Information report for AT1G02450
Gene Details
|
|
Functional Descriptions
- PO:0000013 — cauline leaf — hoja caulinar (Spanish, exact), 茎生葉、茎葉 (Japanese, exact)
- PO:0000230 — inflorescence meristem — meristema de la inflorescencia (Spanish, exact), 花序分裂組織 (Japanese, exact)
- PO:0009010 — seed — semilla (Spanish, exact), 種子 (Japanese, exact), pyrene (narrow), diaspore (broad)
- PO:0009030 — carpel — carpelo (Spanish, exact), 心皮 (Japanese, exact), Poaceae carpel (narrow), Zea carpel (narrow), pistil (broad)
- PO:0009032 — petal — pétalo (Spanish, exact), 花弁 (Japanese, exact)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- GO:0005515 — enables — protein binding
- GO:0042742 — acts upstream of or within — defense response to bacterium
- GO:0045892 — acts upstream of or within — negative regulation of DNA-templated transcription
- GO:0010112 — acts upstream of or within — regulation of systemic acquired resistance
- GO:0005634 — located in — nucleus
Functional Keywords
- cauline leaf , inflorescence meristem , seed , carpel , petal , stem , pollen , guard cell
Literature and News
- Large-scale analysis of mRNA translation states during sucrose starvation in arabidopsis cells identifies cell proliferation and chromatin structure as targets of translational control. DOI: 10.1104/pp.106.079418 ; PMID: 16632591
- Dual targeting of Arabidopsis holocarboxylase synthetase1: a small upstream open reading frame regulates translation initiation and protein targeting. DOI: 10.1104/pp.107.111534 ; PMID: 18156294
- Genome-wide interacting effects of sucrose and herbicide-mediated stress in Arabidopsis thaliana: novel insights into atrazine toxicity and sucrose-induced tolerance. DOI: 10.1186/1471-2164-8-450 ; PMID: 18053238
- Chloroplast 2010: a database for large-scale phenotypic screening of Arabidopsis mutants. DOI: 10.1104/pp.110.170118 ; PMID: 21224340
- Genetic dissection of methylcrotonyl CoA carboxylase indicates a complex role for mitochondrial leucine catabolism during seed development and germination. DOI: 10.1111/j.1365-313X.2011.04893.x ; PMID: 22211474
- The Impact of the Branched-Chain Ketoacid Dehydrogenase Complex on Amino Acid Homeostasis in Arabidopsis. DOI: 10.1104/pp.15.00461 ; PMID: 25986129
- "Hit-and-Run" transcription: de novo transcription initiated by a transient bZIP1 "hit" persists after the "run". DOI: 10.1186/s12864-016-2410-2 ; PMID: 26843062
- MRF Family Genes Are Involved in Translation Control, Especially under Energy-Deficient Conditions, and Their Expression and Functions Are Modulated by the TOR Signaling Pathway. DOI: 10.1105/tpc.17.00563 ; PMID: 29084871
- Snf1-RELATED KINASE1-Controlled C/S(1)-bZIP Signaling Activates Alternative Mitochondrial Metabolic Pathways to Ensure Plant Survival in Extended Darkness. DOI: 10.1105/tpc.17.00414 ; PMID: 29348240
- Heterogeneity of the mitochondrial proteome for photosynthetic and non-photosynthetic Arabidopsis metabolism. DOI: 10.1074/mcp.M700535-MCP200 ; PMID: 18385124
- HCF152, an Arabidopsis RNA binding pentatricopeptide repeat protein involved in the processing of chloroplast psbB-psbT-psbH-petB-petD RNAs. DOI: 10.1105/tpc.010397 ; PMID: 12782738
- Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. DOI: 10.1006/jmbi.2000.4315 ; PMID: 11152613
- The Arabidopsis GPI-Anchored LTPg5 Encoded by At3g22600 Has a Role in Resistance against a Diverse Range of Pathogens. DOI: 10.3390/ijms21051774 ; PMID: 32150834
