AT1G01510

Gene Details

Gene ID: AT1G01510
Gene Symbol: AN, DOQ
Gene Name: ANGUSTIFOLIA, DETORQUEO
Description: NAD(P)-binding Rossmann-fold superfamily protein;(source:Araport11)
TAIR Accession: locus:2025376
Genome: Araport11_genome_release
Species: Arabidopsis thaliana

Functional Descriptions

PO:0000013 — cauline leaf — hoja caulinar (Spanish, exact), 茎生葉、茎葉 (Japanese, exact)
PO:0000230 — inflorescence meristem — meristema de la inflorescencia (Spanish, exact), 花序分裂組織 (Japanese, exact)
PO:0009010 — seed — semilla (Spanish, exact), 種子 (Japanese, exact), pyrene (narrow), diaspore (broad)
PO:0009030 — carpel — carpelo (Spanish, exact), 心皮 (Japanese, exact), Poaceae carpel (narrow), Zea carpel (narrow), pistil (broad)
PO:0009032 — petal — pétalo (Spanish, exact), 花弁 (Japanese, exact)
PO:0009047 — stem — caña (Spanish, exact), culm (exact), eje primario (Spanish, exact), primary axis (exact), primary stem (exact), tallo (Spanish, exact), tronco (Spanish, exact), 茎 (Japanese, exact), bole (narrow), cane (narrow), caudex (narrow), caudices (narrow), core (narrow), primocane (narrow), scape (narrow), stalk (narrow), trunk (narrow)
PO:0025281 — pollen — polen (Spanish, exact), pollen grain (exact), 花粉 (Japanese, exact)
PO:0000293 — guard cell — célula guardiana (Spanish, exact), occlusive cell (exact), 孔辺細胞 (Japanese, exact)

GO:0034063 — acts upstream of or within — stress granule assembly
GO:0010091 — involved in — trichome branching
GO:0019900 — enables — kinase binding
GO:0042803 — enables — protein homodimerization activity
GO:0005802 — located in — trans-Golgi network
GO:0042814 — acts upstream of or within — monopolar cell growth
GO:0048826 — acts upstream of or within — cotyledon morphogenesis
GO:0048530 — involved in — fruit morphogenesis
GO:0009651 — acts upstream of or within — response to salt stress
GO:0042802 — enables — identical protein binding
GO:0003714 — enables — transcription corepressor activity
GO:0048444 — involved in — floral organ morphogenesis
GO:0006970 — acts upstream of or within — response to osmotic stress
GO:2000039 — involved in — regulation of trichome morphogenesis
GO:0009965 — acts upstream of or within — leaf morphogenesis
GO:0043621 — enables — protein self-association
GO:0005515 — enables — protein binding
GO:0007097 — acts upstream of or within — nuclear migration
GO:0005874 — located in — microtubule
GO:0045604 — involved in — regulation of epidermal cell differentiation
GO:0016616 — enables — oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor
GO:0005829 — located in — cytosol
GO:0010494 — located in — cytoplasmic stress granule
GO:0031129 — involved in — inductive cell-cell signaling
GO:0000226 — acts upstream of or within — microtubule cytoskeleton organization
GO:0051287 — enables — NAD binding
GO:0009507 — located in — chloroplast
GO:0010482 — involved in — regulation of epidermal cell division
GO:0008360 — involved in — regulation of cell shape

