Information report for AT1G04410
Gene Details
|
|
Functional Descriptions
- PO:0000013 — cauline leaf — hoja caulinar (Spanish, exact), 茎生葉、茎葉 (Japanese, exact)
- PO:0000230 — inflorescence meristem — meristema de la inflorescencia (Spanish, exact), 花序分裂組織 (Japanese, exact)
- PO:0009010 — seed — semilla (Spanish, exact), 種子 (Japanese, exact), pyrene (narrow), diaspore (broad)
- PO:0009030 — carpel — carpelo (Spanish, exact), 心皮 (Japanese, exact), Poaceae carpel (narrow), Zea carpel (narrow), pistil (broad)
- PO:0009032 — petal — pétalo (Spanish, exact), 花弁 (Japanese, exact)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0005020 — vascular bundle — haz vascular (Spanish, exact), vein (exact), 維管束 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
Functional Keywords
- cauline leaf , inflorescence meristem , seed , carpel , petal , stem , pollen , vascular bundle , pollen , guard cell
Literature and News
- Arabidopsis phosphoribosylanthranilate isomerase: molecular genetic analysis of triplicate tryptophan pathway genes. DOI: 10.1105/tpc.7.4.447 ; PMID: 7773017
- Immunological characterization and chloroplast localization of the tryptophan biosynthetic enzymes of the flowering plant Arabidopsis thaliana. DOI: 10.1074/jbc.270.11.6081 ; PMID: 7890741
- Differential expression of triplicate phosphoribosylanthranilate isomerase isogenes in the tryptophan biosynthetic pathway of Arabidopsis thaliana (L.) Heynh. DOI: 10.1007/s004250000452 ; PMID: 11346937
- Comparative Coexpression Analysis of Indole Synthase and Tryptophan Synthase A Reveals the Independent Production of Auxin via the Cytosolic Free Indole. DOI: 10.3390/plants12081687 ; PMID: 37111910
- Centromere positioning and dynamics in living Arabidopsis plants. DOI: 10.1091/mbc.e05-08-0706 ; PMID: 16195344
- BOLITA, an Arabidopsis AP2/ERF-like transcription factor that affects cell expansion and proliferation/differentiation pathways. DOI: 10.1007/s11103-006-9059-1 ; PMID: 17096212
- Involvement of Arabidopsis HOS15 in histone deacetylation and cold tolerance. DOI: 10.1073/pnas.0801029105 ; PMID: 18356294
- Histone H2B monoubiquitination in the chromatin of FLOWERING LOCUS C regulates flowering time in Arabidopsis. DOI: 10.1105/tpc.108.062760 ; PMID: 18849490
- The evolution and functional divergence of the histone H2B family in plants. DOI: 10.1371/journal.pgen.1008964 ; PMID: 32716939
- Characterization of post-translational modifications of histone H2B-variants isolated from Arabidopsis thaliana. DOI: 10.1021/pr0702159 ; PMID: 17691833
- Calmodulin activation of an endoplasmic reticulum-located calcium pump involves an interaction with the N-terminal autoinhibitory domain. DOI: 10.1104/pp.122.1.157 ; PMID: 10631259
- Two additional type IIA Ca(2+)-ATPases are expressed in Arabidopsis thaliana: evidence that type IIA sub-groups exist. DOI: 10.1016/s0378-1119(99)00242-5 ; PMID: 10433975
- A high-affinity Ca2+ pump, ECA1, from the endoplasmic reticulum is inhibited by cyclopiazonic acid but not by thapsigargin. DOI: 10.1104/pp.118.3.817 ; PMID: 9808725
- ECA1 complements yeast mutants defective in Ca2+ pumps and encodes an endoplasmic reticulum-type Ca2+-ATPase in Arabidopsis thaliana. DOI: 10.1073/pnas.94.16.8579 ; PMID: 9238019
