Information report for AT1G02140
Gene Details
|
|
Functional Descriptions
- PO:0000013 — cauline leaf — hoja caulinar (Spanish, exact), 茎生葉、茎葉 (Japanese, exact)
- PO:0000230 — inflorescence meristem — meristema de la inflorescencia (Spanish, exact), 花序分裂組織 (Japanese, exact)
- PO:0009010 — seed — semilla (Spanish, exact), 種子 (Japanese, exact), pyrene (narrow), diaspore (broad)
- PO:0009030 — carpel — carpelo (Spanish, exact), 心皮 (Japanese, exact), Poaceae carpel (narrow), Zea carpel (narrow), pistil (broad)
- PO:0009032 — petal — pétalo (Spanish, exact), 花弁 (Japanese, exact)
- PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
- PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
- PO:0000084 — plant sperm cell — célula espermática o esperma (Spanish, exact), male gamete (exact), microgamete (exact), 植物精子細胞 (Japanese, exact), sperm nucleus (related), sperm cell (broad)
- PO:0025195 — pollen tube cell — célula del tubo polínico (Spanish, exact), 花粉管細胞 (Japanese, exact)
- PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)
- GO:0009793 — acts upstream of or within — embryo development ending in seed dormancy
- GO:0005730 — located in — nucleolus
- GO:0005654 — located in — nucleoplasm
- GO:0010628 — acts upstream of or within — positive regulation of gene expression
- GO:0010183 — acts upstream of or within — pollen tube guidance
- GO:0008380 — involved in — RNA splicing
- GO:0005634 — located in — nucleus
- GO:0035145 — part of — exon-exon junction complex
- GO:0005515 — enables — protein binding
- GO:0016607 — located in — nuclear speck
- CS16307 — Distorted segregation, reduced transmission through the male gametophyte, does not appreciably affect the female gametophyte; strong, but not complete impact on pollen function; pollen tubes fail to leave the septum.
Functional Keywords
- cauline leaf , inflorescence meristem , seed , carpel , petal , stem , pollen , plant sperm cell , pollen tube cell , guard cell
Literature and News
- The Polycomb group protein MEDEA controls cell proliferation and embryonic patterning in Arabidopsis. DOI: 10.1016/j.devcel.2021.06.004 ; PMID: 34192526
- A chloroplast-localized vesicular transport system: a bio-informatics approach. DOI: 10.1186/1471-2164-5-40 ; PMID: 15236667
- Study of the plant COPII vesicle coat subunits by functional complementation of yeast Saccharomyces cerevisiae mutants. DOI: 10.1371/journal.pone.0090072 ; PMID: 24587212
- Characterisation of a concentrative type of adenosine transporter from Arabidopsis thaliana (ENT1,At). DOI: 10.1016/s0014-5793(01)03195-7 ; PMID: 11749958
- AtBXL1, a novel higher plant (Arabidopsis thaliana) putative beta-xylosidase gene, is involved in secondary cell wall metabolism and plant development. DOI: 10.1046/j.1365-313x.2003.01654.x ; PMID: 12609041
- Expression of beta-galactosidase and beta-xylosidase genes during microspore and pollen development. DOI: 10.1007/s00425-004-1409-0 ; PMID: 15517348
- Apoplastic glycosidases active against xyloglucan oligosaccharides of Arabidopsis thaliana. DOI: 10.1093/pcp/pci223 ; PMID: 16267099
- Characterization of the VIER F-BOX PROTEINE genes from Arabidopsis reveals their importance for plant growth and development. DOI: 10.1105/tpc.105.040675 ; PMID: 17435085
- Identification of stress-tolerance-related transcription-factor genes via mini-scale Full-length cDNA Over-eXpressor (FOX) gene hunting system. DOI: 10.1016/j.bbrc.2007.09.124 ; PMID: 17937930
