering gene network. DOI: 10.1002/pld3.339 ; PMID: 34355114
- Firefly Luciferase Complementation-Based Analysis of Dynamic Protein-Protein Interactions Under Diurnal and Circadian Conditions in Arabidopsis. DOI: 10.1007/978-1-0716-1912-4_16 ; PMID: 34674178
- Arabidopsis EARLY FLOWERING 3 controls temperature responsiveness of the circadian clock independently of the evening complex. DOI: 10.1093/jxb/erab473 ; PMID: 34698833
- Cellular localization of Arabidopsis EARLY FLOWERING3 is responsive to light quality. DOI: 10.1093/plphys/kiac072 ; PMID: 35191492
- Hysteresis in PHYTOCHROME-INTERACTING FACTOR 4 and EARLY-FLOWERING 3 dynamics dominates warm daytime memory in Arabidopsis. DOI: 10.1093/plcell/koac078 ; PMID: 35234947
- The circadian clock mutant lhy cca1 elf3 paces starch mobilization to dawn despite severely disrupted circadian clock function. DOI: 10.1093/plphys/kiac226 ; PMID: 35567528
- REVEILLE 7 inhibits the expression of the circadian clock gene EARLY FLOWERING 4 to fine-tune hypocotyl growth in response to warm temperatures. DOI: 10.1111/jipb.13284 ; PMID: 35603836
- Increasing the resilience of plant immunity to a warming climate. DOI: 10.1038/s41586-022-04902-y ; PMID: 35768511
- The intersection between circadian and heat-responsive regulatory networks controls plant responses to increasing temperatures. DOI: 10.1042/BST20190572 ; PMID: 35758233
- EARLY FLOWERING 3 represses the nighttime growth response to sucrose in Arabidopsis. DOI: 10.1007/s43630-022-00264-6 ; PMID: 35867260
- COP1 dynamics integrate conflicting seasonal light and thermal cues in the control of Arabidopsis elongation. DOI: 10.1126/sciadv.abp8412 ; PMID: 35984876
- The 5'-3' mRNA Decay Pathway Modulates the Plant Circadian Network in Arabidopsis. DOI: 10.1093/pcp/pcac126 ; PMID: 36066193
- HSP90s are required for hypocotyl elongation during skotomorphogenesis and thermomorphogenesis via the COP1-ELF3-PIF4 pathway in Arabidopsis. DOI: 10.1111/nph.18776 ; PMID: 36707919