- A tomato ER-type Ca2+-ATPase, LCA1, has a low thapsigargin-sensitivity and can transport manganese. DOI: 10.1016/j.abb.2008.11.010 ; PMID: 19056336
- Phosphatidic acid binding proteins display differential binding as a function of membrane curvature stress and chemical properties. DOI: 10.1016/j.bbamem.2016.07.014 ; PMID: 27480805
- MIZ1 regulates ECA1 to generate a slow, long-distance phloem-transmitted Ca(2+) signal essential for root water tracking in Arabidopsis. DOI: 10.1073/pnas.1804130115 ; PMID: 30012618
- Carbon export from leaves is controlled via ubiquitination and phosphorylation of sucrose transporter SUC2. DOI: 10.1073/pnas.1912754117 ; PMID: 32123097
- AtMKK6 and AtMPK13 are required for lateral root formation in Arabidopsis. DOI: 10.4161/psb.6.10.17089 ; PMID: 21904115
- The heat-shock element is a functional component of the Arabidopsis APX1 gene promoter. DOI: 10.1104/pp.118.3.1005 ; PMID: 9808745
- From sequence analysis of three novel ascorbate peroxidases from Arabidopsis thaliana to structure, function and evolution of seven types of ascorbate peroxidase. DOI: 10.1042/bj3260305 ; PMID: 9291097
- Photosynthetic electron transport regulates the expression of cytosolic ascorbate peroxidase genes in Arabidopsis during excess light stress. DOI: 10.1105/tpc.9.4.627 ; PMID: 9144965
- Expression of Arabidopsis cytosolic ascorbate peroxidase gene in response to ozone or sulfur dioxide. DOI: 10.1007/BF00020979 ; PMID: 8534847
- Genomic DNA structure of a gene encoding cytosolic ascorbate peroxidase from Arabidopsis thaliana. DOI: 10.1016/0014-5793(93)81185-3 ; PMID: 8422923
- and heat shock transcription factor-dependent expression and activity of ascorbate peroxidase in Arabidopsis. DOI: 10.1104/pp.001362 ; PMID: 12068123
- Effects of leaf ascorbate content on defense and photosynthesis gene expression in Arabidopsis thaliana. DOI: 10.1089/152308603321223513 ; PMID: 12626114
- Growth suppression, altered stomatal responses, and augmented induction of heat shock proteins in cytosolic ascorbate peroxidase (Apx1)-deficient Arabidopsis plants. DOI: 10.1046/j.1365-313x.2003.01715.x ; PMID: 12694594
- Iron-regulated expression of a cytosolic ascorbate peroxidase encoded by the APX1 gene in Arabidopsis seedlings. DOI: 10.1104/pp.103.029876 ; PMID: 14739345
- The zinc finger protein Zat12 is required for cytosolic ascorbate peroxidase 1 expression during oxidative stress in Arabidopsis. DOI: 10.1074/jbc.M313350200 ; PMID: 14722088
- Identifying photoprotection mutants in Arabidopsis thaliana. DOI: 10.1385/1-59259-799-8:287 ; PMID: 15187287
- Cytosolic ascorbate peroxidase 1 is a central component of the reactive oxygen gene network of Arabidopsis. DOI: 10.1105/tpc.104.026971 ; PMID: 15608336
- Acclimation to diverse environmental stresses caused by a suppression of cytosolic ascorbate peroxidase in tobacco BY-2 cells. DOI: 10.1093/pcp/pci135 ; PMID: 15919670
- Expression of the Apx gene family during leaf senescence of Arabidopsis thaliana. DOI: 10.1007/s00425-005-0028-8 ; PMID: 16034597
- Heat stress-induced H(2)O (2) is required for effective expression of heat shock genes in Arabidopsis. DOI: 10.1007/s11103-006-0045-4 ; PMID: 16897488