CS3137 — lacks trichomes on stems and leaves, some rudimentary trichomes in leaf margins, narrow leaves.
CS3139 — lacks trichomes on stems and leaves; narrow leaves; yellow seeds (lacks brown pigment in seed coat); light green plants, sensitive to some amino acids.
CS3144 — yellow-green cotyledons, leaf margins yellow; narrow leaves.
CS3237 — narrow, thick and slightly serrated leaves; lacks trichomes on leaf surface and stems, some rudimentary trichomes in leaf margins; yellow seeds (lacks brown pigment in seed coat).
CS3259 — narrow leaves; bright green stems and siliques, abnormal wax layer; fully fertile; compact habit, short petioles, blunt siliques; lacks trichomes on leaves and stems (glabrous), some trichomes in leaf margins.
CS3322 — leaves but not cotyledons white-yellow, conditional lethal, thiamine phosphate pyrophosphorylase deficient, thiamine restores to normal; narrow leaves.
CS3368 — angustifolia, apetala, pyrimidine requiring, erecta, long hypocotyl, glabra, brevipedicellus, eceriferum, transparent testa.
CS3400 — narrow and thick leaves, slightly twisted blunt siliques; compact rosettes and inflorescences; reduced plant height.
CS3436 — narrow and thick leaves; leaves but not cotyledons white-yellow, conditional lethal, thiamine phosphate pyrophosphorylase deficient, thiamine restores to normal; narrow leaves; yellow seeds (lacks brown pigment in seed coat); lacks trichomes on stems and leaves, some trichomes in leaf margins.
CS3595 — narrow leaves, slightly twisted siliques; compact rosette and inflorescences, short petioles, blunt siliques; leaves but not cotyledons white/pale; conditional lethal; blocked in the synthesis of the pyrimidine part of vitamin B1; 2,5-dimethyl-4-aminopyrimidine or thiamine restores to normal; lacks trichomes on stems and leaves.
CS8073 — narrow leaves; increased number of rosette leaves; slightly twisted siliques; background line for R. Wilson gai and gar mutants.
CS8074 — gibberellin insensitive; increased endogenous levels of gibberellic acid; reduced stature (dwarf), apical dominance, and seed germination; delayed flowering in short days; narrow leaves; increased number of rosette leaves; slightly twisted siliques
CS8076 — gar1 is semi-dominant or dominant, depending on GAI genotype; gar1 restores gibberellin responsiveness in gibberellin insensitive (gai) mutants; also restores normal stature, flowering time, apical dominance and seed germination to gai mutants (gai phenotype: semi-dominant mutation with reduced stature, reduced apical dominance, and reduced seed germination; delayed flowering in short days); an phenotype: narrow leaves, increased number of rosette leaves, slightly twisted siliques; gar1 closely linked to gai - not genetically separable.
CS8078 — gar2 is dominant; gar2 restores gibberellin responsiveness in gibberellin insensitive (gai) mutants; also restores flowering time, apical dominance and seed germination to gai mutants: partially restore normal stature (gai phenotype: semi-dominant mutation with reduced stature, reduced apical dominance, and reduced seed germination; delayed flowering in short days); an phenotype: narrow leaves, increased number of rosette leaves, slightly twisted siliques.
CS8079 — gar3 is semi-dominant; essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8080 — essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8081 — essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8082 — essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8083 — essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8084 — essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8085 — essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8086 — essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8087 — essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8088 — essentially normal growth (gai dwarf phenotype is largely suppressed); an phenotype: narrow leaves, slightly twisted siliques.
CS8089 — essentially normal growth (gai dwarf phenotype is largely suppressed), mutant possibly leaky; an phenotype: narrow leaves, slightly twisted siliques.
CS8090 — essentially normal growth (gai dwarf phenotype is largely suppressed), mutant possibly leaky; an phenotype: narrow leaves, slightly twisted siliques.
CS8091 — essentially normal growth (gai dwarf phenotype is largely suppressed), mutant possibly leaky; an phenotype: narrow leaves, slightly twisted siliques.
CS8092 — essentially normal growth (gai dwarf phenotype is largely suppressed), mutant possibly leaky; an phenotype: narrow leaves, slightly twisted siliques.
CS8093 — essentially normal growth (gai dwarf phenotype is largely suppressed), mutant possibly leaky; an phenotype: narrow leaves, slightly twisted siliques.
SALK_026489C — Impaired dark-induced nuclear positioning in pavement and mesophyll cells, smoother pavement cells, actin filaments in dark-adapted pavement cells aligned aberrantly along anticlinal walls, reduced number of actin filaments at the cell surface
an-2 — Phenotype not described.
an-EM1 — Trichomes of mutant undergo primary but not secondary branching.
an-EM1 nok-122 — Trichomes of mutant undergo primary but not secondary branching.
an-EM1 sta-23 — Unbranched trichomes.
frc1-1 an-496 — Predominantly produces unbranched trichomes.
frc2-1 an-496 — Predominantly produces unbranched trichomes.
frc3-1 an-496 — Predominantly produces unbranched trichomes.
frc4-1 an-496 — Predominantly produces unbranched trichomes.
gl-3 an-EM1 — Reduced, but still significant, number of branched trichomes.
try-EM1 an-EM1 — Trichomes have only one branch point.