- Identification of novel factors that increase enzymatic saccharification efficiency in Arabidopsis wood cells. DOI: 10.5511/plantbiotechnology.17.1107a ; PMID: 31275029
- A sub-proteome of Arabidopsis thaliana mature stems trapped on Concanavalin A is enriched in cell wall glycoside hydrolases. DOI: 10.1093/jxb/erm082 ; PMID: 17526915
- Equilibrative nucleoside transporters of Arabidopsis thaliana. cDNA cloning, expression pattern, and analysis of transport activities. DOI: 10.1074/jbc.M304768200 ; PMID: 12810710
- and darkness-regulated Arabidopsis genes: a focus on calmodulin-like and XTH genes. DOI: 10.1111/j.1469-8137.2004.01238.x ; PMID: 15720654
- Cis-regulatory element based targeted gene finding: genome-wide identification of and abiotic stress-responsive genes in Arabidopsis thaliana. DOI: 10.1093/bioinformatics/bti490 ; PMID: 15890746
- but not monomethylation on histone H3 lysine 36 marks active transcription of genes involved in flowering time regulation and other processes in Arabidopsis thaliana. DOI: 10.1128/MCB.01607-07 ; PMID: 18070919
- Transcriptional responses of Arabidopsis thaliana plants to As (V) stress. DOI: 10.1186/1471-2229-8-87 ; PMID: 18684332
- Two Abscisic Acid-Responsive Plastid Lipase Genes Involved in Jasmonic Acid Biosynthesis in Arabidopsis thaliana. DOI: 10.1105/tpc.18.00250 ; PMID: 29666162
Gene Resources
- UniProt: A0A178WA48
- EMBL: CACRSJ010000104, CACSHJ010000087, LUHQ01000001
- AlphaFoldDB: A0A178WA48
- EnsemblPlants: AT1G02140.1
- Gramene: AT1G02140.1
- KEGG: ath:AT1G02140
- Orthologous matrix: VQDVKCF
- ExpressionAtlas: AT1G02140
- InterPro: IPR004023, IPR036605
- PANTHER: PTHR12638, PTHR12638:SF0
- SUPFAM: SSF89817
- Gene3D: 3.30.1560.10
- OrthoDB: A0A178WA48
- SWISS-MODEL: A0A178WA48
- Conserved Domain Database: cd11295
Sequences
cDNA Sequence
- >AT1G02140.1
AAAGGACACGGAGAGGTAATCTCGATCTCGAGAAAGAAAGAAAAAAAGAGAAGGCATGGCCGCGGAAGAAGCGACGGAGTTCTACCTGAGATACTATGTCGGTCACAAAGGGAAATTTGGACACGAGTTCCTGGAGTTCGAGTTTAGAGAGGACGGTAAGCTCCGTTACGCCAATAACTCTAACTACAAGAACGATACTATTATCCGCAAGGAGGTATTTCTCACCCCCGCCGTGCTCAAGGAATGCAAGCGTATCGTCTCCGAGAGCGAGATTCTGAAAGAAGACGATAACAATTGGCCGGAACCTGACCGTGTTGGAAAGCAAGAGCTCGAGATCGTCTTGGGTAATGAGCATATCTCATTCGCTACATCTAAGATTGGATCTCTTGTTGATTGCCAGAGCAGTAATGATCCTGAAGGACTTCGCATCTTCTACTATCTTGTTCAGGACTTGAAATGTCTTGTTTTTTCGCTCATCTCTCTGCACTTCAAAATCAAGCCTATCTAGAGAAGAAAATCAGTTTGTGACATGTCAAGACGCGATGAATTTGTTGGGAACATGAGGACTTTGTGACTGAAGTTTGGTTGTTTTTATGTCTCTGGTTCTCTGTTTTTTTTTTTTGTTGGATTTGGGTGAAAGTGGGTATGTAAGATGTTCTACCTCAACTTTTGGTCCTTTTTTGTGTCAACATCCCATGTGAAGAACCTTTCATGAACCACAACCTATCTTCTAAAAACCATATACTTGCTGTTTTCTTATCACAAATCATTCACTCTCCCTAATGTACATCTACATATGATGCATGTTTCTTTTCCCTCAAGCCAATTTAAACTAAGGAATGTGATCTATCTAAAATACAAAGTATCAAAAACTA
CDS Sequence
- >AT1G02140.1
ATGGCCGCGGAAGAAGCGACGGAGTTCTACCTGAGATACTATGTCGGTCACAAAGGGAAATTTGGACACGAGTTCCTGGAGTTCGAGTTTAGAGAGGACGGTAAGCTCCGTTACGCCAATAACTCTAACTACAAGAACGATACTATTATCCGCAAGGAGGTATTTCTCACCCCCGCCGTGCTCAAGGAATGCAAGCGTATCGTCTCCGAGAGCGAGATTCTGAAAGAAGACGATAACAATTGGCCGGAACCTGACCGTGTTGGAAAGCAAGAGCTCGAGATCGTCTTGGGTAATGAGCATATCTCATTCGCTACATCTAAGATTGGATCTCTTGTTGATTGCCAGAGCAGTAATGATCCTGAAGGACTTCGCATCTTCTACTATCTTGTTCAGGACTTGAAATGTCTTGTTTTTTCGCTCATCTCTCTGCACTTCAAAATCAAGCCTATCTAG
Protein Sequence
- >AT1G02140.1
MAAEEATEFYLRYYVGHKGKFGHEFLEFEFREDGKLRYANNSNYKNDTIIRKEVFLTPAVLKECKRIVSESEILKEDDNNWPEPDRVGKQELEIVLGNEHISFATSKIGSLVDCQSSNDPEGLRIFYYLVQDLKCLVFSLISLHFKIKPI