- Senescence-specific regulation of catalases in Arabidopsis thaliana (L.) Heynh. DOI: 10.1111/j.1365-3040.2005.01459.x ; PMID: 17080932
- Double mutants deficient in cytosolic and thylakoid ascorbate peroxidase reveal a complex mode of interaction between reactive oxygen species, plant development, and response to abiotic stresses. DOI: 10.1104/pp.107.101436 ; PMID: 17556505
- Ascorbate peroxidase 1 plays a key role in the response of Arabidopsis thaliana to stress combination. DOI: 10.1074/jbc.M806337200 ; PMID: 18852264
- Functional analysis of an Arabidopsis transcription factor WRKY25 in heat stress. DOI: 10.1007/s00299-008-0666-y ; PMID: 19125253
- Differential patterns of reactive oxygen species and antioxidative mechanisms during atrazine injury and sucrose-induced tolerance in Arabidopsis thaliana plantlets. DOI: 10.1186/1471-2229-9-28 ; PMID: 19284649
- AtHsfA2 modulates expression of stress responsive genes and enhances tolerance to heat and oxidative stress in Arabidopsis. DOI: 10.1360/062005-119 ; PMID: 16483133
- Peroxidases identified in a subtractive cDNA library approach show tissue-specific transcript abundance and enzyme activity during seed germination of Lepidium sativum. DOI: 10.1093/jxb/erp318 ; PMID: 19884228
- Transgenic expression of the Trichoderma harzianum hsp70 gene increases Arabidopsis resistance to heat and other abiotic stresses. DOI: 10.1016/j.jplph.2009.11.012 ; PMID: 20080316
- Cytoplasmic H2O2 prevents translocation of NPR1 to the nucleus and inhibits the induction of PR genes in Arabidopsis. DOI: 10.4161/psb.5.11.13209 ; PMID: 21051935
- Functional characterization of a plasma membrane Na+/H+ antiporter from alkali grass (Puccinellia tenuiflora). DOI: 10.1007/s11033-010-0624-y ; PMID: 21153767
- Unraveling uranium induced oxidative stress related responses in Arabidopsis thaliana seedlings. Part I: responses in the roots. DOI: 10.1016/j.jenvrad.2011.03.015 ; PMID: 21492976
- RAP2.6L overexpression delays waterlogging induced premature senescence by increasing stomatal closure more than antioxidant enzyme activity. DOI: 10.1007/s11103-012-9936-8 ; PMID: 22661072
- Cytosolic ascorbate peroxidase 1 protects organelles against oxidative stress by and jasmonate-induced H(2)O(2) in Arabidopsis plants. DOI: 10.1016/j.bbagen.2012.08.003 ; PMID: 22921811
- Enhanced seed production under prolonged heat stress conditions in Arabidopsis thaliana plants deficient in cytosolic ascorbate peroxidase 2. DOI: 10.1093/jxb/ers335 ; PMID: 23183257
- Class III peroxidases are activated in proanthocyanidin-deficient Arabidopsis thaliana seeds. DOI: 10.1093/aob/mct045 ; PMID: 23448691
- Auxin induces redox regulation of ascorbate peroxidase 1 activity by S-nitrosylation/denitrosylation balance resulting in changes of root growth pattern in Arabidopsis. DOI: 10.1093/jxb/ert172 ; PMID: 23918967
- Fine tuning of reactive oxygen species homeostasis regulates primed immune responses in Arabidopsis. DOI: 10.1094/MPMI-04-13-0117-R ; PMID: 24088017
Gene Resources
- UniProt: A0A178W4H0
- EMBL: LUHQ01000001
- AlphaFoldDB: A0A178W4H0
- EnsemblPlants: AT1G04410.1
- Gramene: AT1G04410.1
- KEGG: ath:AT1G04410
- Orthologous matrix: GMIGSNM
- ExpressionAtlas: AT1G04410
- InterPro: IPR001236, IPR001252, IPR001557