- PHYTOCHROME-INTERACTING FACTORS are involved in starch degradation adjustment via inhibition of the carbon metabolic regulator QUA-QUINE STARCH in Arabidopsis. DOI: 10.1111/tpj.16124 ; PMID: 36710626
- Diversification of photoperiodic response patterns in a collection of early-flowering mutants of Arabidopsis. DOI: 10.1104/pp.108.127639 ; PMID: 18799658
Gene Resources
Homologs
- Glycine max GmELF3
- Oryza sativa Hd17;Ef7, OsEF3;OsELF3-2
- Triticum aestivum TaELF3-1DL, TaELF3-1BL, TaELF3-1AL
Sequences
cDNA Sequence
- >AT2G25930.1
AGAGTCCACGTCGTCACGCACTTTTCCGGTGGTGAAAAAAATGTCCAAATGGATTAAATCTATAATATCTCCAGAGAGATCCTCTCCTTCTATCTTTTTGGGCTCCACTTTTCCTATCTCTTTTTGCCCCTTTCCTCTCTCTGTTCACAAGTCATCTTCTTCCTTCCTCTGAATCTTGTTCCTTTTTGCTCTCTCTACTTGATTCACCCACTCTGTTTCTCGATTAGTACGTTGAAAACTCACTTTGGTTTTGTTTGATTCCTCTTTAGTCTGTTTTTCGATTTCGTTTTCTCTGATTGGTTTGGTGGTGAGATCTCTATCGTAGTTTGTCCTTTGGGTTAAGATATTTCATTTGATTGGTGGGTTTGTTTTATTGAAGCTTATTGTTGTGAAAGTTGGAGTCTTTCTCAGTTTTTAGGTTGAATTATTAAGAGAAAGGGAAGATTTTTGGTGTGAAGTTAGGTTATTTGGGGTTTGAGAAGTTTGCAAGTGAAAAAGGTTGTGAATTGTGAGTGATGAAGAGAGGGAAAGATGAGGAGAAGATATTGGAACCTATGTTTCCTCGGCTTCATGTGAATGATGCAGATAAAGGAGGGCCTAGAGCTCCTCCTAGAAACAAGATGGCTCTTTATGAGCAGCTTAGTATTCCTTCTCAGAGGTTTGGTGATCATGGAACGATGAATTCTCGTAGTAACAACACAAGCACTTTGGTTCATCCTGGACCATCTAGTCAGCCTTGTGGTGTGGAAAGAAACTTATCTGTCCAGCATCTTGATTCTTCAGCCGCAAACCAAGCAACTGAGAAGTTTGTCTCCCAAATGTCCTTCATGGAAAATGTGAGATCTTCGGCACAGCATGATCAGAGGAAAATGGTGAGAGAGGAAGAAGATTTTGCAGTTCCAGTATATATTAACTCAAGAAGATCTCAGTCTCATGGCAGAACCAAGAGTGGTATTGAGAAGGAAAAACACACCCCAATGGTGGCACCTAGCTCTCATCACTCCATTCGATTTCAAGAAGTGAATCAGACAGGCTCAAAGCAAAACGTATGTTTGGCTACTTGTTCAAAACCTGAAGTTAGGGATCAGGTCAAGGCGAATGCAAGGTCAGGTGGCTTTGTAATCTCTTTAGATGTATCAGTCACAGAGGAGATTGATCTCGAAAAATCAGCATCAAGTCATGATAGAGTAAATGATTATAATGCTTCCTTGAGACAAGAGTCTAGAAATCGGTTATACCGAGATGGTGGCAAAACTCGTCTGAAGGACACTGATAATGGAGCTGAATCTCACTTGGCAACGGAAAATCATTCACAAGAGGGTCATGGCAGTCCTGAAGACATTGATAATGATCGTGAATACAGCAAAAGCAGAGCATGCGCCTCTCTGCAGCAGATAAATGAAGAGGCAAGTGATGACGTTTCTGATGATTCGATGGTGGATTCTATATCCAGCATAGATGTCTCTCCCGATGATGTTGTGGGTATATTAGGTCAAAAACGTTTCTGGAGAGCAAGGAAAGCCATTGCCAATCAACAAAGAGTATTTGCTGTTCAACTATTTGAGTTGCACAGACTGATTAAGGTTCAAAAACTTATTGCTGCATCACCGGATCTCTTGCTCGATGAGATCAGTTTTCTTGGAAAAGTTTCTGCTAAAAGCTATCCAGTGAAGAAGCTCCTTCCATCAGAATTTCTGGTAAAGCCTCCTCTACCACATGTTGTCGTCAAACAAAGGGGTGACTCGGAGAAGACTGACCAACATAAAATGGAAAGCTCAGCTGAGAACGTAGTTGGGAGGTTGTCAAATCAAGGTCATCATCAACAATCCAACTACATGCCTTTTGCAAACAACCCACCGGCTTCACCGGCTCCAAATGGATATTGCTTTCCTCCTCAGCCTCCTCCTTCAGGAAATCATCAGCAATGGTTGATCCCTGTAATGTCTCCCTCGGAAGGACTGATATACAAGCCTCACCCAGGTATGGCACACACGGGGCATTATGGAGGATATTATGGTCATTATATGCCTACACCAATGGTAATGCCTCAATATCACCCCGGCATGGGATTCCCACCTCCTGGTAATGGCTACTTCCCTCCATATGGAATGATGCCCACCATAATGAACCCATATTGTTCAAGCCAACAACAACAACAACAACAACCCAATGAGCAAATGAACCAGTTTGGACATCCTGGAAATCTTCAGAACACCCAACAACAACAACAGAGATCTGATAATGAACCTGCTCCACAGCAACAGCAACAGCCAACAAAGTCTTATCCGCGAGCAAGAAAGAGCAGGCAAGGGAGCACAGGAAGCAGTCCAAGTGGGCCACAGGGAATCTCTGGTAGCAAGTCCTTTCGGCCATTCGCAGCCGTTGATGAGGACAGCAACATCAACAATGCACCTGAGCAAACGATGACAACAACCACAACGACGACAAGAACAACTGTTACTCAGACAACAAGAGATGGGGGAGGAGTGACGAGAGTGATAAAGGTGGTACCTCACAACGCAAAGCTCGCGAGTGAGAATGCTGCCAGAATTTTCCAGTCAATACAAGAAGAACGTAAACGCTATGACTCCTCTAAGCCTTAATCCTCTCTATGCGTATTGTACTTGATATGTATTTTACAAAATTAGAAAAATTGTGATAGATGTTATCCTCAATATATGTACCATGTAAACGTATTATGGTGTAAGCCTCATTTATATGTGTTAATTTGTCTTAAAGCCTTGAAATC
CDS Sequence
- >AT2G25930.1
ATGAAGAGAGGGAAAGATGAGGAGAAGATATTGGAACCTATGTTTCCTCGGCTTCATGTGAATGATGCAGATAAAGGAGGGCCTAGAGCTCCTCCTAGAAACAAGATGGCTCTTTATGAGCAGCTTAGTATTCCTTCTCAGAGGTTTGGTGATCATGGAACGATGAATTCTCGTAGTAACAACACAAGCACTTTGGTTCATCCTGGACCATCTAGTCAGCCTTGTGGTGTGGAAAGAAACTTATCTGTCCAGCATCTTGATTCTTCAGCCGCAAACCAAGCAACTGAGAAGTTTGTCTCCCAAATGTCCTTCATGGAAAATGTGAGATCTTCGGCACAGCATGATCAGAGGAAAATGGTGAGAGAGGAAGAAGATTTTGCAGTTCCAGTATATATTAACTCAAGAAGATCTCAGTCTCATGGCAGAACCAAGAGTGGTATTGAGAAGGAAAAACACACCCCAATGGTGGCACCTAGCTCTCATCACTCCATTCGATTTCAAGAAGTGAATCAGACAGGCTCAAAGCAAAACGTATGTTTGGCTACTTGTTCAAAACCTGAAGTTAGGGATCAGGTCAAGGCGAATGCAAGGTCAGGTGGCTTTGTAATCTCTTTAGATGTATCAGTCACAGAGGAGATTGATCTCGAAAAATCAGCATCAAGTCATGATAGAGTAAATGATTATAATGCTTCCTTGAGACAAGAGTCTAGAAATCGGTTATACCGAGATGGTGGCAAAACTCGTCTGAAGGACACTGATAATGGAGCTGAATCTCACTTGGCAACGGAAAATCATTCACAAGAGGGTCATGGCAGTCCTGAAGACATTGATAATGATCGTGAATACAGCAAAAGCAGAGCATGCGCCTCTCTGCAGCAGATAAATGAAGAGGCAAGTGATGACGTTTCTGATGATTCGATGGTGGATTCTATATCCAGCATAGATGTCTCTCCCGATGATGTTGTGGGTATATTAGGTCAAAAACGTTTCTGGAGAGCAAGGAAAGCCATTGCCAATCAACAAAGAGTATTTGCTGTTCAACTATTTGAGTTGCACAGACTGATTAAGGTTCAAAAACTTATTGCTGCATCACCGGATCTCTTGCTCGATGAGATCAGTTTTCTTGGAAAAGTTTCTGCTAAAAGCTATCCAGTGAAGAAGCTCCTTCCATCAGAATTTCTGGTAAAGCCTCCTCTACCACATGTTGTCGTCAAACAAAGGGGTGACTCGGAGAAGACTGACCAACATAAAATGGAAAGCTCAGCTGAGAACGTAGTTGGGAGGTTGTCAAATCAAGGTCATCATCAACAATCCAACTACATGCCTTTTGCAAACAACCCACCGGCTTCACCGGCTCCAAATGGATATTGCTTTCCTCCTCAGCCTCCTCCTTCAGGAAATCATCAGCAATGGTTGATCCCTGTAATGTCTCCCTCGGAAGGACTGATATACAAGCCTCACCCAGGTATGGCACACACGGGGCATTATGGAGGATATTATGGTCATTATATGCCTACACCAATGGTAATGCCTCAATATCACCCCGGCATGGGATTCCCACCTCCTGGTAATGGCTACTTCCCTCCATATGGAATGATGCCCACCATAATGAACCCATATTGTTCAAGCCAACAACAACAACAACAACAACCCAATGAGCAAATGAACCAGTTTGGACATCCTGGAAATCTTCAGAACACCCAACAACAACAACAGAGATCTGATAATGAACCTGCTCCACAGCAACAGCAACAGCCAACAAAGTCTTATCCGCGAGCAAGAAAGAGCAGGCAAGGGAGCACAGGAAGCAGTCCAAGTGGGCCACAGGGAATCTCTGGTAGCAAGTCCTTTCGGCCATTCGCAGCCGTTGATGAGGACAGCAACATCAACAATGCACCTGAGCAAACGATGACAACAACCACAACGACGACAAGAACAACTGTTACTCAGACAACAAGAGATGGGGGAGGAGTGACGAGAGTGATAAAGGTGGTACCTCACAACGCAAAGCTCGCGAGTGAGAATGCTGCCAGAATTTTCCAGTCAATACAAGAAGAACGTAAACGCTATGACTCCTCTAAGCCTTAA
Protein Sequence
- >AT2G25930.1
MKRGKDEEKILEPMFPRLHVNDADKGGPRAPPRNKMALYEQLSIPSQRFGDHGTMNSRSNNTSTLVHPGPSSQPCGVERNLSVQHLDSSAANQATEKFVSQMSFMENVRSSAQHDQRKMVREEEDFAVPVYINSRRSQSHGRTKSGIEKEKHTPMVAPSSHHSIRFQEVNQTGSKQNVCLATCSKPEVRDQVKANARSGGFVISLDVSVTEEIDLEKSASSHDRVNDYNASLRQESRNRLYRDGGKTRLKDTDNGAESHLATENHSQEGHGSPEDIDNDREYSKSRACASLQQINEEASDDVSDDSMVDSISSIDVSPDDVVGILGQKRFWRARKAIANQQRVFAVQLFELHRLIKVQKLIAASPDLLLDEISFLGKVSAKSYPVKKLLPSEFLVKPPLPHVVVKQRGDSEKTDQHKMESSAENVVGRLSNQGHHQQSNYMPFANNPPASPAPNGYCFPPQPPPSGNHQQWLIPVMSPSEGLIYKPHPGMAHTGHYGGYYGHYMPTPMVMPQYHPGMGFPPPGNGYFPPYGMMPTIMNPYCSSQQQQQQQPNEQMNQFGHPGNLQNTQQQQQRSDNEPAPQQQQQPTKSYPRARKSRQGSTGSSPSGPQGISGSKSFRPFAAVDEDSNINNAPEQTMTTTTTTTRTTVTQTTRDGGGVTRVIKVVPHNAKLASENAARIFQSIQEERKRYDSSKP