Functional Keywords

Literature and News

Gene Resources

Homologs

Sequences

cDNA Sequence

>AT1G01510.1
TTTTGTAAGAGTTTACAACATTGAACCCTAAATCATTATGTTCCCAAAATCAAAATTTCACTCCTCGAGAGTAGCGAGAAGAAGGAGGAGATGAGCAAGATCCGTTCGTCTGCGACAATGCCACATCGCGACCAGCCGTCACCGGCGTCGCCTCACGTCGTTACACTCAACTGTATAGAGGATTGTGCGCTCGAGCAAGACTCCCTCGCCGGCGTTGCTGGTGTCGAATACGTCCCGCTCAGCCGCATCGCCGATGGTAAGATCGAGTCCGCCACCGCCGTTCTCCTCCATTCCCTCGCGTATCTTCCACGAGCAGCTCAACGCCGACTCCGTCCTCACCAGCTCATTCTCTGCCTTGGCTCTGCTGATCGCGCTGTCGATTCGACTCTCGCCGCCGACCTAGGTCTCCGACTTGTCCATGTAGATACTTCACGAGCCGAGGAAATCGCGGATACCGTCATGGCGCTCATCCTTGGACTCCTTCGACGGACGCATTTACTCTCGCGACACGCTCTATCGGCGTCTGGTTGGCTCGGATCGCTTCAGCCTCTTTGCCGGGGAATGAGACGGTGCCGTGGTATGGTTTTGGGTATCGTTGGCAGATCTGTATCGGCTCGGTATTTAGCTAGTAGAAGCTTGGCTTTCAAGATGAGTGTGCTCTACTTCGATGTCCCAGAGGGAGATGAAGAACGAATCAGGCCCTCGAGATTCCCACGTGCTGCTCGAAGAATGGATACATTGAATGATCTTCTAGCAGCAAGTGATGTCATTTCGCTACATTGTGCATTAACAAATGACACGGTTCAGATACTCAATGCAGAGTGTTTGCAGCATATAAAACCTGGGGCTTTTCTTGTAAATACTGGAAGCTGCCAGCTGTTGGATGATTGTGCTGTGAAACAACTTCTAATTGATGGCACTATAGCTGGCTGCGCCCTTGACGGTGCTGAAGGTCCACAATGGATGGAAGCATGGGTGAAGGAAATGCCAAATGTGTTAATTCTACCTCGCAGTGCAGATTACAGTGAGGAAGTATGGATGGAGATAAGGGAGAAGGCTATCTCTATCTTGCATTCATTTTTCTTAGATGGTGTAATTCCAAGTAACACTGTTTCTGATGAGGAAGTTGAGGAAAGTGAAGCAAGTGAAGAAGAAGAACAATCACCTAGCAAACACGAGAAATTAGCAATAGTGGAATCCACCAGTAGGCAACAGGGAGAAAGTACTCTCACCAGCACTGAGATCGTACGTAGAGAGGCTAGTGAGTTAAAAGAATCTCTGAGCCCTGGTCAGCAACACGTTTCTCAAAATACTGCCGTAAAACCTGAAGGAAGACGTAGCAGATCCGGTAAGAAAGCCAAAAAGAGACATTCACAGCAAAAATACATGCAAAAAACGGATGGTTCCTCAGGGTTAAATGAAGAAAGTACTTCACGAAGAGATGATATTGCTATGAGTGACACAGAAGAAGTATTAAGTTCCAGTTCTAGATGTGCTTCTCCTGAAGATTCCAGAAGTAGGAAAACACCTCTTGAAGTAATGCAAGAGTCTTCCCCAAATCAGCTTGTAATGTCAAGTAAGAAGTTCATTGGAAAGTCAAGTGAGCTACTGAAAGATGGATATGTAGTAGCCTTGTATGCGAAAGACCTCTCGGGCCTCCACGTTTCCAGGCAAAGAACGAAAAACGGTGGCTGGTTCCTCGATACTTTGTCCAATGTATCCAAACGAGATCCTGCTGCACAATTCATTATCGCATACAGAAACAAGGACACTGTTGGTCTGAGATCATTTGCTGCTGGTGGGAAGTTACTGCAGATCAATAGAAGAATGGAGTTTGTGTTTGCTAGCCATAGTTTTGACGTGTGGGAGAGTTGGAGTCTAGAAGGTTCTCTGGACGAATGTCGGCTTGTTAACTGCAGGAATTCCTCTGCGGTGTTGGACGTTCGTGTGGAGATATTGGCAATGGTAGGAGACGATGGTATCACACGTTGGATCGATTAAAAAGAAAAACAGAGTCTCTCCATTTGTGAGTTTCTCTCTTTTAATTACTTTTGTTACTTTAACATCCTTAGGATTCACAGACGAAAAACAGAGACACCCAATTTTTGTGTTTCGAGACTGTGTCGTGTGTTGTGTAGTTGGTATCAACCAACTTATATCTGTAATCATTGTTTCTTTTTATTTATTCTCGGTTTGCAGAAACATCCGATGAGCTTGTCTTAGAGGGACGTTTGTTGTTGTTTTCTGGGTCTGGTCGTGATGAACTCGAAAGCATTGTGTGTTTGGTTAGTAGTTTGAAATAGGTGTGTGTATTGTATTTGTATATGCTGCGTTTGTGTTTTAGAGATCATCGTACATAAAACACATCATCGTACATAACTAAAATTTGAGCTAAACTACAAAAGAAAGTAACCTTCATTTTTAGTCGAACCAGGCCCCAGCTAGGCAGCTATCTCGTAAATAAGATTGCTGGCTTACGATCGTATTCCACGTGGCAATTTATGTGCCGTGGATTTAAATTTGTACGTGGCATGAGTGTTAGGAGAATGTCCACATGGCTTGTAGTTGTTAGTCCCACGCTCTGAACCAGAGCAACCGGCTCCTTACACGTGTTCGGCTTAAATCCATTTTTCGAAT