- Transfer RNA modifications and genes for modifying enzymes in Arabidopsis thaliana. DOI: 10.1186/1471-2229-10-201 ; PMID: 20836892
- Identification of tRNA nucleoside modification genes critical for stress response and development in rice and Arabidopsis. DOI: 10.1186/s12870-017-1206-0 ; PMID: 29268705
- Central functions of the lumenal and peripheral thylakoid proteome of Arabidopsis determined by experimentation and genome-wide prediction. DOI: 10.1105/tpc.010304 ; PMID: 11826309
- Arabidopsis thaliana plants lacking the PSI-D subunit of photosystem I suffer severe photoinhibition, have unstable photosystem I complexes, and altered redox homeostasis in the chloroplast stroma. DOI: 10.1074/jbc.M305106200 ; PMID: 12794067
- Process for the integrated extraction, identification and quantification of metabolites, proteins and RNA to reveal their co-regulation in biochemical networks. DOI: 10.1002/pmic.200200500 ; PMID: 14730673
- In-depth analysis of the thylakoid membrane proteome of Arabidopsis thaliana chloroplasts: new proteins, new functions, and a plastid proteome database. DOI: 10.1105/tpc.017814 ; PMID: 14729914
- Mutants for photosystem I subunit D of Arabidopsis thaliana: effects on photosynthesis, photosystem I stability and expression of nuclear genes for chloroplast functions. DOI: 10.1111/j.1365-313x.2004.02011.x ; PMID: 14996217
- New functions of the thylakoid membrane proteome of Arabidopsis thaliana revealed by a simple, fast, and versatile fractionation strategy. DOI: 10.1074/jbc.M406763200 ; PMID: 15322131
- Characterization of transformed Arabidopsis with altered alternative oxidase levels and analysis of effects on reactive oxygen species in tissue. DOI: 10.1104/pp.105.070763 ; PMID: 16299171
- Characterization of an Arabidopsis thaliana mutant lacking a cytosolic non-phosphorylating glyceraldehyde-3-phosphate dehydrogenase. DOI: 10.1007/s11103-006-0060-5 ; PMID: 16927206
Gene Resources
- UniProt: A0A178WC43
- EMBL: LUHQ01000001
- AlphaFoldDB: A0A178WC43
- EnsemblPlants: AT1G02450.1
- Gramene: AT1G02450.1
- KEGG: ath:AT1G02450
- Orthologous matrix: RWEDFTH
- ExpressionAtlas: AT1G02450
- InterPro: IPR031425
- PANTHER: PTHR33669, PTHR33669:SF1
- SWISS-MODEL: A0A178WC43
Sequences
cDNA Sequence
- >AT1G02450.1
CATCAGACGAAAAGGATTATTTGCCTTCTTCACTCTCCAAAATCAATCACTTTCTCTAAATGTATCCTAAACAATTTAGTTTATACAATTATTCCCTAGAGACCATGAGCAAGGATGAGAATGTGGAGAGCAAAGAGACGATCAGGGTTGATAAGAGAGTAAGAGAAGACGAAGAAGAGGAAGAAGAGAAGAAGATTGATACGTTCTTTAAGCTTATCAAACACTATCAAGAAGCACGGAAACGTAGACGAGAAGAGTTAGCTGAAAATTCTGGCGTCGTGAGGAGGAAATCTAACGGCGGAGAAAGGTCCGGTATAGTAGTTCCGGCGTTTCAGCCGGAGGATTTCTCTCAGTGTCGTACGGGTTTGAAGCCGCCATTGATGTTTGTTTCGGATCACAAGGAAGAAAATACAAAGGTGGAACAAGAAGAAGATCAAACAGAAGAGCGAAACGAAGACAAGGCTTTAGATCTTAATCTTGCATTGTAGTAGCAATTAGTTTTAATCTATTTTTAATTGTCCATGTTTCATTTGTTAGCGTTGTGATTATTAAATCCTTCATTTAACTAAAATGTCCGATAATTAACTTTAAAATGAATAAACTCAAAAGAATCGTGAGGCAAA
CDS Sequence
- >AT1G02450.1
ATGTATCCTAAACAATTTAGTTTATACAATTATTCCCTAGAGACCATGAGCAAGGATGAGAATGTGGAGAGCAAAGAGACGATCAGGGTTGATAAGAGAGTAAGAGAAGACGAAGAAGAGGAAGAAGAGAAGAAGATTGATACGTTCTTTAAGCTTATCAAACACTATCAAGAAGCACGGAAACGTAGACGAGAAGAGTTAGCTGAAAATTCTGGCGTCGTGAGGAGGAAATCTAACGGCGGAGAAAGGTCCGGTATAGTAGTTCCGGCGTTTCAGCCGGAGGATTTCTCTCAGTGTCGTACGGGTTTGAAGCCGCCATTGATGTTTGTTTCGGATCACAAGGAAGAAAATACAAAGGTGGAACAAGAAGAAGATCAAACAGAAGAGCGAAACGAAGACAAGGCTTTAGATCTTAATCTTGCATTGTAG
Protein Sequence
- >AT1G02450.1
MYPKQFSLYNYSLETMSKDENVESKETIRVDKRVREDEEEEEEKKIDTFFKLIKHYQEARKRRREELAENSGVVRRKSNGGERSGIVVPAFQPEDFSQCRTGLKPPLMFVSDHKEENTKVEQEEDQTEERNEDKALDLNLAL