- PANTHER: PTHR23382
- SUPFAM: SSF51735, SSF56327
- PROSITE: PS00068
- Gene3D: 3.40.50.720, 3.90.110.10
- SWISS-MODEL: A0A178W4H0
- Conserved Domain Database: cd01336
Homologs
Sequences
cDNA Sequence
- >AT1G04410.1
CTCAGATTTCGATTTATTTCTTCGAGATAATATGATTATATTAGATGACGTGGCGGTACATCCTTCGATATCTTCGATAAATACGCAAGAGTGAGCTTCACGGTCAGACAAAAGCTGACTCTACGCTCTCTCAAAAGTCGAATATCCCAAATTCGATCCGTTTTCCGGCGATAATCTCCGATCTAGATCCGATGGCGAAAGAACCAGTTCGTGTGCTCGTTACTGGAGCTGCAGGACAAATCGGATATGCTCTTGTACCTATGATTGCAAGGGGTATCATGCTTGGTGCTGACCAACCTGTTATCCTCCACATGTTGGATATTCCTCCAGCTGCTGAAGCTTTGAACGGTGTTAAGATGGAGTTGATCGATGCTGCTTTCCCTCTTCTTAAAGGTGTTGTTGCTACAACTGATGCCGTTGAGGGATGTACTGGAGTCAATGTTGCTGTTATGGTTGGTGGTTTCCCGAGGAAAGAAGGTATGGAGAGGAAGGATGTGATGTCCAAGAATGTTTCCATCTACAAGTCTCAGGCTGCTGCCTTGGAGAAGCATGCCGCTCCTAACTGCAAGGTTCTTGTTGTGGCCAACCCGGCAAACACCAACGCATTGATCCTCAAGGAATTTGCACCATCAATCCCTGAAAAGAACATCTCTTGTTTGACAAGGCTTGACCACAACAGGGCTTTGGGACAGATCTCTGAGAGGTTGAGCGTGCCAGTGTCTGATGTTAAGAACGTGATCATCTGGGGAAACCACTCATCCTCACAGTACCCAGATGTCAACCATGCTAAAGTGCAGACCTCGTCTGGAGAGAAGCCTGTCCGTGAGCTCGTCAAGGACGATGCATGGTTGGACGGAGAATTTATCTCTACAGTTCAACAACGTGGAGCTGCAATCATCAAGGCGAGGAAGTTGTCTAGTGCGCTCTCTGCTGCTAGCTCTGCTTGTGACCACATCCGTGACTGGGTCCTTGGAACTCCAGAGGGTACGTTCGTTTCCATGGGAGTATACTCCGATGGCTCTTACAGCGTTCCATCAGGACTTATCTACTCCTTCCCTGTAACTTGTCGCAATGGAGACTGGAGTATTGTCCAAGGCCTTCCGATTGATGAAGTATCAAGGAAGAAGATGGATTTGACTGCAGAGGAGCTCAAGGAAGAGAAGGACTTGGCGTACTCATGCCTCTCTTAAACCCTTCTGGAGCAAAATTTTCATCTATAAGGTGTGAGATCAGTTAAAGCCTTTCAGGGCTTTGTCCGAATAAGAAGTGTGTTTGAAAGATCTCCAAACACTGTTTTATAACCTCTTTGGTCTCTTTGATGAGTATTGTCCCTGGTCTGTTTCTAAACCAGGATATCGTTTTTTTCAATGTGTCTGATTTGGTTTACCCATGAAAAGAAGAAAATTGGCAGTTGCATGGTTATCTTTTGCGATTATTTTTTTCTGCTTTAGCAATTAGCCCAAAATTGATGAGCTCTTCGATAATGGGTTTGTGCAATTGTGATTTGTGAGGAATGGTGTTATTGTGTTGCAATTGCAAAAAGAAATGCTACTCTTGCAGATTCATACCAAAACCAAATCACTAGATTAAACTGAAATTCTAATGTGGATTAT
CDS Sequence
- >AT1G04410.1
ATGGCGAAAGAACCAGTTCGTGTGCTCGTTACTGGAGCTGCAGGACAAATCGGATATGCTCTTGTACCTATGATTGCAAGGGGTATCATGCTTGGTGCTGACCAACCTGTTATCCTCCACATGTTGGATATTCCTCCAGCTGCTGAAGCTTTGAACGGTGTTAAGATGGAGTTGATCGATGCTGCTTTCCCTCTTCTTAAAGGTGTTGTTGCTACAACTGATGCCGTTGAGGGATGTACTGGAGTCAATGTTGCTGTTATGGTTGGTGGTTTCCCGAGGAAAGAAGGTATGGAGAGGAAGGATGTGATGTCCAAGAATGTTTCCATCTACAAGTCTCAGGCTGCTGCCTTGGAGAAGCATGCCGCTCCTAACTGCAAGGTTCTTGTTGTGGCCAACCCGGCAAACACCAACGCATTGATCCTCAAGGAATTTGCACCATCAATCCCTGAAAAGAACATCTCTTGTTTGACAAGGCTTGACCACAACAGGGCTTTGGGACAGATCTCTGAGAGGTTGAGCGTGCCAGTGTCTGATGTTAAGAACGTGATCATCTGGGGAAACCACTCATCCTCACAGTACCCAGATGTCAACCATGCTAAAGTGCAGACCTCGTCTGGAGAGAAGCCTGTCCGTGAGCTCGTCAAGGACGATGCATGGTTGGACGGAGAATTTATCTCTACAGTTCAACAACGTGGAGCTGCAATCATCAAGGCGAGGAAGTTGTCTAGTGCGCTCTCTGCTGCTAGCTCTGCTTGTGACCACATCCGTGACTGGGTCCTTGGAACTCCAGAGGGTACGTTCGTTTCCATGGGAGTATACTCCGATGGCTCTTACAGCGTTCCATCAGGACTTATCTACTCCTTCCCTGTAACTTGTCGCAATGGAGACTGGAGTATTGTCCAAGGCCTTCCGATTGATGAAGTATCAAGGAAGAAGATGGATTTGACTGCAGAGGAGCTCAAGGAAGAGAAGGACTTGGCGTACTCATGCCTCTCTTAA
Protein Sequence
- >AT1G04410.1
MAKEPVRVLVTGAAGQIGYALVPMIARGIMLGADQPVILHMLDIPPAAEALNGVKMELIDAAFPLLKGVVATTDAVEGCTGVNVAVMVGGFPRKEGMERKDVMSKNVSIYKSQAAALEKHAAPNCKVLVVANPANTNALILKEFAPSIPEKNISCLTRLDHNRALGQISERLSVPVSDVKNVIIWGNHSSSQYPDVNHAKVQTSSGEKPVRELVKDDAWLDGEFISTVQQRGAAIIKARKLSSALSAASSACDHIRDWVLGTPEGTFVSMGVYSDGSYSVPSGLIYSFPVTCRNGDWSIVQGLPIDEVSRKKMDLTAEELKEEKDLAYSCLS