CDS Sequence

>AT1G01510.1
ATGAGCAAGATCCGTTCGTCTGCGACAATGCCACATCGCGACCAGCCGTCACCGGCGTCGCCTCACGTCGTTACACTCAACTGTATAGAGGATTGTGCGCTCGAGCAAGACTCCCTCGCCGGCGTTGCTGGTGTCGAATACGTCCCGCTCAGCCGCATCGCCGATGGTAAGATCGAGTCCGCCACCGCCGTTCTCCTCCATTCCCTCGCGTATCTTCCACGAGCAGCTCAACGCCGACTCCGTCCTCACCAGCTCATTCTCTGCCTTGGCTCTGCTGATCGCGCTGTCGATTCGACTCTCGCCGCCGACCTAGGTCTCCGACTTGTCCATGTAGATACTTCACGAGCCGAGGAAATCGCGGATACCGTCATGGCGCTCATCCTTGGACTCCTTCGACGGACGCATTTACTCTCGCGACACGCTCTATCGGCGTCTGGTTGGCTCGGATCGCTTCAGCCTCTTTGCCGGGGAATGAGACGGTGCCGTGGTATGGTTTTGGGTATCGTTGGCAGATCTGTATCGGCTCGGTATTTAGCTAGTAGAAGCTTGGCTTTCAAGATGAGTGTGCTCTACTTCGATGTCCCAGAGGGAGATGAAGAACGAATCAGGCCCTCGAGATTCCCACGTGCTGCTCGAAGAATGGATACATTGAATGATCTTCTAGCAGCAAGTGATGTCATTTCGCTACATTGTGCATTAACAAATGACACGGTTCAGATACTCAATGCAGAGTGTTTGCAGCATATAAAACCTGGGGCTTTTCTTGTAAATACTGGAAGCTGCCAGCTGTTGGATGATTGTGCTGTGAAACAACTTCTAATTGATGGCACTATAGCTGGCTGCGCCCTTGACGGTGCTGAAGGTCCACAATGGATGGAAGCATGGGTGAAGGAAATGCCAAATGTGTTAATTCTACCTCGCAGTGCAGATTACAGTGAGGAAGTATGGATGGAGATAAGGGAGAAGGCTATCTCTATCTTGCATTCATTTTTCTTAGATGGTGTAATTCCAAGTAACACTGTTTCTGATGAGGAAGTTGAGGAAAGTGAAGCAAGTGAAGAAGAAGAACAATCACCTAGCAAACACGAGAAATTAGCAATAGTGGAATCCACCAGTAGGCAACAGGGAGAAAGTACTCTCACCAGCACTGAGATCGTACGTAGAGAGGCTAGTGAGTTAAAAGAATCTCTGAGCCCTGGTCAGCAACACGTTTCTCAAAATACTGCCGTAAAACCTGAAGGAAGACGTAGCAGATCCGGTAAGAAAGCCAAAAAGAGACATTCACAGCAAAAATACATGCAAAAAACGGATGGTTCCTCAGGGTTAAATGAAGAAAGTACTTCACGAAGAGATGATATTGCTATGAGTGACACAGAAGAAGTATTAAGTTCCAGTTCTAGATGTGCTTCTCCTGAAGATTCCAGAAGTAGGAAAACACCTCTTGAAGTAATGCAAGAGTCTTCCCCAAATCAGCTTGTAATGTCAAGTAAGAAGTTCATTGGAAAGTCAAGTGAGCTACTGAAAGATGGATATGTAGTAGCCTTGTATGCGAAAGACCTCTCGGGCCTCCACGTTTCCAGGCAAAGAACGAAAAACGGTGGCTGGTTCCTCGATACTTTGTCCAATGTATCCAAACGAGATCCTGCTGCACAATTCATTATCGCATACAGAAACAAGGACACTGTTGGTCTGAGATCATTTGCTGCTGGTGGGAAGTTACTGCAGATCAATAGAAGAATGGAGTTTGTGTTTGCTAGCCATAGTTTTGACGTGTGGGAGAGTTGGAGTCTAGAAGGTTCTCTGGACGAATGTCGGCTTGTTAACTGCAGGAATTCCTCTGCGGTGTTGGACGTTCGTGTGGAGATATTGGCAATGGTAGGAGACGATGGTATCACACGTTGGATCGATTAA

Protein Sequence

>AT1G01510.1
MSKIRSSATMPHRDQPSPASPHVVTLNCIEDCALEQDSLAGVAGVEYVPLSRIADGKIESATAVLLHSLAYLPRAAQRRLRPHQLILCLGSADRAVDSTLAADLGLRLVHVDTSRAEEIADTVMALILGLLRRTHLLSRHALSASGWLGSLQPLCRGMRRCRGMVLGIVGRSVSARYLASRSLAFKMSVLYFDVPEGDEERIRPSRFPRAARRMDTLNDLLAASDVISLHCALTNDTVQILNAECLQHIKPGAFLVNTGSCQLLDDCAVKQLLIDGTIAGCALDGAEGPQWMEAWVKEMPNVLILPRSADYSEEVWMEIREKAISILHSFFLDGVIPSNTVSDEEVEESEASEEEEQSPSKHEKLAIVESTSRQQGESTLTSTEIVRREASELKESLSPGQQHVSQNTAVKPEGRRSRSGKKAKKRHSQQKYMQKTDGSSGLNEESTSRRDDIAMSDTEEVLSSSSRCASPEDSRSRKTPLEVMQESSPNQLVMSSKKFIGKSSELLKDGYVVALYAKDLSGLHVSRQRTKNGGWFLDTLSNVSKRDPAAQFIIAYRNKDTVGLRSFAAGGKLLQINRRMEFVFASHSFDVWESWSLEGSLDECRLVNCRNSSAVLDVRVEILAMVGDDGITRWID